ID: 950536582

View in Genome Browser
Species Human (GRCh38)
Location 3:13582416-13582438
Sequence GGTCCTAGAGGCCCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950536582_950536590 6 Left 950536582 3:13582416-13582438 CCAGGCTGTGGGCCTCTAGGACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 950536590 3:13582445-13582467 CTGCAGCATCCGGGGCTTTGAGG 0: 1
1: 0
2: 1
3: 20
4: 177
950536582_950536585 -4 Left 950536582 3:13582416-13582438 CCAGGCTGTGGGCCTCTAGGACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 950536585 3:13582435-13582457 GACCTCTGGCCTGCAGCATCCGG 0: 1
1: 0
2: 1
3: 21
4: 252
950536582_950536588 -2 Left 950536582 3:13582416-13582438 CCAGGCTGTGGGCCTCTAGGACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 950536588 3:13582437-13582459 CCTCTGGCCTGCAGCATCCGGGG 0: 1
1: 0
2: 2
3: 26
4: 223
950536582_950536592 18 Left 950536582 3:13582416-13582438 CCAGGCTGTGGGCCTCTAGGACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 950536592 3:13582457-13582479 GGGCTTTGAGGTGAAGCTTCTGG 0: 1
1: 0
2: 2
3: 14
4: 169
950536582_950536586 -3 Left 950536582 3:13582416-13582438 CCAGGCTGTGGGCCTCTAGGACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 950536586 3:13582436-13582458 ACCTCTGGCCTGCAGCATCCGGG 0: 1
1: 0
2: 2
3: 32
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950536582 Original CRISPR GGTCCTAGAGGCCCACAGCC TGG (reversed) Intronic
900521560 1:3107845-3107867 GGTCATTGAGGCCCAGAGCTTGG - Intronic
901188571 1:7390178-7390200 GCTCCTAGAGGCCCAGGCCCTGG - Intronic
901333131 1:8425624-8425646 GGTCCTGGCGTTCCACAGCCTGG - Intronic
902216592 1:14938094-14938116 GGTCATAGAGCCCCACTGCCTGG + Intronic
902629734 1:17697433-17697455 GGTCCTAGAGCACGAGAGCCGGG - Exonic
902981785 1:20128679-20128701 CCCCCTAGAGGCCCACAGTCAGG + Intergenic
903137825 1:21320920-21320942 GATCCTAGAGGCTCAGACCCAGG - Intronic
903321054 1:22543419-22543441 GGCCCTAGAGACCCTGAGCCGGG + Intergenic
903510990 1:23874810-23874832 GGCCCTCATGGCCCACAGCCTGG - Exonic
903703827 1:25270325-25270347 GTTCCTAACGGGCCACAGCCTGG - Intronic
903723416 1:25422999-25423021 GTTCCTAACGGGCCACAGCCTGG + Intronic
903765257 1:25729904-25729926 GGTCCCCGTGGCTCACAGCCAGG + Intronic
904374147 1:30069248-30069270 GCTCCTAGAGGGCCCCAGACTGG + Intergenic
906060374 1:42944495-42944517 AGGCCCAGAGACCCACAGCCAGG - Intronic
906320550 1:44813043-44813065 TTTCATAGAGGCCCACAGCCAGG + Exonic
911956196 1:104238169-104238191 GGTTCTAGTGTCTCACAGCCTGG + Intergenic
915595054 1:156892407-156892429 CTTCCCAGAGCCCCACAGCCGGG - Intergenic
916171126 1:162002416-162002438 GTTCCTAGATGCCCAGTGCCCGG + Intronic
917472139 1:175334931-175334953 GGTCCTAGAGGCAGAGAGGCCGG + Intronic
917927324 1:179800180-179800202 AGCCCAAGGGGCCCACAGCCAGG + Intronic
