ID: 950521493

View in Genome Browser
Species Human (GRCh38)
Location 3:13500416-13500438
Sequence GCTCCTTGTCCCCACCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950521493_950521495 18 Left 950521493 3:13500416-13500438 CCAGCTTGGTGGGGACAAGGAGC 0: 1
1: 0
2: 1
3: 19
4: 173
Right 950521495 3:13500457-13500479 TGATGAGCTATCTGTTGCTTAGG 0: 1
1: 0
2: 0
3: 14
4: 126
950521493_950521497 20 Left 950521493 3:13500416-13500438 CCAGCTTGGTGGGGACAAGGAGC 0: 1
1: 0
2: 1
3: 19
4: 173
Right 950521497 3:13500459-13500481 ATGAGCTATCTGTTGCTTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 165
950521493_950521496 19 Left 950521493 3:13500416-13500438 CCAGCTTGGTGGGGACAAGGAGC 0: 1
1: 0
2: 1
3: 19
4: 173
Right 950521496 3:13500458-13500480 GATGAGCTATCTGTTGCTTAGGG 0: 1
1: 0
2: 0
3: 30
4: 491
950521493_950521498 29 Left 950521493 3:13500416-13500438 CCAGCTTGGTGGGGACAAGGAGC 0: 1
1: 0
2: 1
3: 19
4: 173
Right 950521498 3:13500468-13500490 CTGTTGCTTAGGGGTGTGAGTGG 0: 1
1: 0
2: 0
3: 23
4: 183
950521493_950521494 -7 Left 950521493 3:13500416-13500438 CCAGCTTGGTGGGGACAAGGAGC 0: 1
1: 0
2: 1
3: 19
4: 173
Right 950521494 3:13500432-13500454 AAGGAGCAGCTTTCTGCTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950521493 Original CRISPR GCTCCTTGTCCCCACCAAGC TGG (reversed) Intronic
900484481 1:2914965-2914987 GGTCCTTATCCCCACCAGGAAGG + Intergenic
900798560 1:4724127-4724149 GCTCCTTGTCCACCCCAGCCTGG - Intronic
901134209 1:6982659-6982681 GCTCCCTGTCCCCACGCAGTTGG + Intronic
902839848 1:19067841-19067863 ACTCCTTGTCGGGACCAAGCTGG + Intergenic
905354645 1:37372866-37372888 TCTCCTTGACCCCACCAACGAGG - Intergenic
905685151 1:39902278-39902300 GCTCCTTGCCCACTCCGAGCTGG + Intergenic
907526947 1:55059343-55059365 GCTCCTTGTCCCCAGAAGGCTGG + Intronic
907688482 1:56637807-56637829 CCTCCTTGTCCACACCACTCTGG + Intronic
909664132 1:78114886-78114908 GCTCCCTATCCCCACCACACAGG - Intronic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
910721812 1:90295010-90295032 GCTCCTTGTTGTCACCAAGGTGG + Intergenic
913294090 1:117302007-117302029 GGTCCTTGTGCTCACCCAGCAGG - Intergenic
917737314 1:177932772-177932794 GCATCTTCTCCCCACCAGGCTGG - Exonic
918632080 1:186730440-186730462 GCCCCCTTCCCCCACCAAGCTGG + Intergenic
921407694 1:214799206-214799228 GCTCCTTGTCCTGAGCCAGCAGG + Intergenic
923110195 1:230884088-230884110 GCTCCTTCTCCCCACACAGCTGG - Intergenic
1063379708 10:5576710-5576732 CCTCCTTGTCCCCACTGAGAGGG - Intergenic
1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG + Intronic
1065952897 10:30668045-30668067 AGTCCTTGTTCTCACCAAGCAGG + Intergenic
1067068156 10:43115099-43115121 CCTCCTTGTCCCGGCCAGGCAGG + Intronic
1069756923 10:70779130-70779152 CTTCCCTGTCCCCACCAAACTGG + Intronic
1070327765 10:75399531-75399553 GGCACTTGACCCCACCAAGCCGG - Exonic
1070772243 10:79089251-79089273 GATCCTTCTCCCCACCCAGATGG + Intronic
1070784996 10:79157693-79157715 GTTCCCTGACCTCACCAAGCTGG - Intronic
