ID: 950518511

View in Genome Browser
Species Human (GRCh38)
Location 3:13482477-13482499
Sequence TAATATCATCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950518505_950518511 -6 Left 950518505 3:13482460-13482482 CCACACTGAGCCTCCTGTAATAT 0: 1
1: 0
2: 4
3: 58
4: 286
Right 950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 227
950518504_950518511 -1 Left 950518504 3:13482455-13482477 CCATGCCACACTGAGCCTCCTGT 0: 1
1: 0
2: 1
3: 24
4: 300
Right 950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950518511 Original CRISPR TAATATCATCAGAAGGTGGA GGG Intronic
900450131 1:2701856-2701878 TATTCTCACCTGAAGGTGGAGGG - Intronic
900453619 1:2762967-2762989 TATTCTCACCTGAAGGTGGAGGG - Intronic
900453992 1:2764898-2764920 TATTCTCACCTGAAGGTGGAGGG - Intronic
900454332 1:2766552-2766574 TATTCTCACCTGAAGGTGGAGGG - Intronic
900454752 1:2768772-2768794 TATTCTCACCTGAAGGTGGAGGG - Intronic
900455061 1:2770228-2770250 TATTCTCACCTGAAGGTGGAGGG - Intronic
900455439 1:2772160-2772182 TATTCTCACCTGAAGGTGGAGGG - Intronic
900455808 1:2773974-2773996 TATTCTCACCTGAAGGTGGAGGG - Intronic
900456290 1:2776516-2776538 TATTCTCACCTGAAGGTGGAGGG - Intronic
904847134 1:33428983-33429005 TAGTAAGATCAGAAGCTGGAAGG - Intronic
907723450 1:56995983-56996005 CAATATCATCCTAATGTGGAAGG - Exonic
908051560 1:60238158-60238180 AAATATCATCACCAGGTGAATGG + Intergenic
908093239 1:60708746-60708768 AAAAATCATCTGAAGGTGGCCGG + Intergenic
908807041 1:67942594-67942616 TAAAGTCATCAGAATGAGGATGG - Intergenic
909851820 1:80475791-80475813 TAATATCATTTGAAAGTGGATGG + Intergenic
911417626 1:97595186-97595208 AAATATCATTAGCAGGAGGAGGG + Intronic
916201650 1:162277329-162277351 TAATAAAATCAGAATTTGGAGGG - Intronic
917210136 1:172622774-172622796 TAATATGAACAGAAGTTGGTAGG - Intergenic
918979790 1:191541422-191541444 TGACATCCTCAGAAGGTAGAGGG + Intergenic
919826879 1:201509286-201509308 TAATATAGTCAGAAGGTGAGAGG - Intronic
922650162 1:227331097-227331119 GAAAATCATCAGAATGTGGCTGG + Intergenic
922974389 1:229771471-229771493 GAATATCATCAGAGGGAGGCAGG + Intergenic
923289572 1:232531350-232531372 TAATATCACAAGAAAGGGGATGG - Intronic
923291098 1:232547089-232547111 TAATACCATAAGGAAGTGGATGG + Intronic
924646160 1:245878794-245878816 TGATGTCATCAGCAGTTGGAGGG + Intronic
1065212310 10:23416028-23416050 AAACATCATCAGAAGGCTGAGGG + Intergenic
1066315274 10:34239845-34239867 TAATATTATCAAAAGATGGTAGG - Intronic
1069103226 10:64350437-64350459 TAATATGACCAGAACGTAGAAGG + Intergenic
1069121028 10:64569221-64569243 AAATATCAACAGAAAATGGAGGG + Intergenic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071103212 10:82062743-82062765 TATCATCATCAAAATGTGGAAGG + Intronic
1071176400 10:82931410-82931432 TTATATACTCAGAAGGTGAAAGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075191519 10:120313702-120313724 TAATATAAACAGATGATGGAAGG - Intergenic
