ID: 950540400

View in Genome Browser
Species Human (GRCh38)
Location 3:13609072-13609094
Sequence CAGAGCCAGGACAGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 833}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950540400_950540407 15 Left 950540400 3:13609072-13609094 CCCGCCGCCCTGTCCTGGCTCTG 0: 1
1: 0
2: 4
3: 57
4: 833
Right 950540407 3:13609110-13609132 TTGTCAGCCACCTCTGCCCCAGG 0: 1
1: 1
2: 0
3: 38
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950540400 Original CRISPR CAGAGCCAGGACAGGGCGGC GGG (reversed) Intronic
900155114 1:1200823-1200845 CAGCGCCAGGACAGGTGGGGAGG - Intergenic
900252878 1:1680571-1680593 CAGAGCCGGGGCAGGGCTGTGGG - Intronic
900266085 1:1757924-1757946 CAGAGCCAGCAAAGCGCGGGTGG - Intronic
900303396 1:1989323-1989345 ACCAGCCAGGACAGGGCGGACGG + Intronic
900401894 1:2476122-2476144 CAGACCCAGGTCAGGGCTGCGGG - Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900992832 1:6105877-6105899 CAGGGGCAGGACAGGGCTCCAGG + Intronic
901100553 1:6715623-6715645 CACATCCCGGACGGGGCGGCAGG + Intergenic
901270946 1:7952715-7952737 CACATCCCAGACAGGGCGGCGGG - Intergenic
901341209 1:8500816-8500838 CACATCCCAGACAGGGCGGCGGG - Intronic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901726998 1:11250140-11250162 CACCTCCCGGACAGGGCGGCTGG + Intronic
902637646 1:17745072-17745094 CTGTGACATGACAGGGCGGCTGG - Intergenic
903081313 1:20815427-20815449 CACATCCTAGACAGGGCGGCGGG - Intronic
903179982 1:21600335-21600357 GAGAGGCAGGAAAGGGTGGCAGG - Intronic
903182793 1:21613497-21613519 CAGCCTCAGGATAGGGCGGCAGG + Intronic
903186700 1:21633307-21633329 CAGAGCCAGGACAGGCGGCTGGG - Intronic
903283461 1:22263184-22263206 CAGCGCCAGGTCAAGGCAGCTGG + Intergenic
903293416 1:22329004-22329026 CAGGGCCAGGCCAGGGCTGGGGG - Intergenic
903647902 1:24905741-24905763 CAGAGCCAGGCCAGGGGATCGGG - Intronic
903959537 1:27047911-27047933 CAGGGCCCGGACAGGCCAGCGGG + Intergenic
903962074 1:27064056-27064078 CACATCCCAGACAGGGCGGCGGG - Intergenic
903962247 1:27064525-27064547 CACCTCCCGGACAGGGCGGCTGG - Intergenic
904027616 1:27514294-27514316 CAGTGCCAGGACAGCTGGGCAGG - Intergenic
904163153 1:28536064-28536086 CAGAGCCAGGACAGGAACGCAGG - Intronic
904311057 1:29629877-29629899 TTGAGGGAGGACAGGGCGGCAGG + Intergenic
904532154 1:31176759-31176781 CACCTCCCGGACAGGGCGGCTGG - Intergenic
904615201 1:31745807-31745829 CAGAGCCCGGGCTGGGCAGCAGG - Intronic
904795341 1:33052687-33052709 CACCTCCCGGACAGGGCGGCTGG - Intronic
904857374 1:33509537-33509559 CACATCCCAGACAGGGCGGCGGG + Intergenic
905427316 1:37896159-37896181 CACATCCCGGACGGGGCGGCAGG - Intronic
905427553 1:37896801-37896823 CACCTCCCGGACAGGGCGGCTGG - Intronic
905427679 1:37897133-37897155 CACCTCCCGGACAGGGCGGCTGG - Intronic
905665175 1:39759261-39759283 AAGACACAGGACAGGGCTGCTGG + Exonic
905686661 1:39913365-39913387 CACATCCCGGACGGGGCGGCAGG + Intergenic
906036009 1:42750715-42750737 CACCTCCCGGACAGGGCGGCCGG - Intronic
906104854 1:43285602-43285624 CAGAACCTGGACAGGTGGGCGGG + Intronic
906345530 1:45012191-45012213 CGGAGCCTGGACTGGGGGGCAGG + Exonic
906427162 1:45724625-45724647 CACATCCCAGACAGGGCGGCGGG - Intronic
906487200 1:46241929-46241951 CACCTCCCGGACAGGGCGGCTGG - Intergenic
906761950 1:48383688-48383710 CACATCCCAGACAGGGCGGCGGG + Intronic
907238506 1:53067532-53067554 CACAGCCACCACAGGGCAGCAGG + Intronic
907402625 1:54233786-54233808 CACCTCCCGGACAGGGCGGCTGG - Intronic
908370165 1:63473121-63473143 CACATCCCAGACAGGGCGGCAGG - Intronic