1072439303 10:95439624-95439646 GCACCTTTTCCCCTCTAAGCAGG - Intronic
1072811870 10:98468183-98468205 GCACCGTCTCCCCACCGAGCAGG - Intronic
1076255557 10:129021831-129021853 GCTCCTTTTCCTCACCAGACTGG - Intergenic
1076599166 10:131645964-131645986 GCTCCTTTTCCTCACCTGGCTGG + Intergenic
1076883231 10:133249575-133249597 GCCCCATGTCCCCACCAGGAGGG - Intergenic
1077037320 11:501696-501718 GCTGCTTGTCCCTGCCAAGCTGG - Intronic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1080687092 11:34524781-34524803 GCTCCTTCGTCCCACCAGGCTGG + Intergenic
1084061564 11:66678593-66678615 TCTCCTCGTACACACCAAGCTGG + Intergenic
1085511641 11:77091149-77091171 GCTCCTAGTTCCCACCAAGATGG - Intronic
1087365726 11:97216616-97216638 GTTCCCTGCCCCCTCCAAGCTGG + Intergenic
1087859189 11:103132815-103132837 GCACCTTGTTGCCTCCAAGCTGG + Intronic
1088687984 11:112300506-112300528 GCTCACTGTCCCCTCCAACCAGG + Intergenic
1089231292 11:116979177-116979199 TCTCCTTTCCCCCACCAAACAGG - Intronic
1090394171 11:126407971-126407993 GCCCCTGGTCCCCATGAAGCAGG - Intronic
1091168147 11:133498570-133498592 GGTCCTTCTCCCCACCCATCTGG + Intronic
1091393440 12:139418-139440 GCACCTTCCCTCCACCAAGCAGG + Intronic
1092196189 12:6551061-6551083 GCTCCCTGTCCCCACCTCTCTGG + Intronic
1092957378 12:13562950-13562972 GGCCCTTGTCACCAACAAGCCGG - Exonic
1093417571 12:18937321-18937343 GCTCCTTGTCCCCAACATAGAGG + Intergenic
1093551673 12:20419984-20420006 GCTCTGTGTCCTCACCAAGGTGG - Intronic
1093788443 12:23218873-23218895 GCTTCTTGTCGTCACCAAGCTGG - Intergenic
1094415872 12:30214291-30214313 GCTCCTTAGCCCCATAAAGCAGG + Intergenic
1096110848 12:49028206-49028228 TGTCCTTGTCCCCACCCAGCTGG - Intronic
1096474065 12:51897230-51897252 GCCCCTTGTCCCCCAAAAGCAGG - Intergenic
1096477537 12:51917557-51917579 CATCCTTGTCCCCAAGAAGCAGG - Intronic
1097070911 12:56354297-56354319 GCTCCTCATCCTCACCACGCAGG - Intronic
1097202099 12:57287875-57287897 CCTCCATTTCCCCACAAAGCAGG - Intronic
1101903817 12:108810865-108810887 TCTCCTTGTACCCCCAAAGCTGG + Intronic
1103436667 12:120932098-120932120 GATACTTGCCCTCACCAAGCTGG - Intergenic
1103526682 12:121573905-121573927 GCCTCTTGTACCCACCAAGAGGG + Intronic
1103737737 12:123071071-123071093 GCTCAGTGTCCCCATCTAGCAGG + Intronic
1104183788 12:126408752-126408774 GCTCCTTGTCACCATCAAGGTGG + Intergenic
1109359264 13:61274624-61274646 GCTGCTTGGCCCCAGCAAACGGG - Intergenic
1110891980 13:80706002-80706024 GCTCTTAGTCCCCACCTCGCTGG - Intergenic
1111511552 13:89270994-89271016 TCTCCTTGTCCCCAGGATGCTGG - Intergenic
1112949544 13:104975688-104975710 GCCCACTGTCCCCACCAAGAGGG + Intergenic
1113468538 13:110529034-110529056 GCGCATTGTCCACACCAAGAAGG + Intronic
1122550905 14:102549240-102549262 GCTCCTTCTCCACCCCAAGGAGG - Intergenic
1122599593 14:102914683-102914705 GCTCCTAGACCCCTCCCAGCAGG - Intergenic
1122838594 14:104443476-104443498 CCTCCTCCTCCCCACCCAGCAGG + Intergenic
1125714283 15:41810382-41810404 GCTCCTTTTCCCCACCCAAGAGG - Intronic
