ID: 950535018

View in Genome Browser
Species Human (GRCh38)
Location 3:13573596-13573618
Sequence CACTCAGAAGCCACTGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950535011_950535018 21 Left 950535011 3:13573552-13573574 CCCTGTACATTCAGCATCTTACC 0: 1
1: 0
2: 1
3: 7
4: 203
Right 950535018 3:13573596-13573618 CACTCAGAAGCCACTGTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 200
950535017_950535018 -6 Left 950535017 3:13573579-13573601 CCTGTGCACATGCTGGGCACTCA 0: 1
1: 0
2: 2
3: 28
4: 252
Right 950535018 3:13573596-13573618 CACTCAGAAGCCACTGTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 200
950535012_950535018 20 Left 950535012 3:13573553-13573575 CCTGTACATTCAGCATCTTACCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 950535018 3:13573596-13573618 CACTCAGAAGCCACTGTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 200
950535015_950535018 0 Left 950535015 3:13573573-13573595 CCGGCTCCTGTGCACATGCTGGG 0: 1
1: 0
2: 0
3: 27
4: 305
Right 950535018 3:13573596-13573618 CACTCAGAAGCCACTGTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950535018 Original CRISPR CACTCAGAAGCCACTGTCAG AGG Intronic
901152487 1:7113188-7113210 CTGTCAGAAGCCACAGACAGAGG + Intronic
901416619 1:9120957-9120979 CATTCAGATGCCACTGCCTGGGG + Intronic
901712686 1:11128092-11128114 GACTTAGAAGCCACTGTCAGTGG + Exonic
905535008 1:38714464-38714486 CACCAAGAAACCAGTGTCAGAGG + Intergenic
905687132 1:39916464-39916486 CACTCAGAGCTCAGTGTCAGTGG + Intergenic
907601488 1:55775407-55775429 CTCTCAGAGGTCACTGTGAGGGG + Intergenic
910528738 1:88211361-88211383 CAACCAGGATCCACTGTCAGAGG + Intergenic
911424968 1:97697131-97697153 AAAACAGAAGCCACTGTTAGAGG + Intronic
912747450 1:112257056-112257078 CTCTCATATGCCAGTGTCAGTGG - Intergenic
913080186 1:115377171-115377193 CAATTAGAAGCCACTATCAGCGG + Intergenic
913539513 1:119805421-119805443 CACTCTGAAGCAACTGTCCTTGG + Intronic
915527539 1:156485228-156485250 AACTCAGCAGCCATTGGCAGTGG - Intronic
916618644 1:166471962-166471984 AACTCAGAAGCCACTATCAGTGG - Intergenic
918878657 1:190084643-190084665 CAGTAAGGAGCCATTGTCAGAGG - Intergenic
921153266 1:212418397-212418419 CAAGCAGAAGGCAGTGTCAGTGG + Intergenic
923148724 1:231215624-231215646 CTCACAGCTGCCACTGTCAGTGG + Exonic
923280423 1:232438090-232438112 CACTCAGTATCCCCTGGCAGTGG + Intronic
923733613 1:236579388-236579410 GACTCAGAGGCCACTGTCAAAGG + Intronic
1063972298 10:11389544-11389566 CACTCAGGAGCTACTCACAGGGG + Intergenic
1067528910 10:47056174-47056196 CTCTCAGCTGCCTCTGTCAGGGG + Intergenic
1067787717 10:49262794-49262816 CACTCAGGAGGCAATGTCAACGG - Intergenic
1068443667 10:57093246-57093268 TAATTGGAAGCCACTGTCAGTGG + Intergenic
1069264255 10:66438354-66438376 AAGGCAGAAGCCACAGTCAGGGG - Intronic