908422546 1:63973089-63973111 CAAAGCCAAGACAGGCCTGCAGG - Intronic
909077010 1:71061330-71061352 TAGAGCCATGACAAGGCGGTGGG - Intergenic
909131140 1:71738660-71738682 CAGAGCCAGGACACACAGGCAGG - Intronic
909529863 1:76670425-76670447 CTGACCCAGGACAGGGGTGCTGG - Intergenic
909641171 1:77870433-77870455 CACATCCCAGACAGGGCGGCGGG + Intronic
910226144 1:84938630-84938652 CAGAGCAAAGACAGGCCTGCAGG + Intronic
910891693 1:92026275-92026297 CACATCCCAGACAGGGCGGCGGG + Intergenic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
912371509 1:109177406-109177428 CACATCCTGGACGGGGCGGCAGG + Intronic
912511782 1:110194782-110194804 CAGAGCCTGGGCATGGGGGCAGG - Intronic
912679724 1:111721394-111721416 CAGAGCCAGGTCATGGTGGGTGG + Intronic
912752052 1:112294158-112294180 CACCTCCCGGACAGGGCGGCTGG - Intergenic
912845173 1:113070164-113070186 CACCTCCCGGACAGGGCGGCTGG - Intergenic
913158217 1:116121107-116121129 CAGAGCCAGGACACTTGGGCAGG + Intronic
913993726 1:143637719-143637741 CACATCCCAGACAGGGCGGCGGG - Intergenic
914231355 1:145766765-145766787 CACCTCCCGGACAGGGCGGCTGG + Intronic
914386288 1:147172689-147172711 CAGCGCCAGGAGGGGGCGCCAGG + Intergenic
914887971 1:151600236-151600258 CACATCCCAGACAGGGCGGCGGG - Intergenic
914888213 1:151600874-151600896 CACCTCCCGGACAGGGCGGCTGG - Intergenic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915208358 1:154287566-154287588 CACATCCCGGACGGGGCGGCAGG - Intergenic
915539149 1:156556938-156556960 CACATCCCAGACAGGGCGGCGGG - Intronic
915861534 1:159449802-159449824 CACATCCCAGACAGGGCGGCGGG - Intergenic
916087529 1:161281776-161281798 CACATCCCGGACGGGGCGGCGGG + Intronic
916087541 1:161281813-161281835 CACATCCCGGACGGGGCGGCGGG + Intronic
916104779 1:161422973-161422995 CACATCCCGGACGGGGCGGCAGG - Intergenic
917375541 1:174349016-174349038 CACCTCCCGGACAGGGCGGCTGG + Intronic
917583178 1:176396952-176396974 CACATCCTGGACGGGGCGGCAGG + Intergenic
918255255 1:182741718-182741740 CACCTCCCGGACAGGGCGGCTGG + Intergenic
918255372 1:182742051-182742073 CACATCCCGGACGGGGCGGCAGG + Intergenic
918255384 1:182742088-182742110 CACATCCCAGACAGGGCGGCGGG + Intergenic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918701618 1:187615747-187615769 CACATCCCAGACAGGGCGGCCGG - Intergenic
919079950 1:192856991-192857013 CACATCCCGGACGGGGCGGCAGG - Intergenic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
921155049 1:212432901-212432923 CAAGGCCGGGCCAGGGCGGCGGG - Exonic
921492106 1:215789768-215789790 AAGAGCCAGCACAGGTCGTCTGG - Intronic
922676926 1:227559070-227559092 CTGAGCCAGAACAGGGCGGCAGG - Intergenic
922722034 1:227904228-227904250 CAGACCCAGGGCAGGGCTGGGGG - Intergenic
922730439 1:227946540-227946562 TGGAGCCAGGAGAGGGCTGCGGG + Intronic
922764912 1:228151689-228151711 CACAGGCAGGACAGTGAGGCCGG + Intronic
922975385 1:229779581-229779603 CAGAGCCAGGCTAGCGTGGCAGG + Intergenic
923137140 1:231128792-231128814 CACCTCCCGGACAGGGCGGCTGG - Intergenic
923174851 1:231454159-231454181 CACATCCCAGACAGGGCGGCGGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923468292 1:234267844-234267866 CACATCCCAGACAGGGCGGCGGG + Intronic
923630096 1:235644128-235644150 CAGAGACAGGGCTGGGTGGCGGG + Intronic
923728071 1:236524230-236524252 CAGAGCCGGGGCTGGGTGGCGGG + Intronic
924145517 1:241070675-241070697 CAGAGACAGTGCAGGGAGGCTGG + Intronic
924634778 1:245775194-245775216 CACCTCCCGGACAGGGCGGCTGG - Intronic
1062841504 10:676773-676795 TAGAGACAGGAAAGGGTGGCGGG + Intronic
1063458762 10:6202728-6202750 CAGGCCCGGGGCAGGGCGGCGGG + Intronic