1126670334 15:51110351-51110373 GTTCCTCAGCCCCACCAAGCAGG - Intergenic
1127870404 15:63068224-63068246 GCTCTTTGTCCTCAATAAGCTGG + Intronic
1128561998 15:68674706-68674728 GCTCCATGACCTCACCAGGCAGG + Intronic
1130880877 15:88054947-88054969 GATCTTTGCCCACACCAAGCAGG + Intronic
1131150879 15:90046563-90046585 GCTCATTGTCCCCACCCGTCTGG - Intronic
1131271436 15:90949882-90949904 GCTCCTTGGCCCCTCCACACTGG + Intronic
1132504130 16:298248-298270 GCTGCTTGTCCCCACACAGGAGG - Exonic
1132541000 16:509720-509742 GCTCCCAGTCCCCTCCAGGCTGG - Intronic
1133112168 16:3554529-3554551 GCACCTTGTTCCCAGCCAGCAGG - Intronic
1134006754 16:10823090-10823112 ACTCCGTGTCCCCACCAGGCAGG + Intergenic
1134542077 16:15075767-15075789 GCTCCTGGTGCCCACCATGGCGG + Intronic
1136032750 16:27515488-27515510 CCTTCTTCTCCCCACCAAGTTGG + Intronic
1139380066 16:66524950-66524972 GCTGCTTGCCCCCACACAGCAGG + Intronic
1139836403 16:69842128-69842150 GCTCTTTGTCCTCACCAAGGGGG - Intronic
1140123187 16:72100576-72100598 GCGCATTGTCTTCACCAAGCAGG + Exonic
1141991616 16:87614126-87614148 GCTCTGTGTCCACACCACGCTGG - Intronic
1144093715 17:11881257-11881279 GCTCATCCTCCACACCAAGCTGG + Exonic
1144788451 17:17844567-17844589 GCTCCTTGTCCCATGCACGCTGG + Intronic
1145247967 17:21282312-21282334 CTTCCTTGTCCCCACCCAGATGG + Intergenic
1145814088 17:27782997-27783019 GCTCATCTTCGCCACCAAGCAGG - Exonic
1146860054 17:36289559-36289581 GCTCCTTTTTCTCCCCAAGCAGG + Intronic
1147090380 17:38093650-38093672 GCTCCTTTTTCTCCCCAAGCAGG + Intergenic
1147106833 17:38226876-38226898 GCTCCTTTTTCTCCCCAAGCAGG - Intergenic
1147141492 17:38463103-38463125 GCTCCTTGTCCCCAGGAGACCGG + Exonic
1148422697 17:47561660-47561682 GCTCCTTTTTCTCCCCAAGCAGG + Intronic
1149691617 17:58581894-58581916 GCTGCTTTTCCCCACCAGGAAGG - Intronic
1151715340 17:75828179-75828201 GCTCCATCTCCCCAACAACCTGG + Intronic
1152621775 17:81368486-81368508 GCTCCCTGTCCACCCCCAGCAGG - Intergenic
1152629311 17:81402823-81402845 GCCCCATGTCCCCACCCATCAGG - Intronic
1153922529 18:9804245-9804267 GCAGCCTGTCCCCACCAAGGAGG - Intronic
1155645471 18:28072109-28072131 GCACCTTGTCCCCAACTATCAGG + Intronic
1158498959 18:57983056-57983078 GCTGCCTCTCTCCACCAAGCTGG + Intergenic
1161403419 19:4078746-4078768 GCCCCAGGCCCCCACCAAGCAGG - Intergenic
1161761014 19:6172894-6172916 GCTCCTTGTCCTCAGCCAGCAGG + Intronic
1163605695 19:18274200-18274222 GCTCCTTGGCCCCTCACAGCAGG - Intronic
1164825771 19:31283947-31283969 GAACCTGGTCCCCACCAGGCTGG + Intronic
1166042818 19:40213657-40213679 GCGCCGTGTCCCCACCGAGCGGG - Exonic
1166776796 19:45318005-45318027 GCTGCTTGTCCCCAGCAAACAGG + Intronic
1167480524 19:49727911-49727933 GTTCCTTGTTCCCGCCAGGCCGG - Intergenic
926764793 2:16314838-16314860 GATCCTTCTCACCACAAAGCAGG - Intergenic
927843895 2:26461617-26461639 TCTCCCTGTCCCCGCCAACCCGG + Intronic
928287871 2:30009032-30009054 TCTCCTGGTCCCCAGCAAGATGG + Intergenic