1070824193 10:79381302-79381324 ATCTCAGAGGCCACAGTCAGGGG + Intergenic
1071585417 10:86815742-86815764 CACTAAGAAGTCACTGCCACAGG - Intronic
1074263231 10:111874942-111874964 ATCTCAGAAGGCACTGTAAGTGG + Intergenic
1075191704 10:120315490-120315512 CACCCAGAGGCCACTGGAAGGGG - Intergenic
1076704247 10:132292744-132292766 CCCTGGGAAGCCACTCTCAGAGG + Intronic
1077149259 11:1061877-1061899 CACACAGGAGCCACTGTGAAGGG - Intergenic
1077575127 11:3377520-3377542 CAATCACATGCCCCTGTCAGAGG - Intronic
1079190465 11:18272785-18272807 CACACAGATGCCACTCCCAGGGG + Intergenic
1079466884 11:20739576-20739598 TTCTCAGAAGACACTGTCAAGGG - Intronic
1081524804 11:43920058-43920080 CACTGAGAAGCCACTTCAAGAGG + Exonic
1082703235 11:56459940-56459962 CAGACAGAATCCACTGACAGAGG - Intergenic
1085281957 11:75336760-75336782 CAATGAGAAACCACTGTCAAAGG + Intronic
1088577164 11:111283484-111283506 CACACAGAAGCCAATTTTAGAGG - Intronic
1088834700 11:113567909-113567931 CTCTCAGATGCCACAGTCACTGG + Intergenic
1089037382 11:115408768-115408790 CACACAGAAGCCAGGGGCAGAGG + Intronic
1090666817 11:128919864-128919886 CACTCAGAGGCCACTGCCCTTGG + Exonic
1091017128 11:132062007-132062029 CATGCAGAAGCCACTGGCTGAGG + Intronic
1091369097 11:135043998-135044020 AAGTCAGAAGCCACTGGCAGTGG - Intergenic
1093205701 12:16246259-16246281 AAGACAGAAGCCACTGTGAGAGG + Intronic
1094419673 12:30257426-30257448 CACCATGCAGCCACTGTCAGGGG - Intergenic
1100332916 12:93602371-93602393 CAGGCATAAGCCACTGTCACTGG + Intergenic
1101728714 12:107409020-107409042 CACTCAGAAGTCCCTTTCTGGGG - Intronic
1102741301 12:115209729-115209751 CACACAGAAGTAACTGGCAGAGG - Intergenic
1103950907 12:124550477-124550499 CCCCCAGCAGCCACTGGCAGGGG + Intronic
1105544719 13:21342928-21342950 CCCACAGAGGCCCCTGTCAGGGG + Intergenic
1106134154 13:26961858-26961880 AATTCAGAAGCCCCTCTCAGAGG + Intergenic
1106171923 13:27296051-27296073 CACTGAGAGGCCTCTGTCTGTGG + Intergenic
1107683664 13:42875570-42875592 CTGTGAGAAGCCTCTGTCAGCGG + Intergenic
1108432426 13:50367649-50367671 CAGTCAGAAGGCACCATCAGTGG - Intronic
1112214704 13:97418278-97418300 CAGACAGAAGCCACTTTAAGTGG + Intergenic
1113514390 13:110881361-110881383 ATATCAGAAGCCTCTGTCAGAGG - Intronic
1115010586 14:28540284-28540306 CCCTCTGAAGCCACAGTCTGAGG - Intergenic
1118356179 14:65015697-65015719 CACTCTGTAGCCACTATCTGGGG - Exonic
1118747215 14:68782827-68782849 CATCCAGAAGCCACTGTCCTGGG - Intergenic
1121499821 14:94425886-94425908 CACACATAGGCCACAGTCAGTGG - Intergenic
1122755284 14:103973748-103973770 CTCTCAGAAGCCACTTGGAGTGG - Intronic
1127640681 15:60913150-60913172 CACTCAGAAGCCAGGGAAAGAGG - Intronic
1128576614 15:68780320-68780342 GACTCAGAGGCCCCTGGCAGTGG - Intronic