1063744916 10:8869066-8869088 CACATCCCAGACAGGGCGGCGGG - Intergenic
1063822713 10:9855713-9855735 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1064011633 10:11741105-11741127 CAGAGTCAGGACGGGGCTGGAGG - Intergenic
1064108420 10:12519585-12519607 CACCTCCCGGACAGGGCGGCTGG + Intronic
1064108701 10:12520280-12520302 CACATCCTAGACAGGGCGGCGGG + Intronic
1064313832 10:14236463-14236485 CACAGCCAGGACACTGCTGCTGG + Intronic
1064367948 10:14725187-14725209 CAGAGCCAGGCTTGTGCGGCTGG + Intronic
1066249335 10:33617925-33617947 CACAGAGGGGACAGGGCGGCGGG - Intergenic
1067117475 10:43446583-43446605 CACATCCCAGACAGGGCGGCCGG + Intronic
1068006068 10:51393210-51393232 CACATCCCAGACAGGGCGGCGGG + Intronic
1068969545 10:62947591-62947613 CACATCCCAGACAGGGCGGCGGG - Intergenic
1068969788 10:62948197-62948219 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1069365614 10:67691538-67691560 CACATCCCGGACGGGGCGGCAGG - Intronic
1069635073 10:69920065-69920087 CCCAGGCAGGACAGGGCAGCAGG + Intronic
1069645486 10:69993221-69993243 CACATCCCAGACAGGGCGGCGGG + Intergenic
1069675018 10:70240276-70240298 CACATCCCAGACAGGGCGGCCGG + Intergenic
1069897861 10:71689925-71689947 CAGGGTCTGGACAGGGTGGCTGG + Intronic
1070135420 10:73689634-73689656 CACATCCTGGACGGGGCGGCAGG - Intronic
1070135549 10:73690007-73690029 CACCTCCCGGACAGGGCGGCTGG - Intronic
1070505110 10:77106322-77106344 CAGAGCCAGAACAGAGTGGCAGG + Intronic
1070595657 10:77831009-77831031 CAGAGTCAGGTCAAGGCTGCTGG + Intronic
1070626461 10:78054457-78054479 CAGGCGCAGAACAGGGCGGCTGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070736959 10:78869707-78869729 CATGGCCAGCACAGGGCGGCCGG + Intergenic
1071616714 10:87081346-87081368 CACCTCCCGGACAGGGCGGCTGG - Intronic
1072116985 10:92376038-92376060 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1072117144 10:92376397-92376419 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1072149587 10:92674503-92674525 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1072481098 10:95810090-95810112 CACCTCCCGGACAGGGCGGCCGG + Intronic
1072481190 10:95810395-95810417 CACTTCCTGGACAGGGCGGCTGG + Intronic
1072602198 10:96941154-96941176 CACCTCCCGGACAGGGCGGCTGG + Intronic
1072602435 10:96941791-96941813 CACATCCCAGACAGGGCGGCGGG + Intronic
1072648550 10:97276354-97276376 CACCTCCCGGACAGGGCGGCTGG - Intronic
1072798338 10:98374025-98374047 GTGAGCCAGGTCAGGGCAGCCGG - Intergenic
1072949852 10:99839329-99839351 CACCTCCCGGACAGGGCGGCTGG + Intronic
1073386397 10:103129649-103129671 CACCTCCCGGACAGGGCGGCTGG - Intronic
1073386526 10:103129954-103129976 CACCTCCCGGACAGGGCGGCTGG - Intronic
1073450729 10:103607424-103607446 CACCTCCCGGACAGGGCGGCTGG - Intronic
1075061702 10:119261287-119261309 CACATCCCAGACAGGGCGGCGGG + Intronic
1075397170 10:122135812-122135834 CAGAGCCACGACAAGAAGGCAGG - Intronic
1075914611 10:126156760-126156782 CAGGCCCAGGACAGGGTGGAAGG + Intronic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076731735 10:132442611-132442633 GGGGGCCAGGACGGGGCGGCCGG + Intergenic
1077019155 11:409859-409881 CAGAGCCATGCCAGGTAGGCAGG - Exonic
1077132097 11:978168-978190 CAGGGCCTGGTCAGGGAGGCAGG + Intronic
1077323708 11:1954185-1954207 CAGAGACAGGGCAGGGCAACTGG + Intronic
1077418626 11:2437707-2437729 CAGACCCAGTACAGTGGGGCTGG - Intergenic
1077439667 11:2562066-2562088 TAAGGCCAGGACAGGGCAGCCGG + Intronic
1077445447 11:2588533-2588555 CAGAGACAGGGCAGGGCTGCTGG - Intronic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1077905448 11:6529308-6529330 CAGAGCCAAAACAGAGAGGCCGG - Intronic