1075303355 10:121345182-121345204 TTAAATCATCAGATGCTGGAGGG + Intergenic
1075692928 10:124412042-124412064 AAATGTCATCAGAGGTTGGAGGG + Exonic
1076038126 10:127218679-127218701 AAATAACAACAGAAAGTGGAGGG - Intronic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1078119222 11:8489495-8489517 GAATATCATCTCATGGTGGAAGG + Intronic
1079682218 11:23312130-23312152 TGATATCATCAGGAAGTGGTAGG + Intergenic
1087025834 11:93648731-93648753 TTATATCATGAGTAGGTAGAAGG - Intergenic
1087151508 11:94864354-94864376 TAATGTAGTCAGAAGGGGGAGGG + Intronic
1087943295 11:104127302-104127324 TATAATAATCAGAAGGTCGATGG - Intronic
1088076781 11:105859521-105859543 AAATTTCATCAGAAGGTGTGTGG + Intronic
1088967536 11:114738786-114738808 TAATATAAGCATAAGGTGGGGGG - Intergenic
1089058892 11:115609766-115609788 TAAGATCATAAGAAGCAGGAAGG - Intergenic
1089512247 11:119006932-119006954 TAATCACAGCAGAAGGTGAAAGG - Intronic
1091810165 12:3390255-3390277 TAATCACATCACAAGCTGGAAGG + Intronic
1092299736 12:7235443-7235465 TAATAAAGTCAGAGGGTGGAAGG + Intergenic
1094482997 12:30899888-30899910 TAATCACATCACAAGCTGGAAGG - Intergenic
1095695981 12:45144489-45144511 TGATATCTTCACATGGTGGAAGG + Intergenic
1096009941 12:48204380-48204402 TATAAGCATCTGAAGGTGGAAGG - Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097924380 12:65111266-65111288 TTATCTCATCACAGGGTGGAGGG - Intronic
1098845629 12:75531730-75531752 TAATTTCAAAAGAATGTGGAAGG - Intergenic
1099148439 12:79077273-79077295 TAATATCAGAATTAGGTGGATGG - Intronic
1099242366 12:80153266-80153288 TTATGTCCTCAGATGGTGGAAGG + Intergenic
1099485478 12:83224277-83224299 TAATTTCCTGAGAAGGTGAAGGG - Intergenic
1099741600 12:86643089-86643111 TAAAATCATCTCACGGTGGAAGG + Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1108587102 13:51879791-51879813 TAATTTCAACAGAATGTGGCAGG + Intergenic
1111148187 13:84212727-84212749 TCATATCCTCAGAAGATGTAGGG - Intergenic
1112052557 13:95657329-95657351 AAATCTCAGCAAAAGGTGGAAGG - Intergenic
1113092687 13:106631936-106631958 GAATATTATGAGAAGGGGGAAGG - Intergenic
1113131726 13:107044348-107044370 TAACATCATCACTAGGTGGAAGG + Intergenic
1114254045 14:20986681-20986703 TGATATCCTCAGAAGATGAATGG - Intergenic
1116447260 14:45024231-45024253 TAATAACTTGAGAAAGTGGAGGG + Intronic
1119146608 14:72320777-72320799 TAATATAAGGATAAGGTGGAAGG + Intronic
1120119622 14:80663520-80663542 TATTATTATCGGAAGGTGGCTGG - Intronic
1121399572 14:93661339-93661361 AAATATAATCACAAGGTGGTGGG + Intronic
1124434525 15:29635908-29635930 TTACCTCATCAGAATGTGGAAGG - Intergenic
1126676778 15:51166041-51166063 TAATAATATCAGAATGGGGAAGG + Intergenic
1129082730 15:73054487-73054509 TTATATAATCAGTAGATGGATGG - Intronic
1130037440 15:80374623-80374645 TGATAGCCTCAGAAGGTGTAAGG - Exonic