1130347608 15:83063149-83063171 AACTGAGAAGCAGCTGTCAGTGG - Intronic
1130536307 15:84787360-84787382 GACTCAGAAGCCACAATGAGTGG - Intronic
1131982690 15:98010679-98010701 CCCTCAGAAGCCACGCTAAGTGG - Intergenic
1132674950 16:1117654-1117676 CCCCCAGAAGCCACACTCAGAGG - Intergenic
1133364027 16:5196850-5196872 TTCCTAGAAGCCACTGTCAGAGG - Intergenic
1134226151 16:12391978-12392000 CACTGAGAAGCAAGCGTCAGAGG - Intronic
1135801919 16:25505416-25505438 CACTCACCAGGGACTGTCAGGGG - Intergenic
1136254099 16:29026632-29026654 GACTCTGAAGTCACTGGCAGCGG + Intergenic
1137540063 16:49355958-49355980 CACACAGATGCCACAGCCAGTGG + Intergenic
1138412183 16:56849456-56849478 CAAACAGAAGCCAGTGTCTGGGG - Intronic
1138831910 16:60384499-60384521 CACTCAGATGCCACCCTCACTGG - Intergenic
1138992515 16:62409047-62409069 CATTCAGACGCCAATGTCCGAGG - Intergenic
1140703352 16:77603074-77603096 CACTCAGAAGCAACTCTCTGAGG - Intergenic
1141236768 16:82225734-82225756 CACACACAACTCACTGTCAGTGG - Intergenic
1141612557 16:85190920-85190942 GACACAGAAGCAGCTGTCAGTGG - Intergenic
1146429516 17:32777973-32777995 CATTCAGAATCCACTGACAGTGG - Intronic
1148112216 17:45151616-45151638 CCCTCAGAAGACACTGACACAGG - Exonic
1148780582 17:50119103-50119125 CCCCCAGAATCCACTGGCAGTGG + Intronic
1150986547 17:70204490-70204512 CTCGAAGAAGCCATTGTCAGAGG + Intergenic
1155422703 18:25672588-25672610 CACCCAGAAGCCCCTGGCAGAGG - Intergenic
1159940158 18:74400631-74400653 CACTTGGAAGCCAAGGTCAGAGG - Intergenic
1159977950 18:74739288-74739310 CCCACAGAAGCCACTGCCAGAGG + Intronic
1161470218 19:4453486-4453508 CAAGCCGAAGCCACCGTCAGCGG - Exonic
1163747766 19:19058214-19058236 CACTCTGAGGCCACTGACTGTGG - Intronic
1164894155 19:31855398-31855420 CTTTCAGAAGACACTGACAGAGG + Intergenic
1166620232 19:44290832-44290854 TAGTCAGAAGCGACGGTCAGTGG - Intronic
926174022 2:10573107-10573129 AACTGAGAAAGCACTGTCAGGGG + Intronic
927128502 2:20036155-20036177 CACACAGAAGCCGCTGACCGTGG + Intronic
929453149 2:42049393-42049415 CACCCAGAAGACACTGGAAGGGG + Intronic
933405507 2:81852895-81852917 CACTAAGATGCCAGTGTCATAGG - Intergenic
935094861 2:99934667-99934689 CCCTCAGAAGCCACTGGGAAGGG + Intronic
935971691 2:108535365-108535387 GAATCTGAAGCTACTGTCAGCGG + Intronic
935982443 2:108640558-108640580 CACTCAGGAGCCCCAGGCAGAGG - Intronic
936522011 2:113217465-113217487 CACTCAGAGGCCAAAGTCTGGGG + Exonic
937895402 2:126973778-126973800 CACCCAGAAGCCACTGCCAGGGG - Intergenic
938095442 2:128458337-128458359 CCCTCACATGCCACTGTCACTGG + Intergenic
939388089 2:141528120-141528142 CAAGCAGAAGCCACTGGAAGAGG - Intronic
944191902 2:197012166-197012188 CACTAAAAAGACACTGTCACTGG - Intronic
945019349 2:205555808-205555830 CATTTAAAAGCCACTGCCAGGGG - Intronic