1078176844 11:8978019-8978041 CACATCCCAGACAGGGCGGCGGG - Intergenic
1079093405 11:17495878-17495900 CCCAGCCACGACAGGGAGGCAGG + Intronic
1079133872 11:17765071-17765093 CTGAGGCAGGGCAGGGCTGCGGG - Intronic
1079149160 11:17882501-17882523 AATAGCCAGGACGGGGCAGCTGG - Intronic
1079444792 11:20548393-20548415 CACATCCCAGACAGGGCGGCGGG - Intergenic
1080475230 11:32583998-32584020 CCGAGCCTGGGCCGGGCGGCCGG + Intronic
1081950490 11:47038891-47038913 CACATCCCGGACGGGGCGGCAGG + Intronic
1082844833 11:57717052-57717074 CACATCCCGGACGGGGCGGCGGG + Intronic
1082879586 11:58024857-58024879 CAGAGTCAGGGCAGGGAGCCAGG + Intronic
1083308022 11:61770816-61770838 CAGAGCCAGGACTGGGCCCGGGG + Intronic
1083842820 11:65314676-65314698 CAGAACCAGGACAGGACTCCAGG + Intergenic
1083918040 11:65763029-65763051 CACATCCCAGACAGGGCGGCCGG + Intergenic
1083991096 11:66246249-66246271 CACAGCCAGGCGAGGGCTGCAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084184588 11:67464870-67464892 CAGAGCCCGGTCAGGGCGAGGGG + Intronic
1084273803 11:68041960-68041982 CAGGGCCAAGACAGAGCAGCTGG + Intronic
1084409190 11:68996739-68996761 CAGAGCCAGAACAGGGCGAGCGG - Intergenic
1084431864 11:69115753-69115775 CGGTGCCAGGACAGGGAGGGCGG + Intergenic
1084440976 11:69173024-69173046 CTGAGCCAGGCCAGGTTGGCAGG - Intergenic
1084519418 11:69654539-69654561 TAGAACCAGGGCAGGGTGGCAGG + Intronic
1084615328 11:70231948-70231970 CAGGGCCAGGGCAGGGGAGCAGG - Intergenic
1084745473 11:71167379-71167401 CACCTCCCGGACAGGGCGGCTGG + Intronic
1085019228 11:73194798-73194820 ATGACTCAGGACAGGGCGGCAGG - Intergenic
1085112083 11:73897494-73897516 CACATCCCGGACAGGGTGGCAGG + Intronic
1085121519 11:73970371-73970393 CAAAGCCAGGACAGGGACTCAGG - Intergenic
1085292532 11:75410338-75410360 CACATCCCAGACAGGGCGGCGGG + Intronic
1085716799 11:78879765-78879787 CACATCCCAGACAGGGCGGCCGG - Intronic
1085807771 11:79652000-79652022 TGGAGACAGGACAGGGAGGCAGG + Intergenic
1086366362 11:86111398-86111420 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1087141479 11:94769034-94769056 CAGAGCCGGGTCTGGCCGGCGGG - Intronic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1090188298 11:124752146-124752168 CAGGAGCAGGACAGGACGGCCGG - Exonic
1090323248 11:125863762-125863784 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1090628679 11:128627521-128627543 CAGCGCCAGGTCAGGGTGGGCGG - Intergenic
1090906931 11:131084495-131084517 CACATCCCAGACAGGGCGGCGGG + Intergenic
1202806696 11_KI270721v1_random:9380-9402 CAGAGACAGGGCAGGGCAACTGG + Intergenic
1091603786 12:1933923-1933945 CAGAGCCAAACCAGGGCTGCAGG + Intergenic
1091626162 12:2122529-2122551 GAGAGCAAGGACCGGGAGGCCGG - Intronic
1091681991 12:2533777-2533799 CAGAACCGGGACAGGGACGCAGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092453506 12:8624966-8624988 CACATCCCAGACAGGGCGGCGGG - Intergenic
1092453536 12:8625082-8625104 CACATCCCAGACAGGGCGGCGGG - Intergenic
1092827894 12:12414898-12414920 CACATCCCAGACAGGGCGGCGGG + Intronic
1094103214 12:26784949-26784971 CACATCCCAGACAGGGCGGCGGG - Intronic
1094844975 12:34357527-34357549 CAGGGCCAGCCCAAGGCGGCAGG - Intergenic
1094847145 12:34366319-34366341 CAGGGCCAGCCCAAGGCGGCGGG - Intergenic
1094854194 12:34395645-34395667 AAGAGCCAGCCCAAGGCGGCAGG + Intergenic
1095646915 12:44558514-44558536 CAAAGCCAGGGCTGGTCGGCGGG + Intronic
1096021973 12:48332428-48332450 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1096071148 12:48776184-48776206 CAGGGCCAGGGCAGGGCTGGGGG - Intronic