920418401 1:205813423-205813445 GGTCCGAGGGGCCCGCTGCCCGG + Intronic
921157374 1:212449156-212449178 AGCCCTAGAGCCCCACAGCTGGG - Intergenic
921196195 1:212760183-212760205 GGTACCAGTGGCCCACAGGCTGG - Intronic
922718182 1:227887564-227887586 GGCCAAAGGGGCCCACAGCCCGG - Intergenic
923563450 1:235059304-235059326 GGGCCTTGAGGCCCACAGCCAGG - Intergenic
1068431177 10:56934566-56934588 GGACCCAGAGGCCCAACGCCAGG - Intergenic
1070665853 10:78342921-78342943 GCTCCTACAGGCCCAGAGCTGGG + Intergenic
1073147459 10:101290163-101290185 GTCCCGAGAGACCCACAGCCTGG - Intergenic
1073176691 10:101561248-101561270 GCACCTTGTGGCCCACAGCCAGG - Intergenic
1074194953 10:111175577-111175599 GGGCCTAGAGGCCCCCAGCCCGG - Intergenic
1075954353 10:126509061-126509083 GGACCTAGAGGCCCAGAGGACGG + Intronic
1075991319 10:126841274-126841296 GGTTCTATACCCCCACAGCCTGG + Intergenic
1076143569 10:128098441-128098463 GGTCGTGATGGCCCACAGCCTGG + Exonic
1076727904 10:132421883-132421905 TGCCCTAGAGCCCCATAGCCAGG + Intergenic
1076830525 10:132992194-132992216 TGTCCTCGAGGCTCACAGGCAGG - Intergenic
1077123999 11:924613-924635 AGTTCTGGAGGCCCAGAGCCTGG + Intergenic
1077158862 11:1103587-1103609 GGGGCAAGAGGCCCACAGCCAGG - Intergenic
1077418034 11:2434800-2434822 GGGCCAGGAGGACCACAGCCTGG + Intergenic
1078735931 11:14020762-14020784 AGTTCTGGAGTCCCACAGCCAGG + Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081770657 11:45648824-45648846 GGTACGAGAGGGCCTCAGCCGGG - Intergenic
1082785357 11:57313547-57313569 GGTCTTGGAGCCCCATAGCCTGG - Exonic
1083746032 11:64736917-64736939 GGTCCTTGAGGTGCACACCCAGG + Exonic
1083983367 11:66192554-66192576 GGGCCTAGAGGGCCTCAGCACGG + Intronic
1084091695 11:66883043-66883065 GCTCCTGGGGGCCCAGAGCCCGG - Intronic
1084264861 11:67999631-67999653 GGGCGTAGATGCCCACAGCGAGG + Exonic
1084588106 11:70074941-70074963 GGACCAAGAGGCCCAGCGCCTGG - Intergenic
1084939455 11:72604667-72604689 GGTTCTGGAGCCCCACTGCCTGG - Intronic
1088906606 11:114159876-114159898 GGTTCAAGCAGCCCACAGCCTGG + Intronic
1089453547 11:118612691-118612713 GGTCCTCGGGACCCACTGCCAGG + Intronic
1089961563 11:122621508-122621530 GGTCCTAGATTCCCACCCCCAGG - Intergenic
1090089058 11:123678261-123678283 GGTCATCGGGGCCCACAGTCTGG - Intergenic
1090801317 11:130174218-130174240 CCTCCTGGGGGCCCACAGCCAGG + Intronic
1091236584 11:134026228-134026250 AGTCCTAGAGGTCCACAGCAAGG + Intergenic
1094491536 12:30963843-30963865 GGGTCCAGATGCCCACAGCCAGG - Exonic
1097372041 12:58796068-58796090 GGTGGGAGAGGGCCACAGCCTGG + Intronic
1098893095 12:76030290-76030312 GGTCCGCGAGGCCCCCTGCCTGG + Intronic
1101569016 12:105936085-105936107 TGTGCTAGAGGTCCTCAGCCTGG - Intergenic
1101966817 12:109287500-109287522 GGCCATAGAGGCCCACAGGAGGG + Exonic
