ID: 950523913

View in Genome Browser
Species Human (GRCh38)
Location 3:13512599-13512621
Sequence CTGTCTGTGCAAGGAGACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950523913_950523917 3 Left 950523913 3:13512599-13512621 CCAACGTCTCCTTGCACAGACAG No data
Right 950523917 3:13512625-13512647 AACTGAAACCCAGAGAGAGCAGG No data
950523913_950523922 21 Left 950523913 3:13512599-13512621 CCAACGTCTCCTTGCACAGACAG No data
Right 950523922 3:13512643-13512665 GCAGGAGCCTTGGGCCGAGCAGG No data
950523913_950523919 11 Left 950523913 3:13512599-13512621 CCAACGTCTCCTTGCACAGACAG No data
Right 950523919 3:13512633-13512655 CCCAGAGAGAGCAGGAGCCTTGG No data
950523913_950523921 12 Left 950523913 3:13512599-13512621 CCAACGTCTCCTTGCACAGACAG No data
Right 950523921 3:13512634-13512656 CCAGAGAGAGCAGGAGCCTTGGG No data
950523913_950523923 27 Left 950523913 3:13512599-13512621 CCAACGTCTCCTTGCACAGACAG No data
Right 950523923 3:13512649-13512671 GCCTTGGGCCGAGCAGGAGCTGG No data
950523913_950523925 28 Left 950523913 3:13512599-13512621 CCAACGTCTCCTTGCACAGACAG No data
Right 950523925 3:13512650-13512672 CCTTGGGCCGAGCAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950523913 Original CRISPR CTGTCTGTGCAAGGAGACGT TGG (reversed) Intergenic
No off target data available for this crispr