1096082449 12:48842295-48842317 CACCTCCCGGACAGGGCGGCTGG - Intronic
1096093050 12:48915949-48915971 CACATCCCAGACAGGGCGGCGGG + Intronic
1096999343 12:55863181-55863203 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1097685269 12:62685024-62685046 CAGAGCCAGGAAGGGGTGGCGGG - Intronic
1097925319 12:65121148-65121170 CAGAGCCAGAGCGCGGCGGCAGG + Exonic
1098412567 12:70201774-70201796 CACATCCCAGACAGGGCGGCGGG - Intergenic
1098551734 12:71770075-71770097 CAGAGAGAGGACAGGGTGGGTGG + Intronic
1098884029 12:75942512-75942534 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1099255383 12:80307833-80307855 CACCTCCCGGACAGGGCGGCTGG + Intronic
1099255582 12:80308356-80308378 CACATCCCGGACGGGGCGGCAGG + Intronic
1100507377 12:95235252-95235274 CACCTCCCGGACAGGGCGGCTGG + Intronic
1100760095 12:97797676-97797698 CTGAGCCAGAACAGGGCTGTAGG + Intergenic
1101230700 12:102738117-102738139 CAGTGCCTGGACAGGGTGACTGG - Intergenic
1101542080 12:105674494-105674516 CAGGGCCAGGCCAGAGCAGCTGG - Intergenic
1101838545 12:108311787-108311809 CTGACCCAGGACAGGGCTGCAGG + Intronic
1102036105 12:109771354-109771376 CAGAGCCCTGCCAGGGTGGCTGG + Intergenic
1104294797 12:127502230-127502252 AAGAGCCAGGACAGGGAGACAGG - Intergenic
1104406057 12:128517749-128517771 CAAAGACAGGACATGGCTGCTGG - Intronic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1104904087 12:132204322-132204344 CACAGGCAGGACAGCGCGGGGGG - Intronic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1105418308 13:20232018-20232040 CAGAGCCGGCAGAGCGCGGCCGG - Intronic
1106560191 13:30839789-30839811 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1107412106 13:40167326-40167348 CAGAGGCTGGACAGGGTGGGTGG + Intergenic
1107498815 13:40955054-40955076 CACATCCCAGACAGGGCGGCAGG - Intronic
1110922224 13:81102409-81102431 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1111947693 13:94682803-94682825 CAGAGACAGGCCAGTGTGGCTGG + Intergenic
1112056213 13:95691404-95691426 CACATCCCGGACGGGGCGGCAGG + Intronic
1112077315 13:95928584-95928606 CACAGCCCAGACGGGGCGGCGGG + Intronic
1112688485 13:101861341-101861363 CAGAAGCAGGACAGGGTGGGTGG - Intronic
1113567008 13:111325262-111325284 CAGAGTCATGACAGCGTGGCTGG - Intronic
1113942116 13:114023720-114023742 AGGAGCCAGGAAAGGGCGGTGGG + Intronic
1114199062 14:20505960-20505982 CACATCCCAGACAGGGCGGCGGG - Intronic
1114199496 14:20507013-20507035 CACCTCCCGGACAGGGCGGCTGG - Intronic
1114427632 14:22637059-22637081 CACATCCCAGACAGGGCGGCGGG - Intergenic
1114776263 14:25485565-25485587 CAAAGCCTGGACAAGTCGGCTGG - Intergenic
1115609884 14:35039479-35039501 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1115703783 14:35977985-35978007 CACATCCGAGACAGGGCGGCGGG + Intergenic
1116056478 14:39870609-39870631 CAGGGCAAGGACAGAGTGGCAGG + Intergenic
1116480682 14:45389973-45389995 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1117353386 14:54902155-54902177 CAGGGCCTCGGCAGGGCGGCAGG + Intronic
1117580025 14:57142891-57142913 CAGAGCCAGGGCCGGGCAGGGGG + Intergenic
1119489927 14:75022750-75022772 CAGAGCCCTGGCAGGGCTGCCGG - Intronic
1119746289 14:77046558-77046580 CAGAACCACGACAGTGCTGCTGG - Intergenic
1119798030 14:77416797-77416819 CACCTCCCGGACAGGGCGGCTGG + Intronic
1119835785 14:77747772-77747794 CACCTCCCGGACAGGGCGGCTGG - Intronic
1120022127 14:79542794-79542816 CAGAGCTAGGAAAGGGCCACAGG + Intronic
