ID: 950519131

View in Genome Browser
Species Human (GRCh38)
Location 3:13485882-13485904
Sequence ATGCAGCTGGATCACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950519131_950519135 -2 Left 950519131 3:13485882-13485904 CCAAGATGGTGATCCAGCTGCAT 0: 1
1: 0
2: 0
3: 17
4: 130
Right 950519135 3:13485903-13485925 ATATTTGGCTTGGAGCTCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
950519131_950519136 14 Left 950519131 3:13485882-13485904 CCAAGATGGTGATCCAGCTGCAT 0: 1
1: 0
2: 0
3: 17
4: 130
Right 950519136 3:13485919-13485941 TCCCTGGCAGTCAGAACAAAAGG 0: 1
1: 0
2: 2
3: 58
4: 256
950519131_950519139 27 Left 950519131 3:13485882-13485904 CCAAGATGGTGATCCAGCTGCAT 0: 1
1: 0
2: 0
3: 17
4: 130
Right 950519139 3:13485932-13485954 GAACAAAAGGAGAAACATGATGG 0: 1
1: 0
2: 2
3: 80
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950519131 Original CRISPR ATGCAGCTGGATCACCATCT TGG (reversed) Intronic
906690150 1:47787180-47787202 AGGCAGCTGGATCTGCATCAGGG + Intronic
913975021 1:143449286-143449308 CTGCAACAGGGTCACCATCTGGG + Intergenic
914069413 1:144274902-144274924 CTGCAACAGGGTCACCATCTGGG + Intergenic
914109742 1:144691452-144691474 CTGCAACAGGGTCACCATCTGGG - Intergenic
915700230 1:157785071-157785093 ATGCAGCAGCATCTCCTTCTTGG - Intergenic
915901171 1:159847582-159847604 TTGGAGATGGCTCACCATCTGGG - Intronic
921001693 1:211050577-211050599 ATGCAACTGGGTAACAATCTCGG + Intronic
924240577 1:242036216-242036238 ATGCTGCTGCATCTCCATCCAGG - Intergenic
1071463948 10:85922918-85922940 AAGCAGCTGAGTCAGCATCTTGG - Intronic
1072475599 10:95757004-95757026 AAGCAGCTGGCTCTCCGTCTTGG - Intronic
1077908441 11:6552948-6552970 ATTCAACTGTATAACCATCTGGG - Intronic
1085517885 11:77121990-77122012 ATGTACCTGGGTCACCAGCTGGG - Exonic
1087292703 11:96337940-96337962 TGCCTGCTGGATCACCATCTGGG - Intronic
1088078446 11:105879951-105879973 ATGAAGCTGGAACTCCAGCTGGG - Intronic
1089362258 11:117898818-117898840 AGGCAGCTGGAGCACCTGCTAGG + Intergenic
1090259330 11:125307346-125307368 AGGCAGGTGGATCACCAGCCTGG + Intronic
1091354349 11:134924125-134924147 ATGCAGGTGGTTCAGCATCCTGG + Intergenic
1092302629 12:7266705-7266727 ATGCAGCTTGATCATCAGCTGGG - Intergenic
1096584760 12:52612785-52612807 ACGCAGCTGGATCAGAATCTAGG - Intronic
1099093586 12:78343384-78343406 AATCAGCTTGTTCACCATCTTGG + Intergenic
1100116273 12:91308447-91308469 ATGCAGCTGGATCAGTTTCAAGG + Intergenic
1100814029 12:98368082-98368104 ATGCTGCTGGCTCACCCTCTAGG - Intergenic
1102799893 12:115722815-115722837 ATGTAGCTGAAACACCAACTTGG - Intergenic
1103794046 12:123491196-123491218 ATGGAGCTCGATTGCCATCTTGG - Intronic
1104462596 12:128967883-128967905 ACGCAGCAGGATCTGCATCTCGG - Intronic
1107791382 13:44005502-44005524 ATGCAGATGAATCAACAGCTTGG - Intergenic
1110219990 13:73061810-73061832 ATCCACCTGATTCACCATCTCGG - Intronic