947819671 2:233061118-233061140 CAGTCAGAAGCTGCTTTCAGGGG + Intronic
948119477 2:235518325-235518347 CATTCAGAGATCACTGTCAGTGG - Intronic
948544105 2:238714197-238714219 GACTCAGAACCCACTGAGAGTGG + Intergenic
1170135474 20:13069231-13069253 CACTCTGAAGTCACTGTCTAGGG + Intronic
1170961345 20:21028543-21028565 CACTCAGATGCCTCTGGCTGGGG + Intergenic
1174656327 20:52175542-52175564 AACTCAGAATTCACTGTCTGAGG + Intronic
1174941448 20:54933472-54933494 CACTCAGAAGGCAATGTCGCTGG + Intergenic
1175360185 20:58403850-58403872 GATCCAGAAGCCACAGTCAGTGG - Intronic
1175522394 20:59610301-59610323 CACACAGAAGCCAATGACAATGG + Intronic
1177252186 21:18607770-18607792 TACTCAGAATCCATTATCAGTGG - Intergenic
1177276848 21:18923267-18923289 CACTCAGAAAGCCCTGGCAGAGG + Intergenic
1179195662 21:39160212-39160234 CCCTCAGCAGCCTCAGTCAGAGG + Intergenic
1179456334 21:41503335-41503357 CACACACAAGCCACTGGCTGAGG + Intronic
1179828234 21:43980366-43980388 CACTCCGCAGCCACTGCCCGTGG - Intronic
1180955025 22:19737716-19737738 CACTCGGAGGGCACTGCCAGAGG - Intergenic
1181052910 22:20246158-20246180 GGCTCAGGAGCCACAGTCAGGGG + Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1182518533 22:30872302-30872324 CTCCCAGAAGCCACTGCCGGAGG + Intronic
1182892621 22:33831566-33831588 CACTCTCAAGCCACTCACAGTGG + Intronic
1185158315 22:49207480-49207502 GGCTCACAAGCCACAGTCAGAGG + Intergenic
950141478 3:10619083-10619105 CACCCAGGAGCCACTGGCAGGGG + Intronic
950269252 3:11600619-11600641 CAGTCATAAGACACTGACAGAGG - Intronic
950429610 3:12943381-12943403 CACTGAGAAGCCACCTGCAGCGG - Intronic
950535018 3:13573596-13573618 CACTCAGAAGCCACTGTCAGAGG + Intronic
950838743 3:15946500-15946522 CACTTAAAATCTACTGTCAGGGG - Intergenic
953117832 3:40010304-40010326 CCCTCAGCTGCCACTCTCAGAGG - Intronic
953589867 3:44241608-44241630 CTCGCAAAGGCCACTGTCAGTGG - Intergenic
953735621 3:45491757-45491779 CACTCTGAAGCCATGGCCAGTGG - Exonic
954327801 3:49873071-49873093 CCCACAGCAGCCACTGTCTGTGG + Intergenic
954853939 3:53626602-53626624 CACTCAGGTGTCACTGTGAGGGG + Intronic
956864242 3:73353580-73353602 AACTTACAAGCAACTGTCAGGGG - Intergenic
960554696 3:119014830-119014852 CACAAGGAAGCCACTGTAAGCGG + Intronic
967233882 3:187366524-187366546 CACACTGGAGCCAGTGTCAGAGG - Intergenic
967577526 3:191111810-191111832 TACTCAGCACCCACTGTCAGTGG + Intergenic
968763033 4:2452081-2452103 CACCCAGCAGCCTCTGTCACGGG + Intronic
970385665 4:15554123-15554145 AAGTCAGAAGCCACTTCCAGTGG + Intronic
971686867 4:29781692-29781714 CAGTCAGATTCCTCTGTCAGGGG + Intergenic
971803573 4:31325105-31325127 CAATCAGAAGCCACTGTGCTTGG + Intergenic
972084731 4:35201419-35201441 CAGGCAGAAGACTCTGTCAGAGG - Intergenic
972236314 4:37137941-37137963 CACACAGAAGCTAATGTCACAGG - Intergenic