1130132315 15:81154309-81154331 TAAATTCATAGGAAGGTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1134768236 16:16781271-16781293 TAATAACAAAAGAAGGGGGAAGG - Intergenic
1135631093 16:24036010-24036032 TAATATCTTGGGAAGGAGGAGGG + Intronic
1138894318 16:61184454-61184476 AAATATCATCAGAAAGAGGTAGG - Intergenic
1139474816 16:67197897-67197919 TGATGTCCTCAGAAGGTGGGTGG + Exonic
1140873450 16:79128088-79128110 TAATAACATCAGTGGGTGGTGGG - Intronic
1142837316 17:2596648-2596670 TAATATGATTAGAAAGTAGAAGG + Intronic
1143230149 17:5347111-5347133 TAATAACTTCACAAGGTGGCTGG + Intronic
1146439324 17:32879998-32880020 TAATAAGATGAGGAGGTGGAAGG + Intergenic
1148138389 17:45310472-45310494 TAATGTCAGTAGAAGGTGGGTGG + Intronic
1150353882 17:64466824-64466846 AAATCTCATCAGGAGATGGAGGG + Intronic
1150702107 17:67456925-67456947 TACTATCTTCAGAGGGTTGAGGG - Intronic
1153193631 18:2569925-2569947 TGATAACAGCAGAAGGTGGCAGG - Intronic
1153896992 18:9572685-9572707 TAATTTCATGAGAATGTAGATGG - Intronic
1154336186 18:13466826-13466848 TTATATCTTCACATGGTGGAAGG + Intronic
1155102475 18:22625924-22625946 CAAAACCATCAGAAGGTGTATGG + Intergenic
1155876353 18:31094652-31094674 TAAAATCATCAAAATTTGGATGG + Intronic
1156867860 18:41908674-41908696 TCATCCCATCAGAAGGTGGAGGG - Intergenic
1157626221 18:49053360-49053382 TTATATCATCTTTAGGTGGAAGG - Intronic
1157699802 18:49754750-49754772 GAATATCTTCAGAAGGGAGATGG + Intergenic
1157735945 18:50049185-50049207 TATTTTCATCATAAGTTGGATGG + Intronic
1159690520 18:71482397-71482419 TAATATAAACAGGAGGTGGGAGG + Intergenic
1163901933 19:20109980-20110002 TCATAAAATCAGAAAGTGGAAGG - Intronic
1163947118 19:20548456-20548478 TCATAAAATCAGAAAGTGGAAGG + Intronic
1164317903 19:24110719-24110741 TCATAAAAACAGAAGGTGGAAGG - Intronic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1165784132 19:38451240-38451262 GAGCATCATCAGCAGGTGGATGG + Intronic
925132176 2:1501891-1501913 AAAAATCATCACAAAGTGGATGG - Intronic
925785498 2:7428670-7428692 TCATATCATCAGATGGGTGAGGG - Intergenic
925847984 2:8051035-8051057 TAATCACAGCAGAAGGTGAAGGG - Intergenic
926618098 2:15019787-15019809 TCCTATCATCATATGGTGGAAGG - Intergenic
928223695 2:29427396-29427418 TAATAGCATTAAAAAGTGGAGGG + Intronic
928762210 2:34597974-34597996 TAGTATCATCATAAGATGGGAGG - Intergenic
930656277 2:54010122-54010144 TGATATCCTAGGAAGGTGGATGG + Intronic
931507696 2:62949791-62949813 TAATATCATCAGTAAGAGAAAGG - Intronic
933117079 2:78487532-78487554 TTATATCATCAGTTGGTGGGGGG - Intergenic
937482787 2:122279958-122279980 TGATAAAATCAGAACGTGGAGGG - Intergenic
938649225 2:133364446-133364468 TAATATTATGGGAAGCTGGATGG - Intronic
939716980 2:145596120-145596142 AAATATCAGCAGAAGTGGGAGGG - Intergenic
941650258 2:168084899-168084921 TAAGATCCTCAGAAGGTGTTAGG - Intronic
