ID: 950517898

View in Genome Browser
Species Human (GRCh38)
Location 3:13479628-13479650
Sequence CCTGGCTCAGCTTACCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950517887_950517898 7 Left 950517887 3:13479598-13479620 CCCCACGGACAACCCCAGCTGTC 0: 1
1: 0
2: 1
3: 11
4: 106
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517894_950517898 -6 Left 950517894 3:13479611-13479633 CCCAGCTGTCGCTTGGGCCTGGC 0: 1
1: 0
2: 2
3: 10
4: 184
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517884_950517898 22 Left 950517884 3:13479583-13479605 CCTCCTGGGTTGCAGCCCCACGG 0: 1
1: 0
2: 1
3: 9
4: 205
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517895_950517898 -7 Left 950517895 3:13479612-13479634 CCAGCTGTCGCTTGGGCCTGGCT 0: 1
1: 0
2: 0
3: 19
4: 137
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517883_950517898 25 Left 950517883 3:13479580-13479602 CCTCCTCCTGGGTTGCAGCCCCA 0: 1
1: 0
2: 2
3: 95
4: 639
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517888_950517898 6 Left 950517888 3:13479599-13479621 CCCACGGACAACCCCAGCTGTCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517886_950517898 19 Left 950517886 3:13479586-13479608 CCTGGGTTGCAGCCCCACGGACA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517892_950517898 -5 Left 950517892 3:13479610-13479632 CCCCAGCTGTCGCTTGGGCCTGG 0: 1
1: 0
2: 5
3: 19
4: 189
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149
950517889_950517898 5 Left 950517889 3:13479600-13479622 CCACGGACAACCCCAGCTGTCGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950517898 Original CRISPR CCTGGCTCAGCTTACCCCGG CGG Intergenic
901201358 1:7469189-7469211 CCTGGCTCTGCCTCCCCTGGAGG + Intronic
902308686 1:15563736-15563758 CCTGGCTCAGCCTTCCCAAGTGG - Intronic
902630808 1:17703265-17703287 CCTGGCTGAGCTGCCCCTGGAGG + Intergenic
903126489 1:21251720-21251742 CCTGGATCAGCATCCCCAGGAGG + Intronic
904229189 1:29053271-29053293 TCTGGCTCAGCTTGCTCAGGTGG - Exonic
904455167 1:30643061-30643083 CCTGGCTCAGCTTCACCCCAGGG - Intergenic
904737331 1:32644642-32644664 TCTGGCTCAGCTTCCCCAGTAGG + Intronic
907408230 1:54267109-54267131 CCTGGCTGAGATGACCCCAGAGG - Intronic
907917154 1:58881686-58881708 CATGACTCAGCTTTCCCTGGGGG - Intergenic
907962432 1:59296439-59296461 CCTTGCGGAGCTTACCCAGGCGG - Intergenic
908514649 1:64880120-64880142 CCTGGCCCAGCACACCCAGGCGG + Intronic
910633699 1:89383763-89383785 CAGGGCTCAGCTTACACAGGAGG + Intronic
912827044 1:112915123-112915145 ACTGGCTCAGCTAAGCCCTGAGG + Intronic
913451144 1:118993400-118993422 CCTGCCTCAGGTTACCAAGGCGG + Intergenic
913452317 1:119000681-119000703 CCTTGCTCATCTGACTCCGGAGG - Intergenic
914756317 1:150563396-150563418 CCTGGGTCAGTTTACTCTGGTGG - Intergenic
920965599 1:210698317-210698339 CCTCCCACAGCTTACCCCGTGGG + Intronic
922455569 1:225771093-225771115 CCTGACCCAGCTTCCCCCAGAGG + Intergenic
924907611 1:248473327-248473349 ACTGGCTCAGTTTCCCCCTGAGG - Intergenic
1063177739 10:3567586-3567608 CCTGCCTCTGCTTACCCCACGGG + Intergenic
1065123988 10:22555160-22555182 CATGGCTCAGCTTTCCACGTAGG + Intronic
1069209261 10:65735127-65735149 CCTGCCTCAGCTTACCAAGTAGG - Intergenic
1075102784 10:119517953-119517975 CAGGGCTCAGCTTATCTCGGCGG + Intronic