1110423716 13:75341547-75341569 ATGCCTCTGTATCACCAGCTTGG + Exonic
1116421604 14:44739151-44739173 ATGCAGCTGGAATAACACCTAGG + Intergenic
1116955252 14:50916717-50916739 ATTCAGCTGGATGGCCACCTGGG + Exonic
1126415268 15:48411754-48411776 ATGCATCTGAATCACCTACTAGG - Intronic
1128781112 15:70359305-70359327 CTGCAGCTGCCCCACCATCTTGG - Intergenic
1129333755 15:74840544-74840566 CTGCCGCTGGCACACCATCTCGG + Exonic
1131142921 15:89992301-89992323 ATGCAGCAGCAGCACCATCTGGG - Intergenic
1132432683 15:101773769-101773791 ATGCAGCTGGTTCATTAGCTGGG + Intergenic
1133295023 16:4747462-4747484 ACACAGCTGGATCACGAACTGGG + Exonic
1138512801 16:57518374-57518396 ATGCAGCTGGATCTGCTTCCTGG - Intronic
1141630180 16:85283398-85283420 TTGCAGCTGGATCCCCTTTTTGG + Intergenic
1143402866 17:6657298-6657320 CTGCAGCTGGATCTCCGTGTAGG + Intergenic
1145177508 17:20713707-20713729 AGGCAGGTGGGTCACCATGTTGG - Intergenic
1145279068 17:21455322-21455344 AAGCACCTGGGTCACCATCTGGG - Intergenic
1145398788 17:22515125-22515147 AAGCACCTGGGTCACCATCTGGG + Intergenic
1145952526 17:28830388-28830410 AGGCAGCTGGATCACGAGGTTGG - Intronic
1146852863 17:36238477-36238499 AGGCAGGTGGATCACCATGTCGG + Intronic
1146868776 17:36362369-36362391 AGGCAGGTGGATCACCATGTCGG + Intronic
1147071649 17:37962993-37963015 AGGCAGGTGGATCACCATGTCGG + Intergenic
1147083176 17:38042517-38042539 AGGCAGGTGGATCACCATGTCGG + Intronic
1147099120 17:38166490-38166512 AGGCAGGTGGATCACCATGTCGG + Intergenic
1149837172 17:59923421-59923443 AGGCAGGCGGATCACCATGTTGG - Intronic
1150082136 17:62249802-62249824 AGGCAGGTGGATCACCATGTTGG + Intergenic
1150579635 17:66460622-66460644 ATTCAGCTGGTTCTCCAACTAGG - Intronic
1150689009 17:67347198-67347220 ATTCAGCTGGATCAACATGAGGG - Exonic
1151190761 17:72396065-72396087 ATGCACCTGTTTGACCATCTTGG - Intergenic
1152946983 17:83203231-83203253 CTGCGGCTGAATCACCCTCTGGG + Intergenic
1153216090 18:2822248-2822270 AAGTAGCTGGCTGACCATCTTGG + Intergenic
1154089399 18:11343550-11343572 AAGCAGGCGCATCACCATCTAGG + Intergenic
1154994525 18:21627056-21627078 AGGCAGGTGGATCACCAGCCTGG + Intronic
1155305508 18:24474167-24474189 ATGCAGCTTTAGCACCATCTGGG + Intronic
1158476808 18:57787507-57787529 ATGCGGGTGGAGCTCCATCTAGG + Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161200602 19:3012706-3012728 CAGCAGCTGGACCTCCATCTAGG + Intronic
1162729824 19:12711597-12711619 GTGCAGGTTGATCCCCATCTTGG - Exonic
1164904473 19:31955796-31955818 ATTCAGCTCGAGCACCAACTTGG + Intergenic
1166624536 19:44338542-44338564 ATGCAGCAGGAACACTATGTAGG - Intronic
925954952 2:8954529-8954551 ATGCAGCTGGGAAACCATCTGGG + Intronic
927631360 2:24776956-24776978 ATGAAACGGCATCACCATCTAGG + Intergenic
929950781 2:46408206-46408228 ATGCAGCTGGCTCAGGAGCTAGG + Intergenic