1120850223 14:89162973-89162995 CAGAGCGAGGACAGTGGGGAGGG + Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121473043 14:94171474-94171496 CAGAGCCAGGACAGGGACTCAGG + Intronic
1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG + Intergenic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1121728028 14:96167096-96167118 CAGAGACTGAACAGGGAGGCAGG - Intergenic
1122112939 14:99514532-99514554 CATAGCCTGGACAGGGTGGCAGG + Exonic
1122113880 14:99518250-99518272 CAGGTCCAGGCCAGGGCGGGCGG - Intronic
1122153721 14:99738133-99738155 CTGACCCAGGACAGAGGGGCAGG + Intronic
1122340196 14:101023004-101023026 CAGACCCAGCACAGTGCGCCTGG + Intergenic
1122505096 14:102227074-102227096 GACAGTCAGGACAGGGCAGCTGG + Intronic
1122523608 14:102363695-102363717 CAGAGCTAGGAAGGGGCCGCTGG - Intronic
1122527038 14:102394232-102394254 CAGAGGCAGAACAGGGCCTCTGG + Intronic
1122568577 14:102677550-102677572 CACATCCCAGACAGGGCGGCGGG + Intronic
1122613443 14:103001172-103001194 CTGAGCCAGGGCGGGGAGGCTGG - Intronic
1122637896 14:103138794-103138816 CAGCGCGGGGACAGGGCGGGCGG + Intergenic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123151512 14:106186029-106186051 CAGGGGCAGGGCAGGGCTGCAGG - Intergenic
1123944518 15:25232609-25232631 CCAAGCCAGTACAGGGAGGCTGG - Intergenic
1124230315 15:27939674-27939696 CAGAGGCAGGTCAGTGCTGCAGG + Intronic
1124251315 15:28107769-28107791 CAGAGCCAGGCCAGGCCGCACGG + Intergenic
1124469383 15:29969142-29969164 CAGGGCCTGGGCAGGGCGGCCGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125749496 15:42019106-42019128 CAGAGCCAGGACTTGGGTGCAGG + Intronic
1125868437 15:43076550-43076572 CACATCCCAGACAGGGCGGCGGG - Intronic
1125878058 15:43167473-43167495 CACATCCCGGACGGGGCGGCAGG + Intronic
1125902951 15:43366231-43366253 AAGAGCCAGGGCAGAGGGGCTGG - Exonic
1126295334 15:47132396-47132418 CACATCCCAGACAGGGCGGCGGG - Intergenic
1126836258 15:52669015-52669037 CTGAGGCAGGACAGTGAGGCAGG - Intronic
1127775975 15:62264559-62264581 CAGGGCCTGGACAGGGAAGCTGG + Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128415971 15:67446585-67446607 CAGAGCCTGGACAGGTCAGCCGG + Intronic
1128569819 15:68726060-68726082 CAGAGCCAGGACAGGAGTGGGGG + Exonic
1128597411 15:68964573-68964595 CACCTCCCGGACAGGGCGGCTGG + Intronic
1129053358 15:72800875-72800897 CAGAGTCAGACCAGGGTGGCTGG - Intergenic
1129117772 15:73374840-73374862 CAGAGCCAGGCCAGAGAGGGAGG + Intergenic
1129157570 15:73728359-73728381 CAGAGGCAGGACAGGAGGGTGGG - Intergenic
1129428596 15:75481727-75481749 CACCTCCCGGACAGGGCGGCTGG - Intronic
1129606091 15:77025690-77025712 TAGAGCCAGTGGAGGGCGGCAGG + Intronic
1129659431 15:77544715-77544737 CAGATCCAGGGCAGGGGTGCTGG - Intergenic
1129825315 15:78631024-78631046 GACAGCCAGGCCAGGGCAGCAGG - Intronic
1130508813 15:84571128-84571150 CAAAGCCAGGAGGGGGCAGCCGG - Intergenic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131096056 15:89655039-89655061 CGGAGCCGGGGCAGGGCAGCTGG + Intronic
1131125502 15:89854595-89854617 CACCTCCCGGACAGGGCGGCTGG - Intronic
1131347680 15:91665916-91665938 CAGAGCCAGGACAAGGGTGAGGG - Intergenic
1131431976 15:92394780-92394802 CAAAGCCAGGCGAGGGCGGGGGG - Intronic
1132582020 16:689128-689150 CAGAGGCAGGTCAGGGCAGGTGG - Intronic
1132658937 16:1053083-1053105 CCGAGCCTGGACAGTGGGGCAGG + Intergenic
1132713264 16:1278578-1278600 CACAGCCACCGCAGGGCGGCGGG + Intergenic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132855326 16:2042374-2042396 CAGAGCCAGGCCAGGTGCGCCGG - Intronic
1133288798 16:4704374-4704396 CATAGCCAGGCCAAGGCTGCTGG - Intronic
1133306831 16:4814943-4814965 CACAGCCAGGACAGCACAGCGGG - Intronic