1076107319 10:127834041-127834063 CCTGGCTCAGCTGAGCCCAGGGG - Intergenic
1076174703 10:128359176-128359198 CCTGGATCAGCTCATCCCTGTGG - Intergenic
1076307127 10:129473340-129473362 CATGGTTCAGCTCACCCTGGTGG + Intronic
1076614945 10:131749081-131749103 CCTGCCTCAGCTGACGCCTGGGG - Intergenic
1079307496 11:19336423-19336445 CCTTGCTCAGCTTAGCCTGCTGG + Intergenic
1083270539 11:61570011-61570033 CCTGGCTCAGCCTACTCGAGGGG - Intronic
1083941955 11:65900586-65900608 CCCGGCTCGGCGTTCCCCGGAGG + Intergenic
1084150410 11:67285568-67285590 CCTGGCCCAGCTCCCCCGGGAGG + Exonic
1084361172 11:68669568-68669590 TCTGGGTCAGCTGACCCTGGTGG - Intergenic
1084517477 11:69644557-69644579 CCGGGCTCAGCTGAGCCCTGAGG + Intronic
1085614950 11:77990277-77990299 CCTGGCTCAGCCTTCCACGTAGG - Intronic
1089377077 11:118002055-118002077 CCTGGCTCCCCTTGCCCAGGAGG + Intergenic
1092149772 12:6239631-6239653 TGTGGTTCAGCTTACCCAGGTGG + Intergenic
1092239533 12:6828512-6828534 CCTGACCCAGCTGTCCCCGGGGG + Exonic
1105388700 13:19957581-19957603 CCTGACTCCGCTCCCCCCGGCGG + Intergenic
1105969717 13:25417212-25417234 CCTGGCTCAGCCTAAACTGGGGG - Intronic
1106938472 13:34750215-34750237 CCTGCCTCCGCTTCCCCCTGGGG + Intergenic
1117149685 14:52872784-52872806 CCAGGCTCTCCTTACCCCTGAGG + Exonic
1119183226 14:72618402-72618424 CCTGGTTCAGCTTCTCCTGGTGG - Intergenic
1119198064 14:72732143-72732165 TCTGGCTCAGCTTCCTCTGGGGG - Intronic
1119864995 14:77966128-77966150 CCTGGCTCAGCCCCTCCCGGCGG + Intergenic
1122290720 14:100679000-100679022 CCTGGCTGGGCTTACCCTGAGGG - Intergenic
1122691025 14:103532227-103532249 CCTTGCACAGATTTCCCCGGAGG + Intronic
1122737158 14:103849400-103849422 TTTGGATCACCTTACCCCGGGGG - Intergenic
1122952956 14:105056058-105056080 GCTGGCCCACCTTCCCCCGGCGG + Exonic
1124719626 15:32100010-32100032 CCTGGCCCATCTCACCCCAGAGG + Intronic
1125669781 15:41462462-41462484 CCTGCCTCAGCTTCCTCCTGGGG + Intronic
1128173776 15:65535805-65535827 CCTGGCTCAGCCTACCAAGTAGG + Intronic
1128236949 15:66074126-66074148 TCAGGCTCAGGTTACCCCTGGGG - Intronic
1130140737 15:81224420-81224442 CCTGGCTCAGCTTTGCCAAGAGG - Intronic
1134200702 16:12196214-12196236 CCTGTCTCAGCCTCCCCAGGTGG + Intronic
1135356557 16:21773795-21773817 CCTGGTTCAGGCTACGCCGGAGG - Intergenic
1135435772 16:22425722-22425744 CCAGGCTCTGCTTTCCCCAGGGG - Intronic
1135455056 16:22589938-22589960 CCTGGTTCAGGCTACGCCGGAGG - Intergenic
1136534844 16:30893505-30893527 CCTGGCTCTGCGGACCCCTGGGG + Intronic
1138119962 16:54392172-54392194 CCTGCCTCAGCTTCCCAAGGTGG + Intergenic
1141584458 16:85024341-85024363 CCTGCCTCAGCCTACCCAGTAGG + Intergenic
1142034390 16:87854662-87854684 CCTGGCCCAGCTGTCCCCGCAGG - Intronic
1145989090 17:29067525-29067547 CATGGCTCATCTTAACCCTGGGG - Intergenic
1146281690 17:31549363-31549385 CCTGGATGACCTTGCCCCGGAGG - Intergenic
1147965130 17:44190628-44190650 CCTGGAACAGCTGACCCTGGGGG - Exonic
1148747063 17:49924392-49924414 CCTGGCTCTGATTACCCCCCGGG + Intergenic
1148807299 17:50270457-50270479 CCTGGCTCAGCCCAGCCCAGGGG - Intergenic
1151479662 17:74362524-74362546 CCTGGCTCAGCTTGCCCCTGGGG - Intergenic
1151910697 17:77080960-77080982 CCTGCCTCAGCCTACTCGGGAGG - Intergenic
1152729663 17:81963221-81963243 CCTGGGTCAGCCTTCCCCGCCGG - Intergenic
1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG + Intronic