941673198 2:168317104-168317126 TAATAGCATCAGAAGTTAGAAGG - Intergenic
942385819 2:175441675-175441697 TGCTTTCATCAGAAGGGGGAAGG - Intergenic
943525813 2:189015968-189015990 GAATATACTCAGAAGGTGAATGG - Intergenic
943567162 2:189529645-189529667 TTATATCATCCCATGGTGGAAGG - Intergenic
943713831 2:191128015-191128037 GATCATCAACAGAAGGTGGATGG - Intronic
945365661 2:208950114-208950136 GAATATCCTCATAAGGTAGATGG - Intergenic
945381567 2:209146968-209146990 CAATAACATCAGAAGCTAGAGGG - Intergenic
945868212 2:215200365-215200387 TAAGAACATCAGGAGGAGGAAGG + Intergenic
946697108 2:222370951-222370973 TAATATCTTCAAAATGTTGAAGG + Intergenic
946839647 2:223807729-223807751 TAAAATCATGATAAGGTGAATGG - Intronic
1170380706 20:15756688-15756710 TTTTATCATCTGAAGGGGGAAGG + Intronic
1170558430 20:17534614-17534636 TAATAAAAACAGAAGGGGGATGG + Intronic
1170967507 20:21088158-21088180 TCATCTCATCTGAAGGAGGAAGG - Intergenic
1178502337 21:33136061-33136083 TAAAATCAGGAGCAGGTGGATGG + Intergenic
1181929524 22:26389088-26389110 TATTATCGTCAGAAGGGGAAGGG - Intergenic
1182822476 22:33229630-33229652 TAATAACATAAGAAGGTGCAAGG + Intronic
1184932247 22:47690163-47690185 GAATAACAATAGAAGGTGGAAGG + Intergenic
949170889 3:995103-995125 GCATCTCATCAGATGGTGGAAGG - Intergenic
950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG + Intronic
952692332 3:36224661-36224683 TAATATTATTTGAAGGTAGATGG - Intergenic
953013841 3:39053320-39053342 TAATCCCAGCAGAAGGTGGTAGG + Intronic
953361134 3:42297784-42297806 TAATATCATCACAAGGCAGCTGG + Intergenic
953581846 3:44164567-44164589 TAATATCCTCGGAATGTTGATGG - Intergenic
953735543 3:45491325-45491347 TAATATTATCTGAAGGAGCAAGG + Intronic
955118940 3:56036397-56036419 TAAAATCATCCGAATCTGGAAGG + Intronic
955422433 3:58751998-58752020 TTATATCATCAGAAGGGGAAGGG - Intronic
956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG + Intronic
957770117 3:84679688-84679710 TACCATCATCAGAAGGTGAAAGG - Intergenic
958502560 3:94933241-94933263 GATTGTCATTAGAAGGTGGATGG + Intergenic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
959632058 3:108517762-108517784 GAATTTAATCAGAAGGTGGCCGG - Intronic
960855692 3:122100060-122100082 TTATGTCATAAGAAGGTGGGGGG + Intronic
961225530 3:125241957-125241979 TTATCTCAGCAGGAGGTGGATGG + Intronic
962384828 3:134924114-134924136 TAATTTCTGCATAAGGTGGAAGG - Intronic
963713005 3:148768831-148768853 TAGTATCCTCACATGGTGGAGGG - Intergenic
964760338 3:160129558-160129580 GAATATCATCTGAAAGTGGCAGG - Intergenic
965631050 3:170733140-170733162 TAATAACAACATAAGGAGGATGG + Intronic
966238722 3:177730913-177730935 TATTATTATAAGAAGGAGGATGG + Intergenic
967239974 3:187428826-187428848 TAATATTAACATAAGGTGTAAGG + Intergenic
967629177 3:191723292-191723314 TAATATCACTAGAAGTTAGAGGG - Intergenic