1134692198 16:16198171-16198193 CAGAGCCAGGACCTGGCGGGTGG + Exonic
1136165284 16:28448966-28448988 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1136172021 16:28495381-28495403 GAGAGGCAGGACAGTGGGGCTGG + Exonic
1136197690 16:28666054-28666076 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1136214028 16:28780191-28780213 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1136258763 16:29060115-29060137 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1136572092 16:31104279-31104301 CACATCCCAGACAGGGCGGCGGG - Intergenic
1136893393 16:33982991-33983013 CAGAGCCTGGAGAGGTGGGCAGG - Intergenic
1136918901 16:34245699-34245721 CACCTCCAGGACAGGGTGGCTGG + Intergenic
1137283907 16:47000350-47000372 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1138113192 16:54340522-54340544 CAGAGCCAGGGTAGGTCGGTGGG - Intergenic
1138642558 16:58396982-58397004 CACCTCCAGGAGAGGGCGGCTGG + Intronic
1139159642 16:64488917-64488939 CAGAGCCAGGACAAAGCCACAGG - Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1139556298 16:67712930-67712952 CACATCCCAGACAGGGCGGCGGG - Intronic
1139564700 16:67766800-67766822 CAGATCCAGTACAGGGCAGGTGG - Intronic
1139864150 16:70050970-70050992 CACATCCCAGACAGGGCGGCGGG - Intergenic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140604537 16:76518849-76518871 CAGAGGCAGGAAATGGCGGAGGG - Intronic
1141509943 16:84505478-84505500 CAGGGCCAGGAATGGGCGCCGGG - Intronic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142262108 16:89047931-89047953 CTGAGACAGGACAAGGCCGCTGG + Intergenic
1142391936 16:89806944-89806966 CACCTCCTGGACAGGGCGGCTGG + Intronic
1203079644 16_KI270728v1_random:1140631-1140653 CAGAGCCTGGAGAGGTGGGCAGG + Intergenic
1142766048 17:2064906-2064928 GGGAGCCAGGACAGGGAGGTTGG + Intronic
1142809317 17:2387779-2387801 AAGAGCCTGGCCAGGGAGGCTGG + Intronic
1142818523 17:2447227-2447249 CACATCCCAGACAGGGCGGCGGG - Intronic
1142889089 17:2931440-2931462 CCCAGCCAGGACAGCGGGGCCGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144222736 17:13114730-13114752 CACAGCCAGGACAGGGAGACGGG - Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144745599 17:17612124-17612146 AAGCACCAGGACAGGGCAGCAGG - Intergenic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145733612 17:27212034-27212056 CACATCCCAGACAGGGCGGCGGG - Intergenic
1147046444 17:37755611-37755633 CAGAGCGGGGACATGGCAGCTGG + Intergenic
1147422817 17:40331079-40331101 CAGCTCCAGGACAGGGCGGGTGG + Exonic
1147600219 17:41740523-41740545 CAGAGCCTGGACATGGACGCAGG - Intergenic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1148075119 17:44931321-44931343 CTGGGTCAGGGCAGGGCGGCTGG - Intronic
1148108783 17:45132889-45132911 CAGAGCCGGGACAGGACGCAGGG + Intronic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1149793590 17:59500100-59500122 CACATCCCAGACAGGGCGGCGGG - Intergenic
1149950208 17:60977116-60977138 CACCTCCCGGACAGGGCGGCTGG + Intronic
1150209683 17:63435262-63435284 CGGTTCCGGGACAGGGCGGCCGG + Intronic
1150213864 17:63456422-63456444 CACATCCCGGACGGGGCGGCAGG - Intergenic
1150214070 17:63456951-63456973 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1150527379 17:65937640-65937662 CACCTCCCGGACAGGGCGGCTGG - Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151671135 17:75572230-75572252 CTGAGGCAGGACAGGGGGCCAGG + Intronic
1151724892 17:75878112-75878134 GAGAGGCAGGACAGCGCGGCGGG + Exonic
1151841787 17:76624074-76624096 CAGTGCCAGCTCCGGGCGGCAGG - Intergenic
