ID: 950516660

View in Genome Browser
Species Human (GRCh38)
Location 3:13470878-13470900
Sequence CTGGATGAACACAGCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950516660_950516667 24 Left 950516660 3:13470878-13470900 CCATGCAGGCTGTGTTCATCCAG No data
Right 950516667 3:13470925-13470947 TTGGTGCCAGGCACTGTGCTGGG No data
950516660_950516664 5 Left 950516660 3:13470878-13470900 CCATGCAGGCTGTGTTCATCCAG No data
Right 950516664 3:13470906-13470928 AATGTTTAGTGGATGCAGATTGG No data
950516660_950516666 23 Left 950516660 3:13470878-13470900 CCATGCAGGCTGTGTTCATCCAG No data
Right 950516666 3:13470924-13470946 ATTGGTGCCAGGCACTGTGCTGG No data
950516660_950516662 -6 Left 950516660 3:13470878-13470900 CCATGCAGGCTGTGTTCATCCAG No data
Right 950516662 3:13470895-13470917 ATCCAGGCACAAATGTTTAGTGG No data
950516660_950516665 12 Left 950516660 3:13470878-13470900 CCATGCAGGCTGTGTTCATCCAG No data
Right 950516665 3:13470913-13470935 AGTGGATGCAGATTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950516660 Original CRISPR CTGGATGAACACAGCCTGCA TGG (reversed) Intergenic
No off target data available for this crispr