968190501 3:196663845-196663867 TTATTTCAGCAGAAGGTGGCAGG - Intronic
969893073 4:10277621-10277643 TAATCTCATCCGAAGCTGGCAGG - Intergenic
974645672 4:64687784-64687806 TCATGTCATCTGATGGTGGAAGG - Intergenic
975856808 4:78633275-78633297 TAATATGATTAGAAGGGGCATGG - Intergenic
977408392 4:96630554-96630576 TAATTACAACAGAAAGTGGAAGG + Intergenic
979567922 4:122177605-122177627 TAAGATGATCAGGAGGTAGAAGG - Intronic
981155574 4:141431065-141431087 TAATTACATCAGAAGGGGCAGGG + Intergenic
983926123 4:173404352-173404374 AAATATGAACAGAAGATGGACGG - Intronic
984886635 4:184455446-184455468 TGGTTGCATCAGAAGGTGGAAGG - Intronic
984937673 4:184903488-184903510 TATTTTCATCAGAATTTGGAAGG + Intergenic
987341461 5:16943211-16943233 TAAGATCATCAGAAGATTTAGGG - Intergenic
987716498 5:21578564-21578586 TAATAACAACATAAGGTAGAAGG + Intergenic
990695227 5:58408935-58408957 TACTATCCTCAGAAAGAGGATGG - Intergenic
991608300 5:68425120-68425142 TTATATAATCAGAAGTAGGAAGG + Intergenic
993284006 5:85966105-85966127 TAATATCATGAGAAAGTCAAGGG - Intergenic
993312372 5:86350727-86350749 AAATTTAATCAGAAAGTGGAGGG - Intergenic
993552511 5:89291305-89291327 TACAATCATCAGCAGGAGGAAGG + Intergenic
994181576 5:96772651-96772673 TAAAATCTTCAGCTGGTGGATGG + Exonic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995798747 5:115968725-115968747 TTATACCGTCAGAAGGAGGAGGG - Intronic
998662625 5:144256968-144256990 TAGTAAAATCAGAATGTGGAAGG + Intronic
1000193504 5:158936514-158936536 TACTAACATCAGCATGTGGATGG + Intronic
1000911103 5:167023091-167023113 TAAAATTCTCAGAAGGGGGATGG - Intergenic
1001235729 5:170027814-170027836 CAATAACATCAGAAGGCTGAGGG - Intronic
1006698073 6:35948787-35948809 TAATACCACCACAATGTGGATGG - Intronic
1007034133 6:38657079-38657101 TAATGTCATCAAAAGGTGTCAGG - Intergenic
1008863524 6:56181187-56181209 TAGTATCCTCAGAAGGTGTAAGG + Intronic
1009320368 6:62280625-62280647 TAGTATTATCAGAAGTTTGAAGG + Intronic
1009762840 6:68030032-68030054 TAGTATAATTATAAGGTGGAAGG - Intergenic
1010063421 6:71651594-71651616 TCACATCATCTGAAGGGGGATGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010383516 6:75251165-75251187 TAAAATCACCAAAAGGTGAAGGG + Intergenic
1011003959 6:82622886-82622908 TAATATCCTCACATGGTAGAAGG - Intergenic
1013941582 6:115669505-115669527 GAATATGATGAGAAGGTGGGAGG + Intergenic
1014781275 6:125567657-125567679 TGCTTTCATCAGAAGGAGGAAGG - Intergenic
1015380630 6:132563466-132563488 TAATACCAACAGAAGATGAAAGG - Intergenic
1016048633 6:139506382-139506404 TGATATGATCTAAAGGTGGAAGG - Intergenic
1018426656 6:163688986-163689008 TAAAATCATCACATGCTGGAGGG - Intergenic
1019903000 7:4038553-4038575 TAATACCATTAGAAGATGCATGG - Intronic
1020243410 7:6412667-6412689 GAATCTGATCAGATGGTGGAAGG + Intronic