1104860350 12:131920206-131920228 GGACCTTGATGCCCACAGCGTGG + Intronic
1104876125 12:132036060-132036082 CGTCTTAGAAGCACACAGCCAGG + Intronic
1113735088 13:112672709-112672731 TGTCCCAGTGCCCCACAGCCTGG + Intronic
1114194886 14:20468834-20468856 GGTCCTAGATGCCGACAGAAAGG - Intergenic
1117071542 14:52061537-52061559 GGTGGTAGAGGCCAAGAGCCGGG + Intronic
1118320220 14:64748554-64748576 GGTGCTAGAGGCACTCAGCCAGG + Exonic
1118904751 14:70015676-70015698 GGTTCAACAGGCCCACAGACGGG + Intronic
1119443059 14:74641756-74641778 GGTCCCAGCGGCCCACAGTATGG + Intergenic
1119520606 14:75281560-75281582 AGTCCTTGAGGCCCACAGCCTGG - Exonic
1119669468 14:76507596-76507618 GGTCCCAGAGGGGCACATCCTGG - Intergenic
1119880205 14:78093742-78093764 GGTCCTTGAGGCTCAAAGCCTGG - Intergenic
1120934853 14:89884902-89884924 GGACCCAGAAGCACACAGCCAGG + Intronic
1122117799 14:99536349-99536371 GGGCTCAGAGGCCCACAGCGAGG - Intronic
1122784626 14:104157991-104158013 GTCCCCAGGGGCCCACAGCCGGG - Intronic
1123626963 15:22233943-22233965 GGTCCTAGAGTCACATGGCCAGG - Intergenic
1124962675 15:34410163-34410185 CGTCCTGGAGGCCCACGACCAGG + Intronic
1124979300 15:34556385-34556407 CGTCCTGGAGGCCCACGACCAGG + Intronic
1127221754 15:56887448-56887470 GGTCCGAGAGCCGCACAGGCCGG - Intronic
1128159340 15:65413270-65413292 GGCCCTGGCAGCCCACAGCCTGG + Intronic
1128904446 15:71454476-71454498 GGCCCTGGAGCCCCACAGCTGGG - Intronic
1129178191 15:73855109-73855131 TGTCCCAGAGGCCCACGGCCAGG + Intergenic
1130120610 15:81044364-81044386 TGCCATAGAGGCCCACTGCCAGG - Intronic
1131227979 15:90640872-90640894 GGTCCCTGAGGTCCACAGCGTGG - Intronic
1132466536 16:79943-79965 TGCCCTAGATGCCCAGAGCCGGG - Intronic
1132617982 16:851810-851832 GGCCCTCGAGGCCCCCAGCTGGG + Intergenic
1132744384 16:1430632-1430654 GGTCCCAGGGACCCCCAGCCAGG - Intergenic
1134195888 16:12158647-12158669 TGTCCTTTTGGCCCACAGCCTGG - Intronic
1136397161 16:29999394-29999416 CGTCCTGGAGGCCCACGCCCTGG + Intronic
1136458301 16:30394969-30394991 GGTCCGAGAGGCCGAGGGCCCGG - Intronic
1136482014 16:30548002-30548024 GGAACCAGAGGCCCACAGGCCGG + Intronic
1137829093 16:51526721-51526743 CGGCCTGGAAGCCCACAGCCAGG - Intergenic
1138744726 16:59349729-59349751 TGTACTAGAGGCAGACAGCCTGG + Intergenic
1140507530 16:75483208-75483230 GGTGGGAGAAGCCCACAGCCTGG - Intronic
1140514607 16:75532946-75532968 GGTGGGAGAGGCCCACAGCCTGG - Intronic
1141150644 16:81562492-81562514 GGTCCAAGAGGCCCGCAGCTGGG - Intronic
1141908895 16:87045144-87045166 GCTCCTGGAGACCCACAGCCAGG + Intergenic
1141977013 16:87523460-87523482 GGTCCTAGAGTCACACGGCCAGG + Intergenic
1142979513 17:3663564-3663586 GGTCCCAGAGGCCCCAGGCCAGG + Exonic
1144727673 17:17510049-17510071 GGTGCCAGAGCCACACAGCCTGG - Intronic
1144729211 17:17517079-17517101 GGTCCTTGAGGCCCAGCTCCTGG - Intronic
1144771250 17:17760786-17760808 GGTCCTAGCTGCCCAGGGCCAGG + Intronic
1146007417 17:29169414-29169436 GGCCCAAAAGGCACACAGCCAGG + Intronic
1147141428 17:38462827-38462849 GGTCCTAGTGGGCATCAGCCAGG - Exonic
1151327511 17:73388243-73388265 GCTCCTAGAGCCCCAGGGCCTGG + Intronic
1151750191 17:76032759-76032781 GGGCCTAGAGGAGCACAGTCTGG + Intergenic
1151817286 17:76477539-76477561 GGACCCAGAGGCCCACTGCTGGG - Intronic
1151984050 17:77530629-77530651 GTTCCTAAAGGGCCACAGACCGG + Intergenic
1152099722 17:78294045-78294067 GGACCTAGAGGCACATGGCCTGG + Intergenic
1152364808 17:79849503-79849525 CGGCCCAGAGGCCCACAGGCAGG + Intergenic
1152655655 17:81518106-81518128 GGTGCTGGAGGCCCACAGAGTGG + Intronic
1152658202 17:81529700-81529722 GGGGCAGGAGGCCCACAGCCTGG + Intronic
1152697168 17:81803246-81803268 GGTTCTAGGGCCCCAAAGCCAGG + Intergenic
1152716383 17:81902616-81902638 CGTCCTGGACGCACACAGCCTGG - Exonic
1156489083 18:37485778-37485800 GGTACGAGAGGCAGACAGCCGGG - Intronic
1157766197 18:50298964-50298986 GGTCCTACAAGCCCACACCTGGG + Intergenic
1158536335 18:58311460-58311482 GGTCCTAAAGACCCCCAGCTGGG - Intronic
1160731845 19:644802-644824 GAGCCAAGAGCCCCACAGCCTGG + Intergenic
1160816171 19:1036748-1036770 TTCCCTAGAGACCCACAGCCAGG - Intronic
1161677653 19:5661469-5661491 GGACCTAGACACCCCCAGCCAGG - Intronic
1161736432 19:5994894-5994916 GGGCCCAGACGCCCGCAGCCTGG - Exonic
1162573504 19:11485795-11485817 GGTCCCATAGGCCCACAGAAGGG + Intronic
1163543513 19:17926502-17926524 GGTTATAGAGGCCCACAGCCTGG - Intergenic
1163544110 19:17930822-17930844 GGTTGTGGAGGCCCACAGCCTGG - Intergenic
1167634074 19:50643525-50643547 GGTCCTAGATGCAAACAGCATGG - Intronic
925830181 2:7886252-7886274 GGTCCTAAAGCCACACAGCCAGG + Intergenic
925873443 2:8291287-8291309 GGTCATGGAGGCATACAGCCTGG - Intergenic
929041274 2:37747074-37747096 AGCCCTAGGGGCCGACAGCCTGG + Intergenic
930090326 2:47527184-47527206 AGTCCTCCAGGACCACAGCCAGG + Intronic
930232536 2:48857634-48857656 GGTACTAGAGCCCTCCAGCCTGG - Intergenic
932007450 2:67940781-67940803 GGCCCTTGAGGATCACAGCCTGG + Intergenic
932445722 2:71779805-71779827 GCTCCTACAGTCCCACAGCCTGG - Intergenic
934695409 2:96396512-96396534 AGTCCTAGAAGCCCAGAGCGGGG - Intergenic
934718079 2:96554687-96554709 GGGCCCAGTGCCCCACAGCCCGG + Intergenic
934773274 2:96921456-96921478 GGTACTAGACGCCCAGAGCCTGG - Exonic
936509294 2:113132479-113132501 GGTCCCAGAGTCCCACAGAATGG + Intronic
937528656 2:122801767-122801789 GGACCTACAGCCCTACAGCCAGG + Intergenic
938380013 2:130831406-130831428 GGTCCCAGAGCCCCGGAGCCTGG - Intergenic
939590927 2:144062428-144062450 GGTTCTAGAGTCACACTGCCTGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947634798 2:231674513-231674535 GGACTTAGAGGCACACATCCAGG + Intergenic
948686811 2:239675245-239675267 GGGGCAAGAGGCCCACAGCTGGG + Intergenic
948997718 2:241592185-241592207 GCTCAGAGAGGCCCCCAGCCTGG - Intronic
1168954669 20:1826540-1826562 GATCCCAGAGGCCAACAGCATGG - Intergenic
1174371057 20:50088018-50088040 GGCACTACAGGCCCAGAGCCTGG + Intronic
1178909110 21:36659997-36660019 GGTGCATGGGGCCCACAGCCTGG - Intergenic
1179882854 21:44300592-44300614 GGTCCCGGAAGCCCGCAGCCTGG - Intronic
1180695087 22:17746833-17746855 GGTTCTAGAGGCCCAAAGGCTGG - Intronic
1181563266 22:23717745-23717767 GGTCCCAGAGGCCCAGGGTCAGG - Intergenic
1183509922 22:38228674-38228696 TGTCCTAGAGGCACAGAGACAGG - Intronic
1183989512 22:41588859-41588881 GGTCCTTGAGGCCCCCAGACTGG + Intronic
1184075016 22:42171195-42171217 GCTCCTGGAGACCGACAGCCAGG + Intronic
1184233217 22:43169433-43169455 GCTCCTGCAGGCCCCCAGCCCGG + Intronic
1184968588 22:47998933-47998955 GCTCCTGGAGGCACACGGCCAGG - Intergenic
1185012665 22:48323955-48323977 GGTCCTGGAGACCCACAGCTAGG - Intergenic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
949854994 3:8453217-8453239 GGGCCTACAGTCCCACAGCTAGG + Intergenic
950261933 3:11548771-11548793 GGCCCAAGAGGCCCTCAGCGGGG - Intronic
950331366 3:12158669-12158691 GGTCCGCGAGGTCCACAGCAGGG - Intronic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
954289534 3:49642436-49642458 GGCCCAGGAGGACCACAGCCTGG + Exonic
954663157 3:52236862-52236884 GGTCCCTGAGGCCCCAAGCCTGG + Intronic
960881441 3:122349315-122349337 GGCCCTGGAGGCAAACAGCCTGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
962176360 3:133159765-133159787 GGTCCTAGAGCAACACTGCCTGG - Intronic
966214797 3:177491116-177491138 GGTCCTTGAACCCCAAAGCCAGG - Intergenic
967361225 3:188634421-188634443 GGTCCTACAGGCACAGAGCAGGG + Intronic
967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG + Exonic
968651744 4:1762934-1762956 GGTCCTAGTGACCCACAGCTCGG - Intergenic
968902385 4:3437793-3437815 GGCCCCAGAGGCCCTCATCCTGG - Intronic
969198706 4:5584622-5584644 GATCCTGGAGTCGCACAGCCGGG - Exonic
969703163 4:8778794-8778816 AGTCCTAGAAGCTCACAGCCGGG - Intergenic
971357397 4:25907434-25907456 GGTCTGCGAGGCCCACAGCATGG + Intronic
973974092 4:56244726-56244748 GGTCCTGGAGGCCCACTTCTGGG - Intronic
975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG + Intronic
980707196 4:136514318-136514340 GCTTCTAGAGGGCCACATCCTGG + Intergenic
993899274 5:93573274-93573296 GGTTCTGGAGGCCCGCTGCCGGG - Intergenic
997696295 5:135863746-135863768 GGTCATAGAGTTGCACAGCCTGG - Intronic
999772536 5:154786429-154786451 TGTCCCAGAGGACCATAGCCAGG - Intronic
1001598601 5:172914586-172914608 GCTCCTGGAGGTCCCCAGCCCGG + Intronic
1006931728 6:37692761-37692783 GGTCCCAGCAGCTCACAGCCAGG + Intronic
1007996723 6:46315620-46315642 GGGCCTTGAGGGCCACAGCAAGG + Intronic
1008506659 6:52237288-52237310 GGTTCTGGAGCCACACAGCCTGG + Intronic
1013432037 6:110064005-110064027 GCTTCTTGTGGCCCACAGCCCGG - Intergenic
1015370149 6:132441219-132441241 GGTCATAGCGGCCTACAGGCAGG - Intergenic
1018686168 6:166306863-166306885 GGTCCCAGAGACCCTCTGCCTGG - Exonic
1018945431 6:168344604-168344626 GGGCCTAGCACCCCACAGCCAGG - Intergenic
1019428131 7:986909-986931 GCTCTGAGAGGCCCCCAGCCAGG - Intronic
1022196240 7:28069919-28069941 TGACCTTGAGGCCCACAGACTGG + Intronic
1023055957 7:36290299-36290321 GGTACTATTGACCCACAGCCTGG + Intronic
1023843489 7:44109052-44109074 GGTCCTCAAAGCCCAGAGCCAGG + Intronic
1024123739 7:46270832-46270854 TCTCCTAGAGGACCACAGCTGGG - Intergenic
1029551345 7:101238680-101238702 GGTCCTGCTGGCCAACAGCCTGG + Exonic
1030523074 7:110622007-110622029 GATCCTAGAGGCTCAGAGACTGG - Intergenic
1030699359 7:112621735-112621757 CGACCTGAAGGCCCACAGCCGGG + Intergenic
1031631029 7:124042894-124042916 AGTCTTACTGGCCCACAGCCTGG + Intergenic
1032098370 7:128951817-128951839 GGACCTTGATGCCCACATCCTGG + Intergenic
1034425170 7:151010266-151010288 GGAGCTGGAGGCCCTCAGCCAGG + Exonic
1034639653 7:152592610-152592632 TTTCCTAGAGACCCACAGCCGGG - Intergenic
1035171220 7:157018353-157018375 GGCCCTCGGGGCTCACAGCCGGG + Intergenic
1035174449 7:157040291-157040313 GCTGCTAGAAGCCCACAGCAGGG + Intergenic
1035456350 7:159011504-159011526 GTGCTTAGAGGCCCACAGCCAGG + Intergenic
1035734728 8:1879914-1879936 GGTCCCAGAAGCCCCCAGCCAGG + Intronic
1037965407 8:23130032-23130054 GGCACTACAGGGCCACAGCCTGG + Intergenic
1039380339 8:37079147-37079169 TGTGCTACAGGCCAACAGCCCGG + Intergenic
1042222319 8:66485933-66485955 CTTCTCAGAGGCCCACAGCCCGG + Intronic
1042746567 8:72114194-72114216 ATTGCTAGAGGTCCACAGCCAGG - Intronic
1042803335 8:72744857-72744879 GATCCTGAGGGCCCACAGCCAGG + Intronic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1047718173 8:127614947-127614969 GGGCCTTGAGCCACACAGCCTGG + Intergenic
1049319294 8:141987451-141987473 GGGTCCACAGGCCCACAGCCAGG + Intergenic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049610686 8:143553451-143553473 GGTCCTGGGGGGCCAGAGCCTGG - Exonic
1051991789 9:23161202-23161224 TGTCCTTGATGGCCACAGCCTGG - Intergenic
1052198556 9:25748213-25748235 GGTCCTAGAGGCGCAGACACAGG + Intergenic
1052224424 9:26067994-26068016 TCTCCTAGAGGTCCACAGCTAGG - Intergenic
1057796378 9:98160904-98160926 AGTCCTAGAGGGTCACAGGCAGG - Intronic
1059656885 9:116365432-116365454 GGTCCTAAAGCCCCAGAGCTGGG + Intronic
1190342412 X:49308326-49308348 GGGACTAGAGCCCCACGGCCAGG + Intronic
1198394749 X:136209634-136209656 GGTCCTTGAGAGCCACAGCAGGG + Intronic
1200211300 X:154347780-154347802 GGGCCCTGAGGCCCAGAGCCTGG + Intergenic
1202095367 Y:21243903-21243925 GGTACCAGTGGCCCCCAGCCTGG + Intergenic