973712768 4:53645497-53645519 TACTCAGAAGGCAATTTCAGTGG - Intronic
978031512 4:103943522-103943544 TACCCAGAAGCCACTCCCAGAGG + Intergenic
978278297 4:106978396-106978418 AAGGCAGCAGCCACTGTCAGGGG - Intronic
979479510 4:121200022-121200044 CCCTCAAAAACCACGGTCAGAGG + Intronic
980705348 4:136485783-136485805 CAAACAGAAGCCATAGTCAGGGG + Intergenic
983005083 4:162474979-162475001 CTCTCAGAAGGCAGTGTCATGGG + Intergenic
989132393 5:38120229-38120251 CATTCAGCAGCTACTGTGAGGGG - Intergenic
994100013 5:95881907-95881929 CACTCACAAGCCACAGACTGTGG - Intergenic
997387307 5:133483567-133483589 AACTCTGAAGCCAGTGTCAGAGG - Intronic
997387748 5:133486971-133486993 TTCTCAGAAGCCAGGGTCAGGGG - Intronic
997432606 5:133851177-133851199 CACTCTGAAGACTCTGCCAGTGG - Intergenic
998690820 5:144585527-144585549 CACTCAGAAACTACTTTTAGAGG + Intergenic
1000827462 5:166063412-166063434 CAGTGGGAAGCCACTGTCATCGG - Intergenic
1001123629 5:168999597-168999619 CACTAGGAAGCCAATGTGAGTGG - Intronic
1002881482 6:1256473-1256495 CACTCAGAAGCAACTGTACAAGG - Intergenic
1003513564 6:6801183-6801205 CAAGCAAAAGTCACTGTCAGGGG - Intergenic
1004326751 6:14681982-14682004 CACTCAGAACCCAGTGGCCGGGG - Intergenic
1004702983 6:18096381-18096403 TACTCAGAAGCCACCCTCACAGG - Intergenic
1006743868 6:36327675-36327697 CACGGAGAAGCCACTGACAATGG + Intronic
1006990130 6:38208276-38208298 CACTCATAAAGAACTGTCAGAGG - Intronic
1007085762 6:39143769-39143791 CACTCAGAAGCCTCTGTTCTTGG + Intergenic
1007416871 6:41696092-41696114 CCCTCAGAAGCCCTTGTCTGGGG - Intronic
1008541049 6:52546721-52546743 CGCTGAGAAGGCACAGTCAGAGG + Intronic
1010157598 6:72812716-72812738 CACTTAGAAGCCATAGTAAGTGG + Intronic
1011203918 6:84870866-84870888 CTCTCAGAAGCCCCTGCTAGTGG + Intergenic
1013079237 6:106798177-106798199 CTCTTAGAAGCCTCTGTAAGGGG + Intergenic
1013163982 6:107573218-107573240 CAATCAGAAGACACTGCCAAAGG - Intronic
1013851005 6:114515202-114515224 CACAAAGAAGCCACTGCCACCGG - Intergenic
1014052898 6:116976401-116976423 CTCTCAGAGCTCACTGTCAGAGG - Intergenic
1014516996 6:122391795-122391817 CACTCAGAAGCAGCTGGCATGGG - Intergenic
1014905896 6:127026406-127026428 CTCTCAGAAGAGACTTTCAGGGG - Intergenic
1015604378 6:134940054-134940076 CACACAGCAGGCCCTGTCAGGGG + Intronic
1015726684 6:136306577-136306599 CAGTCAGAGGCAACTGTCTGCGG - Intergenic
1016005392 6:139084006-139084028 CACTCAAAAACCCCTGTGAGTGG - Intergenic
1017735216 6:157356655-157356677 CATTCAGAAACAACTGTCAAAGG + Intergenic
1018281175 6:162187369-162187391 CACTCAGCTGACACTGTCATGGG - Intronic
1018932484 6:168250396-168250418 CACTCAGCAAGCACTGTCTGAGG + Intergenic
1019083971 6:169456921-169456943 CACGCAGAACCCACAGGCAGAGG + Intergenic
1020769982 7:12378619-12378641 CACTCAGCAGACAGTGTCAGGGG - Intronic