1021394616 7:20131963-20131985 TAATATTTTCAGAACGGGGATGG + Intergenic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022567531 7:31418120-31418142 TAATATCTTCAGAAAATGCAAGG - Intergenic
1024028833 7:45438452-45438474 TCATAGTATCAGCAGGTGGAGGG - Intergenic
1024192617 7:47028257-47028279 TACTCCCATCAGAAGATGGAAGG + Intergenic
1024401791 7:48932314-48932336 CAATGTCCTCAGATGGTGGAAGG + Intergenic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1028074639 7:86496852-86496874 TAAAATCATTAGAAGGCAGAAGG + Intergenic
1028146863 7:87328839-87328861 TAAAATCATCAGAGGGAGGATGG - Intergenic
1030825271 7:114148184-114148206 GAATCTCATCAGAAGTTTGAAGG + Intronic
1034083855 7:148305604-148305626 TAATCACAGCAGAAGGTGAAGGG + Intronic
1034726125 7:153337103-153337125 TCATCTCATCAGAAGGTGTGTGG + Intergenic
1037188528 8:16093801-16093823 TAATGTCATTAGGAGGTGGGAGG - Intergenic
1044078459 8:87854454-87854476 CAATGTCATCAGCAGGTGAATGG + Intergenic
1044609947 8:94081218-94081240 TAATGGCATCACATGGTGGATGG + Intergenic
1044738795 8:95304709-95304731 TAATATTGTCAGGAGGTGCATGG + Intergenic
1044918964 8:97147954-97147976 TAATCACAGCAGAAGGTGAAAGG - Intronic
1045705811 8:104921172-104921194 GAACATCATCAGAAGATGCAGGG + Intronic
1046257502 8:111720860-111720882 TAATCACAGCAGAAGGTGAATGG + Intergenic
1046663329 8:116972962-116972984 TAATATCCTCAGATCGGGGATGG - Intronic
1046699751 8:117386842-117386864 AAATGTCTTCAGAAGGTGAAAGG - Intergenic
1047821582 8:128526902-128526924 TTATATCATCAGATTGTGGGAGG + Intergenic
1048729639 8:137424530-137424552 TAATATCTTCCAAGGGTGGAAGG + Intergenic
1048797683 8:138166507-138166529 TAACATCATCAGTAGGTTGCTGG + Intronic
1053217290 9:36282749-36282771 TAATCTCATCAGAACCTGGAAGG + Intronic
1055493642 9:76831885-76831907 TATAATCATCGGAAGGTTGAAGG + Intronic
1056631023 9:88293136-88293158 TAATATCAAGAGAAAGGGGATGG - Intergenic
1058933571 9:109746636-109746658 TGATATCCCCAGGAGGTGGAAGG + Intronic
1059671357 9:116495466-116495488 TAATGTCATCAGAACTTGGTTGG - Intronic
1059997196 9:119923212-119923234 TAGTATCATGAGAATGAGGATGG + Intergenic
1187952000 X:24480182-24480204 TAAGATCATCTGAAAGTGAAAGG + Intronic
1188303212 X:28530661-28530683 AAATATTATGAGAAGGTGTAGGG - Intergenic
1189046364 X:37596105-37596127 TAATTACATCAGAAGTTGGAAGG + Intronic
1189527363 X:41838420-41838442 TAATATCATTAGGACATGGAGGG - Intronic
1189556518 X:42151035-42151057 TAATAACAACAAAAGATGGAGGG - Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1194164340 X:90496434-90496456 TAATATTATCAGTAGCTGTATGG - Intergenic
1195624978 X:106998676-106998698 TAATTTAATTAGAAGGTGAAAGG - Intronic
1198708091 X:139471191-139471213 TATTATTATCAGAAGTTGCATGG - Intergenic
1198718640 X:139591087-139591109 TAATAACATGATAAGCTGGAAGG + Intronic
1201632035 Y:16079854-16079876 TAAGATCATCTGAAGCTTGATGG - Intergenic
1202068354 Y:20963738-20963760 TAATATCATCAGATTGTTGAAGG + Intergenic