ID: 950524156

View in Genome Browser
Species Human (GRCh38)
Location 3:13513800-13513822
Sequence CGTTTTCTCTCCTGTGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950524149_950524156 6 Left 950524149 3:13513771-13513793 CCGCCTGACTGCGATGTGCCCGG No data
Right 950524156 3:13513800-13513822 CGTTTTCTCTCCTGTGTCCTGGG No data
950524148_950524156 7 Left 950524148 3:13513770-13513792 CCCGCCTGACTGCGATGTGCCCG No data
Right 950524156 3:13513800-13513822 CGTTTTCTCTCCTGTGTCCTGGG No data
950524151_950524156 3 Left 950524151 3:13513774-13513796 CCTGACTGCGATGTGCCCGGCCT No data
Right 950524156 3:13513800-13513822 CGTTTTCTCTCCTGTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950524156 Original CRISPR CGTTTTCTCTCCTGTGTCCT GGG Intergenic