1021456575 7:20835643-20835665 AACTCAGAGGCCACAGTTAGTGG + Intergenic
1022322557 7:29300446-29300468 CATTCAGAAGCCAGTGTCAAAGG - Intronic
1023414175 7:39916815-39916837 TACACAGAAGCCAATGTCACAGG + Intergenic
1029228649 7:99047908-99047930 CACTCCGAAGCCCCGGCCAGGGG + Intronic
1030747402 7:113183851-113183873 TACTCAGAAGACAGTGTAAGTGG + Intergenic
1033062372 7:138121347-138121369 CATTCTGAAGCCACAGTCATAGG + Intergenic
1034382982 7:150715302-150715324 CACTCATAACTCTCTGTCAGAGG - Intergenic
1035956823 8:4089358-4089380 CACTGAGAAGACATTTTCAGAGG + Intronic
1036440847 8:8780564-8780586 CACGCAGAAGTACCTGTCAGTGG - Intergenic
1038575825 8:28702227-28702249 CTTTCAGGAGCCACAGTCAGAGG + Intronic
1039679777 8:39719490-39719512 TATTCAAAAGCCACTGTTAGGGG + Intronic
1040536733 8:48317096-48317118 CACTCAGAGGACACAGGCAGTGG + Intergenic
1041380055 8:57245329-57245351 AACTCAGAAGACACTTTGAGAGG + Intergenic
1042368403 8:67963000-67963022 CACTTAGAAGTCTCTGCCAGAGG - Intronic
1044969752 8:97607407-97607429 CAATCAGAAGCTTCTGGCAGTGG + Intergenic
1048821136 8:138381853-138381875 CACAGAGAAGCCAGTGTCGGGGG + Intronic
1049437056 8:142591508-142591530 CATGCAGAGGCCACTGTGAGAGG - Intergenic
1049437825 8:142595796-142595818 CACCCAGACGCCACTGACAAGGG + Intergenic
1050009709 9:1173083-1173105 CACTCAGAAACCAGGGTCTGGGG - Intergenic
1050375488 9:4968233-4968255 CATTCAGATGCCATTTTCAGTGG - Intergenic
1052778741 9:32758915-32758937 AACTCAGAAGTCACTGTGAGAGG + Intergenic
1052897325 9:33759915-33759937 CCCTCAGCATCCACTGCCAGTGG - Intronic
1058351711 9:104032828-104032850 TTCTCAGAAGACACTGCCAGAGG - Intergenic
1058699018 9:107585851-107585873 CACTCAACAGCCATTGTAAGTGG + Intergenic
1060808210 9:126591973-126591995 AAATCATAAGCCTCTGTCAGTGG + Intergenic
1062466680 9:136684697-136684719 TACTCTGGAGTCACTGTCAGTGG + Intronic
1062633027 9:137475143-137475165 CACTGGGAATCCAGTGTCAGTGG + Intronic
1186254787 X:7706991-7707013 CACTCAGAAGCAGCTTTCTGGGG - Intergenic
1186841147 X:13485788-13485810 CCCTCTGAAGCACCTGTCAGTGG + Intergenic
1187879139 X:23830375-23830397 AATGCAGAAACCACTGTCAGGGG - Intergenic
1188840761 X:35014173-35014195 CAGTGAGAAGACACTGTCTGTGG + Intergenic
1190406212 X:50090425-50090447 CACTGGGAAGCCACTGTAAGTGG - Exonic
1190962315 X:55264699-55264721 CTCTCAGAAGCCACGGACTGTGG + Exonic
1194432879 X:93832544-93832566 CAGTCATAAGCCACTGTGACTGG + Intergenic
1196255239 X:113510460-113510482 CATTCAGAAGTGAATGTCAGTGG + Intergenic
1199529022 X:148826187-148826209 CTCTGAGAATCCACTGCCAGTGG - Intronic
1199662201 X:150063292-150063314 CACTCAGAAGGCACTGACTAGGG + Intergenic
1200747139 Y:6912150-6912172 CACACTGAGGCCACTGTCTGGGG - Exonic
1201961835 Y:19689669-19689691 CACTCAGAAGCCCCATTCAAAGG - Intergenic