ID: 950528513 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:13539052-13539074 |
| Sequence | CTCCATGTTTATTCTGAGAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950528513_950528517 | 10 | Left | 950528513 | 3:13539052-13539074 | CCGCTCTCAGAATAAACATGGAG | No data | ||
| Right | 950528517 | 3:13539085-13539107 | TGCCCACAGGCTCCCCCGTGAGG | No data | ||||
| 950528513_950528514 | -3 | Left | 950528513 | 3:13539052-13539074 | CCGCTCTCAGAATAAACATGGAG | No data | ||
| Right | 950528514 | 3:13539072-13539094 | GAGCTTCTTCCCGTGCCCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950528513 | Original CRISPR | CTCCATGTTTATTCTGAGAG CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||