ID: 950515015

View in Genome Browser
Species Human (GRCh38)
Location 3:13459470-13459492
Sequence TCTCTTGGTGTTGGTCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950515015_950515026 19 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515026 3:13459512-13459534 GGACCAAGGAGGCAGTCTGATGG No data
950515015_950515020 -7 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515020 3:13459486-13459508 CAAGAGAAGAATGGGAAGAATGG No data
950515015_950515025 8 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515025 3:13459501-13459523 AAGAATGGGGAGGACCAAGGAGG No data
950515015_950515021 -6 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515021 3:13459487-13459509 AAGAGAAGAATGGGAAGAATGGG No data
950515015_950515024 5 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515024 3:13459498-13459520 GGGAAGAATGGGGAGGACCAAGG No data
950515015_950515022 -5 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515022 3:13459488-13459510 AGAGAAGAATGGGAAGAATGGGG No data
950515015_950515023 -2 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515023 3:13459491-13459513 GAAGAATGGGAAGAATGGGGAGG No data
950515015_950515028 24 Left 950515015 3:13459470-13459492 CCAGAATGACCAACACCAAGAGA No data
Right 950515028 3:13459517-13459539 AAGGAGGCAGTCTGATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950515015 Original CRISPR TCTCTTGGTGTTGGTCATTC TGG (reversed) Intergenic
No off target data available for this crispr