929555390 2:42922526-42922548 GGCCCTTGTCCCCCCCATGCTGG + Intergenic
933355655 2:81206375-81206397 GCCCCTCCACCCCACCAAGCTGG - Intergenic
934563873 2:95327828-95327850 GCTCCTTCTTCCCTCCCAGCTGG - Intronic
937120051 2:119434749-119434771 GCACCTTTTCCTCACCAAGAGGG + Intronic
937671143 2:124538252-124538274 ACTCCTGGTCTCCACCAAACTGG - Intronic
938191156 2:129281963-129281985 GCTCCTTGTCCACACCCAGCAGG + Intergenic
942111583 2:172687996-172688018 GCTTCTTGTCCCCACAATTCTGG - Intergenic
947873663 2:233453808-233453830 GTTTCTTCTCCCCACCCAGCTGG - Intronic
947950137 2:234139727-234139749 GCACCTTGTCGCCACCGAGGGGG - Intergenic
948595602 2:239077358-239077380 CTTCCTTGGCCCCACCAAGTGGG + Intronic
1169000276 20:2163359-2163381 GCTCCATGTGCCAACAAAGCAGG - Intronic
1175943728 20:62549449-62549471 GCTCATTGTCCCCATCACACGGG + Intergenic
1176219814 20:63964569-63964591 GCTCCTTGTCGCCAGGCAGCAGG - Exonic
1179613229 21:42565637-42565659 GAGCCTTGTCCCCACCACGAGGG - Intronic
1179983942 21:44910858-44910880 GCTCCTTGTCCCAGGCCAGCTGG - Intronic
1181139521 22:20794257-20794279 GCTCCTTGTCCTCCACAAGGTGG + Intronic
1183454894 22:37917279-37917301 GCTCCTTGTCAACCCCAAGGAGG + Intronic
1184370823 22:44080982-44081004 ACTCCATGACCCCACAAAGCAGG - Intronic
1184417983 22:44363284-44363306 CCTCCCTGCCCCCACAAAGCCGG - Intergenic
949819118 3:8095988-8096010 GCTCCATATCCCCACCAATGAGG - Intergenic
950521493 3:13500416-13500438 GCTCCTTGTCCCCACCAAGCTGG - Intronic
952710232 3:36424065-36424087 TCTCCTTGTCCCCAGCAAAATGG + Intronic
953960752 3:47264001-47264023 GGTCCTTGTCTTCACAAAGCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954943015 3:54392594-54392616 CCTCCTGGTCCTCACCAAGCTGG + Intronic
958694561 3:97511029-97511051 GCCCCTCCCCCCCACCAAGCTGG + Intronic
959833704 3:110893607-110893629 GCTCCTTGTTCCTGCAAAGCTGG - Intergenic
961015705 3:123466668-123466690 TCTCCTTGTCCCTACCAGCCAGG + Intergenic
961642277 3:128371953-128371975 ACTCCTGGTCCGCACCAGGCTGG - Intronic
962640129 3:137377144-137377166 CCTCCCTCCCCCCACCAAGCTGG + Intergenic
963069849 3:141294241-141294263 CCTCCTTCTAACCACCAAGCAGG - Exonic
969690598 4:8702086-8702108 GCTCATGGTCCCCACGGAGCTGG - Intergenic
971134378 4:23852062-23852084 TCTACTTGTCCCCATCATGCAGG + Intronic
972449500 4:39182493-39182515 GCACCCGGTCTCCACCAAGCAGG - Exonic
974835345 4:67241671-67241693 TCTCCTTGTCCCCATCACACCGG - Intergenic
976956155 4:90902911-90902933 GCTCCTTGTCCTAAGCAGGCAGG + Intronic
986340528 5:6785306-6785328 CCTGCTTGCCCCCACCAATCTGG - Intergenic
987099812 5:14581890-14581912 GCTCCTTGTCGCCGCCATGCCGG - Exonic
989075503 5:37561515-37561537 ACTCCATTTCCCCACCAAGGTGG - Intronic
989329942 5:40245413-40245435 ACTGATTGTCCCCACCATGCAGG + Intergenic
993885945 5:93415083-93415105 GCTCCTTGACACAACGAAGCTGG - Intergenic
995294004 5:110497350-110497372 GTTCCATGTCTCCACAAAGCTGG - Intronic
996568664 5:124908816-124908838 GATCCATGTCCCCAAGAAGCAGG - Intergenic
