ID: 950528513

View in Genome Browser
Species Human (GRCh38)
Location 3:13539052-13539074
Sequence CTCCATGTTTATTCTGAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950528513_950528517 10 Left 950528513 3:13539052-13539074 CCGCTCTCAGAATAAACATGGAG No data
Right 950528517 3:13539085-13539107 TGCCCACAGGCTCCCCCGTGAGG No data
950528513_950528514 -3 Left 950528513 3:13539052-13539074 CCGCTCTCAGAATAAACATGGAG No data
Right 950528514 3:13539072-13539094 GAGCTTCTTCCCGTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950528513 Original CRISPR CTCCATGTTTATTCTGAGAG CGG (reversed) Intergenic
No off target data available for this crispr