1153529641 18:6032087-6032109 CCTGCCTCAGCTTCCCCAGTAGG + Intronic
1153562705 18:6387199-6387221 CCTGTTTCAGCTTCCCCTGGAGG - Intronic
1154240301 18:12647502-12647524 CCTGCCTCAGCTTCCCACAGTGG - Intronic
1155974145 18:32109772-32109794 CCTGCCTCAGCCTACCCAGTAGG - Intronic
1160567776 18:79797969-79797991 CCGGGCTCCGCTTACCCGGCCGG - Intergenic
1160724829 19:613533-613555 CCTGGCTCTGCACACCGCGGGGG - Intronic
1160793252 19:932647-932669 CCTGGCCCTGCCCACCCCGGAGG + Exonic
1161451140 19:4346043-4346065 CCTGGCACAGCTCTCTCCGGAGG + Intronic
1163124914 19:15239547-15239569 CCTGGCCCACCTCACCCCAGTGG + Intronic
1163596772 19:18225205-18225227 CCTGGCTCAGTTTACCCCCCTGG - Intronic
1166076105 19:40414690-40414712 CCTGACTCACCAGACCCCGGGGG + Intergenic
1166591077 19:43999273-43999295 CATAGCTCAGCATACCCCAGTGG + Intergenic
1166597972 19:44067649-44067671 CATAGCTCAGCATACCCCAGTGG + Exonic
1166803372 19:45471184-45471206 CCTGACTCAGCTCACCCCAGAGG + Exonic
1166956350 19:46468077-46468099 CCTGGCTTAACTTACCCCGCTGG + Exonic
925293859 2:2765391-2765413 CCTGGCTCAGCCTGCACCGTGGG - Intergenic
927711963 2:25331804-25331826 CCTGGCTCAGCCTCCCCCTGGGG + Intronic
932333855 2:70918217-70918239 CCTGGCTCACCTTTTCCCTGAGG + Intronic
932470522 2:71952209-71952231 CCTATCTCAGCTTTCCCAGGTGG - Intergenic
932892501 2:75609151-75609173 CCTGGCTGAGGTTACCACTGAGG + Intergenic
938414165 2:131090838-131090860 CCTGCCTCAGCCTCCCCCAGTGG + Intronic
939139467 2:138336338-138336360 CCTGGCTCAGCTTTCCCTCAGGG + Intergenic
941095627 2:161237696-161237718 CCCGGTGCAGCTTTCCCCGGAGG + Intergenic
941996489 2:171606211-171606233 CCTGCCTCAGCTTCCCCAGTGGG + Intergenic
945195954 2:207237907-207237929 TCTGACTCAGCCAACCCCGGTGG + Intergenic
947718377 2:232352890-232352912 CCAGGATCAGCTCTCCCCGGGGG + Intergenic
948876535 2:240832601-240832623 CCTAGCTCAGCTCGCCCCGCGGG - Intergenic
948879583 2:240850037-240850059 CCTCCCTCAGCTTAGCCCTGGGG - Intergenic
1171763313 20:29233159-29233181 CCTGGAGCAGCTTACCTGGGAGG - Intergenic
1173234534 20:41232699-41232721 CCTGCCTCAGCCTCCCGCGGGGG + Intronic
1173249814 20:41358495-41358517 CCTGGATGAGCTCTCCCCGGGGG - Exonic
1173993521 20:47320611-47320633 CCTGCCTCAGCTTCCCCAGTAGG - Intronic
1175562295 20:59940378-59940400 CCTGGCTGAGCTGAGGCCGGCGG - Intronic
1175789272 20:61731409-61731431 CCTGACTGAGCATACCCCTGTGG - Intronic
1175941595 20:62539873-62539895 CCTGGCTCAGCAGAGCCAGGAGG + Intergenic
1178975529 21:37218056-37218078 CCTGGCCCAGCCTCCCCAGGTGG + Intergenic
1179044392 21:37831721-37831743 CCTAGCTCAGCTCACCCTGCAGG + Intronic
1179466748 21:41580988-41581010 CCTGGCTCAGCATCTCCCGGAGG - Intergenic
1180296568 22:10942970-10942992 CCAGGCTCAGCTGACTCCAGAGG - Intergenic
1180970314 22:19811711-19811733 CCTAGCTCACCTTTCCCCTGAGG + Intronic
1182584636 22:31337359-31337381 CCTGACTCATCCAACCCCGGGGG - Intronic
1183295770 22:37028602-37028624 CCTGCCTCAGCTTCCCCCCGAGG - Intronic
1183393798 22:37560567-37560589 CCTGGCTCCGCGAGCCCCGGGGG - Exonic
1183797346 22:40130669-40130691 CCTGCCTCAGCCTCCCGCGGGGG - Intronic
1184089000 22:42282751-42282773 CCCTCCTCAGCTCACCCCGGAGG - Intronic
1184268478 22:43363738-43363760 CCAGGCTCAGCTTCCCCCAGTGG + Intergenic
950298718 3:11855352-11855374 CCTGCCTCAGCCTCCCCCGTAGG + Intergenic
950469244 3:13174446-13174468 CCTGGCCCAGCTGACCCCCATGG + Intergenic
950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG + Intergenic
961677451 3:128576307-128576329 CAGGGCTCAGCTTTCCCCGTGGG - Intergenic
962818187 3:139020879-139020901 CCGGGCTCAGCTTAGCTCGTTGG + Exonic
964525700 3:157613624-157613646 CCAGGCTCTGCTGACCCCTGCGG - Intronic
968626769 4:1629377-1629399 CCAGGCTCCGCTTTCCCTGGCGG - Intronic
969112908 4:4854744-4854766 TCTGGCTCTGCCCACCCCGGCGG - Intergenic
970371549 4:15412139-15412161 CCTGGCTCTGATCACCCCAGAGG + Intronic
975798579 4:78035081-78035103 CCTCCCTCAGCTTATCCCTGTGG + Intergenic
977600548 4:98929692-98929714 CCTGGCTCAGCTAATGCTGGTGG + Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
984834025 4:184002510-184002532 CCTGGCTCAGCTGACTCCTGGGG - Intronic
985223817 4:187737870-187737892 CCTGGCTCACCTTTCCACTGGGG + Intergenic
985705774 5:1400601-1400623 CCTGGCTCAGCTGGCCCCACAGG + Intronic
986417594 5:7544660-7544682 CATGGCTCAGCTCACCCCTGGGG + Intronic
997226253 5:132211522-132211544 CCAGGGTCTGCTAACCCCGGTGG + Intronic
998232720 5:140371617-140371639 CCTGCCTCAGCTTACCATGAGGG - Exonic
1001449643 5:171814723-171814745 CCTAGCCCAGCTCACCCAGGAGG + Intergenic
1006262409 6:32886286-32886308 CATGCCTCGGCTTACCCAGGGGG - Intergenic
1008414061 6:51218785-51218807 CCTGTCTCAGATTCCCCCTGGGG + Intergenic
1013227923 6:108133979-108134001 CCAGGCGCAGCTTCCCCCAGAGG + Intronic
1017324537 6:153130799-153130821 CCTGGCCGAGCGTTCCCCGGCGG + Intronic
1017748989 6:157472089-157472111 CCTTCCTCAGCTCACCCCAGAGG - Intronic
1018698900 6:166411999-166412021 CCAGTCTCGGCTTTCCCCGGGGG - Exonic
1019483669 7:1277740-1277762 CCAGGCTCAGCTTTCCCCACTGG - Intergenic
1019747614 7:2709449-2709471 CCTGACTCACCTTTCCCCTGGGG + Intronic
1023818975 7:43969861-43969883 CCTGGCTGAGCTGACCCCACAGG - Intergenic
1025252846 7:57363413-57363435 CCTGGCTCAGCTCAGGCCTGGGG + Intergenic
1028621375 7:92833081-92833103 CCTGGCTCACCTGACCACGTTGG + Exonic
1029376220 7:100178231-100178253 CCTGGAGCCGCTTACCCCAGGGG + Intronic
1029552398 7:101244404-101244426 CCCGGAGCAGCTGACCCCGGCGG + Intronic
1029744026 7:102506824-102506846 CCTGGCTGAGCTGACCCCACAGG - Exonic
1029762016 7:102605987-102606009 CCTGGCTGAGCTGACCCCACAGG - Exonic
1035210814 7:157326797-157326819 CCTGCCTCAGCTTCCCAAGGAGG + Intergenic
1039823991 8:41157517-41157539 CCCAGCTCAGCTTACCCCTGTGG + Intergenic
1040931254 8:52737887-52737909 CCTGGTTCAGCTTTCCCCTAAGG - Intronic
1051212282 9:14757441-14757463 CCTGCCTCAGCCTCCCCAGGAGG - Intronic
1052995064 9:34547555-34547577 CCTGGGTCAGCTTACCCCTCAGG + Intergenic
1053381144 9:37650713-37650735 CCTGCCTCAGCTCACCGCCGGGG - Intronic
1053477678 9:38393733-38393755 GCTGACTCAGCTTCCCCCTGTGG + Intronic
1055069223 9:72149420-72149442 CCTGCCCCCGCTTACCCGGGCGG - Exonic
1057516916 9:95729411-95729433 CCTGGCTCCTCTTTCCCCCGGGG - Intergenic
1059209273 9:112497112-112497134 CTTTGCTCAGCTTTCCCCAGTGG + Intronic
1061497977 9:130986505-130986527 CATGGCCCAGCTTGCCCCGAGGG - Intergenic
1062539749 9:137036320-137036342 CCTGGCTCAGCCTTGCCTGGGGG - Exonic
1200232554 X:154451273-154451295 CCTGCCTCAGCTTAGCCAAGTGG - Intergenic
1201546668 Y:15172765-15172787 CCTGCCTCAGCCTACCCAGTAGG + Intergenic