998284169 5:140842491-140842513 GCCCCATGTCCCCTTCAAGCTGG + Exonic
999590431 5:153139149-153139171 GCCCCATGACCCAACCAAGCTGG + Intergenic
999775008 5:154805140-154805162 CCTCCCTCTCCCCACCAAGTAGG - Intronic
1001563473 5:172684848-172684870 TCTCCTTCACTCCACCAAGCTGG - Intronic
1001672061 5:173481854-173481876 GCTCCTCGTCTCCCCCAACCCGG + Intergenic
1002139305 5:177129122-177129144 GCTCCTTGTTCCCACTGAACAGG - Intergenic
1004105291 6:12661596-12661618 GCTCCTTTTCCTAACCAACCAGG + Intergenic
1007487454 6:42191338-42191360 CCTTTTTGTCCCCACCAAACCGG + Intronic
1007609791 6:43142052-43142074 CATCCTGGACCCCACCAAGCTGG + Exonic
1013173525 6:107658399-107658421 GCATCTTGGACCCACCAAGCAGG + Exonic
1019303961 7:323595-323617 GCTCCCTGTCCCCGCCCTGCAGG + Intergenic
1019565196 7:1675609-1675631 GCTCCTCGGCCCCAGGAAGCCGG - Intergenic
1020756798 7:12212734-12212756 ACACATTGTACCCACCAAGCAGG + Intronic
1021394843 7:20134227-20134249 TCTCCTTGTCTCACCCAAGCTGG - Intergenic
1021903444 7:25310400-25310422 GGTCAATGCCCCCACCAAGCTGG - Intergenic
1023044736 7:36201193-36201215 TCTCCTTGTCTCCTCCAATCTGG - Intronic
1023912487 7:44565847-44565869 GCTCCTTGGCACTTCCAAGCTGG - Exonic
1026486072 7:70822447-70822469 TCTCCAAGTCCCCACCCAGCAGG - Intergenic
1028596092 7:92547350-92547372 ACTCCTTGTCACCAACAACCTGG + Intergenic
1031960971 7:127989524-127989546 GGACCTTGTCTCCACCAAGCAGG + Intronic
1032411010 7:131693242-131693264 GCTCCCTCTCCCCAGAAAGCAGG + Intergenic
1038555842 8:28514782-28514804 CCTCCTTATGCCCACCAAGTAGG + Intronic
1040538307 8:48329007-48329029 GTTCCTGGGCCCCACCCAGCCGG + Intergenic
1040575227 8:48645976-48645998 GCTCCATCTGCCCACCCAGCAGG + Intergenic
1047399094 8:124531064-124531086 ACTACTTGTCATCACCAAGCTGG + Intronic
1048275309 8:133061611-133061633 TCTCTTTGACCCCACAAAGCAGG - Intronic
1048923948 8:139254075-139254097 GTTCCTTTTCCCTACCAAGGAGG - Intergenic
1053128032 9:35598864-35598886 GATCCTTGTCCCTTCCAAGTTGG + Intergenic
1056544354 9:87601415-87601437 GCTGCCTGTCCCCACCCAGAGGG - Intronic
1057228721 9:93305987-93306009 GGACCTTGTCCCCACCAGGCTGG + Intronic
1060105442 9:120870077-120870099 GCTGCTGGTGCCCACCAAGATGG + Intronic
1061014645 9:127974732-127974754 GCTCACTGCCCCCACCTAGCTGG + Intronic
1061710385 9:132483381-132483403 GCTCCTTGTCCTGAGCCAGCTGG - Intronic
1061786267 9:133030469-133030491 GGACCTTTTCCCCACCAAGCAGG + Intergenic
1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG + Intronic
1189341807 X:40210226-40210248 GTTCCTTGTTCCAAACAAGCTGG + Intergenic
1190163828 X:48055102-48055124 TATCCATGTCCCCACAAAGCAGG + Intronic
1190460456 X:50668205-50668227 GCTCCTTGTTACCGCCAAGCGGG - Intronic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1192736013 X:73850614-73850636 CCACCATGTCCACACCAAGCAGG + Intergenic
1193789416 X:85800294-85800316 GCTCCTTGTCCTCTGCAGGCAGG + Intergenic
1194798387 X:98240678-98240700 CGCCCCTGTCCCCACCAAGCTGG + Intergenic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic