ID: 950525914

View in Genome Browser
Species Human (GRCh38)
Location 3:13523184-13523206
Sequence CACGGGAAGCAGGGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950525914_950525927 23 Left 950525914 3:13523184-13523206 CCAGCTTCCCCCTGCTTCCCGTG No data
Right 950525927 3:13523230-13523252 TGGCTTACTGATGGGCCTGCTGG No data
950525914_950525926 15 Left 950525914 3:13523184-13523206 CCAGCTTCCCCCTGCTTCCCGTG No data
Right 950525926 3:13523222-13523244 CTGCGTGTTGGCTTACTGATGGG No data
950525914_950525923 3 Left 950525914 3:13523184-13523206 CCAGCTTCCCCCTGCTTCCCGTG No data
Right 950525923 3:13523210-13523232 CCAGCTGACCTTCTGCGTGTTGG No data
950525914_950525928 26 Left 950525914 3:13523184-13523206 CCAGCTTCCCCCTGCTTCCCGTG No data
Right 950525928 3:13523233-13523255 CTTACTGATGGGCCTGCTGGTGG No data
950525914_950525925 14 Left 950525914 3:13523184-13523206 CCAGCTTCCCCCTGCTTCCCGTG No data
Right 950525925 3:13523221-13523243 TCTGCGTGTTGGCTTACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950525914 Original CRISPR CACGGGAAGCAGGGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr