ID: 950537925

View in Genome Browser
Species Human (GRCh38)
Location 3:13591950-13591972
Sequence GTTACATTGTTAGCTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950537917_950537925 18 Left 950537917 3:13591909-13591931 CCCAGCACCATGTGTTGAAAAGG 0: 4
1: 369
2: 1306
3: 4033
4: 18384
Right 950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 124
950537921_950537925 -5 Left 950537921 3:13591932-13591954 CCATCTTTCCCCTACTGCGTTAC 0: 1
1: 0
2: 0
3: 6
4: 174
Right 950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 124
950537919_950537925 17 Left 950537919 3:13591910-13591932 CCAGCACCATGTGTTGAAAAGGC 0: 1
1: 60
2: 831
3: 2507
4: 6166
Right 950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 124
950537920_950537925 11 Left 950537920 3:13591916-13591938 CCATGTGTTGAAAAGGCCATCTT 0: 1
1: 4
2: 47
3: 269
4: 1041
Right 950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950537925 Original CRISPR GTTACATTGTTAGCTTCTCC AGG Intronic
903568480 1:24286459-24286481 GATACAGTGTCACCTTCTCCGGG - Intergenic
904062182 1:27720360-27720382 ATTACATTGTTGGCTTCACAAGG + Intergenic
907727462 1:57033029-57033051 GTTACACTGTGAGCTTCTTTAGG + Intronic
909279591 1:73732111-73732133 TTTAAATTGTCAGTTTCTCCTGG - Intergenic
913107885 1:115631483-115631505 GTTAAATTATTAGCTTCCCAGGG + Intergenic
916313465 1:163422372-163422394 GTAACATTTTAATCTTCTCCTGG - Intergenic
917004501 1:170398117-170398139 TTCACTTTCTTAGCTTCTCCAGG + Intergenic
917525871 1:175787984-175788006 GCTACATTATTAGCTTCACTGGG - Intergenic
918301526 1:183208362-183208384 GTCACATTATTAACTTTTCCAGG + Intronic
1063701678 10:8390501-8390523 GTTGCTTTGTTAGTTTTTCCAGG - Intergenic
1063758144 10:9039705-9039727 GTCACATTGTGAGTTTCTCAGGG + Intergenic
1065411527 10:25434620-25434642 ATTAGATTGTGAGCTTCTCGTGG - Intronic
1067057110 10:43058737-43058759 ATTACAGTCTTAGCTTCTGCGGG + Intergenic
1069055569 10:63840992-63841014 GTTCATTTGTTATCTTCTCCAGG - Intergenic
1071984441 10:91036457-91036479 CTAACATTGTTACCTACTCCTGG - Intergenic
1072439213 10:95438991-95439013 GTGATATTGTTACATTCTCCTGG - Intronic
1072859742 10:98990763-98990785 GAGACATTGTTAGCTTCTATGGG + Intronic
1074455243 10:113590482-113590504 GTTCCATTGTTAGCTTCTGGGGG - Intronic
1075321240 10:121493204-121493226 GGAAGATGGTTAGCTTCTCCCGG + Intronic
1076619256 10:131776561-131776583 GTTGCATTGGCAGCTTCTGCAGG - Intergenic
1080563352 11:33484670-33484692 GCTATATTGTTAGCGTCTGCTGG + Intergenic
1083015356 11:59447616-59447638 GTTACATCATTAGCTTCTTCAGG + Intergenic
1083473881 11:62903186-62903208 CTTAGAATGTGAGCTTCTCCAGG + Intergenic
1085330153 11:75641734-75641756 GTTACAGCATTAGCTTCACCTGG - Intronic
1087160377 11:94942800-94942822 GGTACATTGATGCCTTCTCCAGG - Intergenic
1092495199 12:8986524-8986546 GTTCCATTGGGAGCTTTTCCAGG + Intronic
1096740380 12:53689337-53689359 ATTACATTATTAGCTACTCCAGG - Intergenic
1098109047 12:67102340-67102362 GTTACAGAGCTAGCTCCTCCTGG - Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099512901 12:83559272-83559294 GCTACATAGTATGCTTCTCCAGG + Intergenic
1100868626 12:98886531-98886553 CTTACATTGTTACCTACTTCAGG - Intronic
1101057801 12:100937158-100937180 GTTACATTGTGACCATCTTCAGG + Intronic
1101729492 12:107415143-107415165 TTCACATTGCTGGCTTCTCCTGG + Intronic
1105362797 13:19736205-19736227 GTTACAATCTTAGTTTTTCCTGG - Intronic
1107257369 13:38444583-38444605 GTTTAATTGTGAGCTTCTCAAGG + Intergenic
1108229743 13:48323796-48323818 ATTAATTAGTTAGCTTCTCCAGG - Intronic
1111941818 13:94617017-94617039 GTTATAATGTTAGCTTTTTCTGG + Intronic
1112699240 13:101986049-101986071 CTTACAGTGTTTTCTTCTCCAGG - Intronic
1113078208 13:106489143-106489165 GGTACATAGTTACCTTCCCCAGG + Intergenic
1115414590 14:33116756-33116778 GGTCCATTATAAGCTTCTCCAGG - Intronic
1119422596 14:74516443-74516465 GTTAGATTGTTAGCTCCTGAGGG - Intronic
1124610788 15:31206981-31207003 GTTACAGTGAGAGCTTTTCCAGG - Intergenic
1127177356 15:56374338-56374360 CTTATATTGTTTGCTTCTGCAGG - Intronic
1127489522 15:59449204-59449226 GTCAAATTGTTAGACTCTCCAGG - Intronic
1128882080 15:71253087-71253109 GTTACCTTGTTACCTCCTGCTGG + Intronic
1130150052 15:81304785-81304807 GTTACATGGTTAGAATCCCCAGG - Intronic
1131003740 15:88959093-88959115 GTAACTTTGTTAGCTTCTTCAGG - Intergenic
1131083934 15:89559748-89559770 ATTAAGTTGTCAGCTTCTCCAGG - Intergenic
1132037107 15:98493630-98493652 TTTAAATTGTTAGTTTCTCGGGG - Intronic
1133258984 16:4536425-4536447 TTTACACTGTAAGCTTGTCCAGG - Intronic
1137379364 16:47983195-47983217 GTTTCACTCTTACCTTCTCCAGG - Intergenic
1138213969 16:55186795-55186817 CTGACAGTGTTAGCTTCTGCAGG - Intergenic
1143336867 17:6178111-6178133 GTCAGATTGTGAGCTTCCCCGGG + Intergenic
1143718493 17:8793567-8793589 GTTAGACTGTTAGCTTCTTGAGG + Intergenic
1148252053 17:46091091-46091113 GTTACACTGTTAGGTTTTCAGGG - Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153595819 18:6724422-6724444 GTTTCAAGCTTAGCTTCTCCAGG + Intergenic
1154977329 18:21472544-21472566 GTTAGATTGTCAGCTTTTCATGG - Intronic
1161585720 19:5104291-5104313 GTTACACTGTGAGCTGCTTCAGG + Intronic
1163056071 19:14719168-14719190 ATTACATTGATAGGGTCTCCCGG - Exonic
1168498585 19:56874782-56874804 GTTACACCACTAGCTTCTCCTGG + Intergenic
925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG + Intergenic
925406416 2:3608292-3608314 GTTGAAATGTTAGCCTCTCCTGG + Intronic
925768296 2:7259007-7259029 GCTACATCTGTAGCTTCTCCTGG + Intergenic
929072785 2:38050430-38050452 GTGACATTGTTTGCTTTTTCAGG - Intronic
929284803 2:40123544-40123566 CTTAAATTCTTGGCTTCTCCTGG + Intronic
930004191 2:46882874-46882896 GCCACATGGTCAGCTTCTCCTGG - Intergenic
932730337 2:74216553-74216575 GGTGGATTGTTAGCTTCCCCAGG + Exonic
935923772 2:108044040-108044062 GTTACATTGATTGCTTTTCTTGG - Intergenic
939583587 2:143980407-143980429 GTTACATTGTAAGTTCCTCGAGG + Intronic
940414880 2:153408141-153408163 GTAACATTGTCACCTTCTTCTGG - Intergenic
941418613 2:165253957-165253979 GTTATATTGTCAGATTTTCCTGG + Intronic
943335537 2:186608879-186608901 GTTCTTTTGTTAGCTTCTCTTGG - Intronic
1170674318 20:18465282-18465304 ATTTCATGGTTAGCTTTTCCAGG + Exonic
1171016451 20:21546436-21546458 TTTCCTTTGTTGGCTTCTCCAGG + Intergenic
1173725568 20:45294882-45294904 GTGGCATTGTTAGATTCTCATGG + Intronic
1175522333 20:59609825-59609847 ATTACCTTGTCAGCTTCTTCAGG + Intronic
1179778870 21:43686767-43686789 GACACACTGTTAGCTTCCCCAGG - Intronic
1183666671 22:39250128-39250150 GATGCATTTTTAGCTCCTCCAGG + Intergenic
1183844599 22:40531012-40531034 ATTAGATTATTAGCTTCTCAAGG - Intronic
949091020 3:29182-29204 ACTACATTGTAAGTTTCTCCAGG - Intergenic
950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG + Intronic
951658751 3:25038646-25038668 GTTTCATTATTAGCTTCCCAGGG + Intergenic
953197368 3:40746947-40746969 GCTGAATGGTTAGCTTCTCCTGG + Intergenic
957031346 3:75245389-75245411 ACTACATTGTAAGTTTCTCCAGG - Intergenic
960316629 3:116186407-116186429 GGTACATTTTTAGTTTCTGCTGG + Intronic
960592032 3:119376049-119376071 GTTAAATTGTAAGCTTCCCGAGG + Intronic
963870139 3:150408022-150408044 GTTCCATTGTAAGCTTCCCTAGG + Intergenic
967475360 3:189910337-189910359 CTTTCATTGTTATCTTTTCCTGG - Intergenic
967858473 3:194134945-194134967 TTTACCTTCTTGGCTTCTCCCGG + Intergenic
967879690 3:194292641-194292663 TTTACGTTGTGAGCTTCTCAAGG - Intergenic
967953835 3:194861895-194861917 CTTAGATTGTAAGCTTCTCGAGG + Intergenic
971272852 4:25167055-25167077 GGTATATTGTTATCTTCTCCAGG - Intronic
972087237 4:35234178-35234200 GTTCCATTTTTAGCTGTTCCAGG - Intergenic
973583578 4:52369516-52369538 CTTTCATTGTCATCTTCTCCAGG - Intergenic
974460050 4:62175709-62175731 GTTACACTGTTTGGTTCTCTAGG + Intergenic
974717606 4:65690267-65690289 GTGACACTGTCAGTTTCTCCAGG + Intergenic
978016027 4:103747994-103748016 GTTTGATTGTCATCTTCTCCTGG - Intergenic
987741762 5:21917482-21917504 GTTACATTCTTAGCTCCTCAGGG + Intronic
989479494 5:41913689-41913711 GTTTCTTTGTTAGCCTCTCCTGG + Intronic
1001133161 5:169080948-169080970 GTTATCCTGTTGGCTTCTCCAGG - Intronic
1001289414 5:170446020-170446042 TTTACACTGTCAGTTTCTCCAGG - Intronic
1001334880 5:170788789-170788811 GTTTCATTGTTCGGTGCTCCAGG - Intronic
1001373924 5:171236326-171236348 TTTATACTGTTAGTTTCTCCTGG + Intronic
1002499534 5:179638878-179638900 GCTAGATTCTAAGCTTCTCCAGG + Intergenic
1003475762 6:6481188-6481210 GTTACTTTGTTGGCTACTGCTGG - Intergenic
1007936541 6:45737516-45737538 CTTACATATTTAGCTTATCCTGG - Intergenic
1011702567 6:89969383-89969405 GATACATTGTGAGTTCCTCCAGG - Intronic
1012770150 6:103423152-103423174 GTTTCATTTTTAGCATCTCTGGG + Intergenic
1013642496 6:112099975-112099997 ACTACATTGTTAGATTCTCATGG + Intronic
1014371760 6:120618322-120618344 GTTATATTATTAGTTCCTCCAGG - Intergenic
1015934367 6:138393595-138393617 CTGACATTATTAGCTTCTTCAGG - Intergenic
1018306617 6:162463618-162463640 GTCACATTGTCAACATCTCCAGG - Intronic
1018672628 6:166192459-166192481 GATACAGTGATACCTTCTCCTGG - Intergenic
1023094055 7:36642090-36642112 GTCACATTCTGAGCTTCTGCAGG - Intronic
1026036787 7:66835839-66835861 GTTACAATTTTTGCTTCTCAGGG - Intergenic
1028781844 7:94746192-94746214 GATATATTGTTGTCTTCTCCAGG - Intergenic
1028975803 7:96912657-96912679 GTCACATTGTCAGCTTTCCCTGG - Intergenic
1031243151 7:119271196-119271218 GCTACAGTGGTAGTTTCTCCTGG - Intergenic
1032118212 7:129135423-129135445 GTTAGATCGTGAGCTTCTCAAGG + Intergenic
1036543619 8:9744576-9744598 GTTAAATTGTCTGTTTCTCCTGG + Intronic
1040636048 8:49274304-49274326 GTAACAGTGTTAGTTTCTCAGGG + Intergenic
1043634158 8:82369193-82369215 GTTACATTGTTTTATTATCCAGG - Intergenic
1044208988 8:89527469-89527491 GAAACCTTGTTAACTTCTCCAGG - Intergenic
1051410386 9:16784195-16784217 GCTACATTGTGAGCAACTCCAGG - Intronic
1052672326 9:31573973-31573995 ATTATATTGTTACCTGCTCCAGG - Intergenic
1054955515 9:70905248-70905270 GGTACATTGTAATGTTCTCCTGG + Intronic
1185639704 X:1582389-1582411 ATTACATTGTTAGACCCTCCAGG + Intergenic
1191596856 X:62954440-62954462 TTTTAATTGTTATCTTCTCCTGG - Intergenic
1194775200 X:97954602-97954624 GTAACATTGTTAATATCTCCAGG - Intergenic
1195105057 X:101595649-101595671 GATACTTTCTTATCTTCTCCTGG - Intergenic
1197192895 X:123668305-123668327 GTACCATTTTTAGCTTCTTCCGG - Exonic
1199802474 X:151265323-151265345 GTTACATTGCTAGCCTCTGCAGG - Intergenic