934179726 2:89610259-89610281 CTGCAACAGGGTCACCATCTGGG + Intergenic
936041921 2:109156345-109156367 CTCCAGCAAGATCACCATCTAGG - Intronic
939413516 2:141862635-141862657 ATGCAGGTGGATCACGAGGTCGG - Intronic
940600719 2:155855950-155855972 ATGGATCTGAATCTCCATCTAGG - Intergenic
940766446 2:157795069-157795091 ATGAAGCTAGATCACATTCTTGG - Intronic
941600912 2:167543723-167543745 AGGAAACTGGAGCACCATCTTGG + Intergenic
942532098 2:176922244-176922266 ATGCAGCTAGATAAACATGTGGG + Intergenic
942718442 2:178921747-178921769 GAGCAGCTGAATCACCAACTGGG + Intronic
942722100 2:178965114-178965136 ATGCATCAAGGTCACCATCTTGG + Intronic
945269806 2:207926627-207926649 ATTCAGCAGGACCGCCATCTGGG + Intronic
945803732 2:214465132-214465154 AGGCAGCTGAGGCACCATCTTGG - Intronic
946359291 2:219209454-219209476 ATGCAGCTGGAGCACTAGCAAGG - Exonic
948334311 2:237195388-237195410 ATGCACCTCGAAGACCATCTGGG - Intergenic
1169937167 20:10896129-10896151 ATGCAGCTGGTCAACCTTCTTGG - Intergenic
1177245315 21:18515468-18515490 TTTCAGCTGGAACACCATCACGG - Intergenic
1179959956 21:44762619-44762641 GTGGAGCTGGGTCGCCATCTGGG - Intergenic
1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG + Intronic
1182763061 22:32738460-32738482 ATGCAGCAGGAGCTTCATCTTGG - Intronic
949308948 3:2674035-2674057 ATTCAGCTGGAGCATCAGCTGGG - Intronic
950519131 3:13485882-13485904 ATGCAGCTGGATCACCATCTTGG - Intronic
954866158 3:53731846-53731868 CTGAAGCAGAATCACCATCTGGG + Intronic
963819715 3:149876303-149876325 ATGCAGCTGCAAAGCCATCTAGG + Intronic
964750884 3:160052852-160052874 ATTCATCTGCATCACTATCTAGG - Intergenic
964919196 3:161875442-161875464 ATGGAGCTGGGAAACCATCTTGG - Intergenic
965498864 3:169432851-169432873 TTGCAGCTGGAGCAGAATCTTGG - Intronic
968039798 3:195579444-195579466 CAGCAGCAGCATCACCATCTTGG + Exonic
968491651 4:893425-893447 CTGCAGCTGGTGCACCACCTCGG + Exonic
969948660 4:10811188-10811210 ATGCAGCAGAATCACCAGATGGG + Intergenic
970006215 4:11413289-11413311 AGGCAGCTTAATCACCTTCTAGG + Intronic
971425556 4:26511707-26511729 ATGTAGCTGGATTAGCATCGGGG - Intergenic
971539466 4:27797687-27797709 AAACAGCTGGCTCTCCATCTTGG - Intergenic
971637969 4:29088061-29088083 ATGCAGCTGGATTACACTTTAGG - Intergenic
972233222 4:37099409-37099431 ATGCAGCTGGATCCCTTTTTGGG - Intergenic
975003430 4:69255752-69255774 GTGCAGCAGCAGCACCATCTTGG - Intergenic
975011720 4:69363117-69363139 GTGCAGCAGCAACACCATCTCGG - Intronic
975173324 4:71258655-71258677 AATCAGCTGGATCTCTATCTAGG - Intronic
975823444 4:78294705-78294727 ATTCAGCTGTATCACAATCATGG + Intronic
976895953 4:90111500-90111522 ATACAGCCGAAGCACCATCTAGG - Intergenic
983177774 4:164611568-164611590 ATACAGCTGGAAGCCCATCTTGG - Intergenic
985506638 5:285313-285335 ATGCAGCTGGATACCCGGCTGGG + Intronic
985620687 5:953381-953403 GTGCAGCAGAAACACCATCTGGG + Intergenic
985741027 5:1617608-1617630 ATGCAGCTGGATACCCGGCTGGG - Intergenic
985788664 5:1913414-1913436 CTGCACCTGGATGACCACCTTGG + Intergenic
987631465 5:20478246-20478268 ATGCAGCTGGGACACCAGCTTGG + Intronic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
990769193 5:59223285-59223307 ATTCAGCTGGAGCCCCACCTAGG - Intronic
991049855 5:62261130-62261152 AGGCAGGTGGATCACAATGTCGG + Intergenic
995134972 5:108671215-108671237 ATCCAGCTGGATGACCAAATAGG - Intergenic
995587258 5:113660914-113660936 ATGCATCTGAATGACCATATTGG + Intergenic
997676396 5:135716223-135716245 AGCCAGCAGGATCACCATCAGGG + Intergenic
998521914 5:142808691-142808713 AGGCAGCTCGACCACCAGCTGGG - Intronic
998808607 5:145942736-145942758 GTGAAGCTGGAGAACCATCTGGG - Intronic
1001245218 5:170101054-170101076 ATGCTGGTGGTTCACCAGCTGGG - Intergenic
1002023792 5:176383370-176383392 ATGCAGCAGGATCACAAGCAGGG - Intronic
1003753823 6:9093306-9093328 AGTCAGCTGGATCCTCATCTAGG + Intergenic
1005501212 6:26430667-26430689 CTGCAGCGGGATCCCCATGTAGG - Intergenic
1010226502 6:73494425-73494447 ATGCAGCATGATCACCATTCTGG - Intronic
1012390946 6:98739611-98739633 TTTGAGCTGGATCACCATATAGG - Intergenic
1013490690 6:110643735-110643757 ATGCAACTGGAAAACTATCTTGG + Intronic
1013813080 6:114066422-114066444 AGGCAGATGGATCACCAGCTTGG + Intronic
1015566235 6:134574373-134574395 ATGCACCTGTATCAGCTTCTTGG - Intergenic
1016703168 6:147076759-147076781 TGGCAGCTGGAACACCATTTGGG + Intergenic
1017353344 6:153471393-153471415 AGGCAGGTGGATCACCAGGTCGG - Intergenic
1022515199 7:30970759-30970781 ATCCAGCTTGCTCACCAGCTTGG - Intronic
1022605559 7:31810717-31810739 ATGCACCTGGATCTCCCTCTTGG + Intronic
1025626852 7:63230408-63230430 AGGCAGGTGGATCATCAGCTTGG + Intergenic
1030470646 7:109958841-109958863 AAGAAGCTGGATCTCTATCTAGG - Intergenic
1030470999 7:109962315-109962337 ATACAACTGCAGCACCATCTTGG + Intergenic
1032547850 7:132758460-132758482 ATGAAGCCAGATCAACATCTGGG + Intergenic
1036003658 8:4637451-4637473 CTGCACCTGGATCATCATCACGG - Exonic
1037325690 8:17687765-17687787 AAGCAGCTGGATGACCCTGTTGG + Intronic
1038372508 8:27008228-27008250 GTGCAGCTGGATGGCCACCTAGG + Intergenic
1038783284 8:30587368-30587390 ATGCCGCTGCATTACAATCTGGG + Intronic
1047000331 8:120566772-120566794 CAGCAGCGGGAACACCATCTGGG - Intronic
1052763542 9:32617399-32617421 ATGGAGATGGCTCACCCTCTAGG + Intergenic
1055341690 9:75291207-75291229 ATATTTCTGGATCACCATCTGGG + Intergenic
1058928698 9:109696678-109696700 ATGCAGGTGGAACACCACATTGG - Intronic
1188739697 X:33763561-33763583 ATCCAGGTGGATCAGCCTCTAGG + Intergenic
1197342970 X:125295838-125295860 ATGCATCTTGATCACCATACTGG + Intergenic
1198146332 X:133861205-133861227 ATGCAGCTAGATCACTTACTAGG - Intronic
1201952013 Y:19575870-19575892 AGGCGGGTGGATCACCATCCTGG + Intergenic