1152302965 17:79506216-79506238 CAGAGCCAGAAAAGGGAGGAGGG + Intronic
1152696255 17:81798213-81798235 CACATCCCAGACAGGGCGGCGGG + Intergenic
1152928042 17:83096830-83096852 CTGAGCCAGCACAGGTCTGCAGG + Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153694565 18:7627195-7627217 CAGAGTAATGACAGGGTGGCTGG - Intronic
1153959360 18:10127569-10127591 AAGAGCCTGGACCAGGCGGCAGG - Intergenic
1154278385 18:12980336-12980358 CACCTCCCGGACAGGGCGGCTGG + Intronic
1154398372 18:14011200-14011222 CACATCCCAGACAGGGCGGCGGG + Intergenic
1154409765 18:14132119-14132141 CAGGGACAGGACAGGACGCCCGG + Intronic
1154420286 18:14223086-14223108 CAAATCCCAGACAGGGCGGCCGG - Intergenic
1154420439 18:14223653-14223675 CACATCCCAGACAGGGCGGCTGG - Intergenic
1154990182 18:21592520-21592542 CACCTCCTGGACAGGGCGGCTGG + Intronic
1155498631 18:26465838-26465860 CAGAGGCAGGACTGGGAGGATGG - Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1158849590 18:61482093-61482115 CAGCACCAGGACAGGGAAGCTGG + Intronic
1158889988 18:61863823-61863845 CAGAGCCAGGGCGGAGTGGCAGG + Intronic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159054477 18:63450494-63450516 CACATCCCGGACGGGGCGGCTGG + Intergenic
1160730270 19:638909-638931 CAGGGCCAGGACTGGGCTGCTGG + Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160918496 19:1508708-1508730 CAGAGCCAGGACTGGACCGTAGG + Intronic
1160961097 19:1721203-1721225 CAGAGCCAGGAGAGGGGCACGGG + Intergenic
1161067139 19:2244232-2244254 CACAGCCAGGACAGCACCGCCGG - Intronic
1161266180 19:3365896-3365918 CAGAGCCAGGCAGGGGCTGCGGG - Intronic
1161392379 19:4028243-4028265 CTGGGCCAGGACTGGGGGGCGGG - Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161618805 19:5287484-5287506 CAGAGCCAGGTCAGAGGGCCAGG + Intronic
1161685722 19:5701897-5701919 CATATCCCAGACAGGGCGGCGGG - Intronic
1161709114 19:5837937-5837959 CAGAGCCCGGACTGGGAGGGAGG + Intronic
1162398799 19:10432466-10432488 CAGTGCCAGGGCAGGGGGCCGGG - Intronic
1162498668 19:11038400-11038422 CAGACCCAGGGCGGAGCGGCGGG - Intronic
1162585508 19:11555800-11555822 CACAGCCAGGACAGGGCTGTTGG + Intronic
1162659206 19:12156349-12156371 CAGAGACGGGACAGGACGCCTGG + Intronic
1162672066 19:12266071-12266093 CAGGGACAGGACAGGACGCCCGG + Intronic
1162730485 19:12715587-12715609 CAGAGCGAGTACTGGGGGGCTGG - Intronic
1162968189 19:14165584-14165606 GAGGGCCAGGGCAGGGCGGGTGG - Intronic
1163143012 19:15363004-15363026 CACATCCCGGACGGGGCGGCAGG - Intronic
1163434550 19:17287571-17287593 CATAGACAGGGCAGGGCTGCTGG - Exonic
1163542192 19:17918244-17918266 CACATCCCGGACGGGGCGGCAGG - Intergenic
1163682341 19:18690345-18690367 CAAAGCCAGGACTGGGGGGCGGG - Intronic
1163862917 19:19751605-19751627 CTGCGCCAGCACTGGGCGGCCGG - Intergenic
1163896448 19:20064435-20064457 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1163921811 19:20296614-20296636 CACCTCCAGGACGGGGCGGCTGG - Intergenic
1164298538 19:23937494-23937516 CACATCCCGGACAGGGTGGCAGG + Intronic
1164587363 19:29484401-29484423 CAGATCCAGGAGAGGCCGGCTGG - Intergenic
1164652734 19:29900148-29900170 CACCGCCCGGACGGGGCGGCTGG + Intergenic
1164652919 19:29900552-29900574 CACCGCCCGGACGGGGCGGCTGG + Intergenic
1164653069 19:29900905-29900927 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1164735097 19:30535462-30535484 CAGACCTGGGACAGGGCAGCTGG + Intronic
1164749107 19:30638166-30638188 GAAAGCCAGGCCAGGGTGGCTGG + Intronic
1165258355 19:34593480-34593502 CAGAGCCAGGCCAGGAACGCGGG + Exonic
1165295447 19:34922322-34922344 CACATCCCGGACGGGGCGGCAGG + Intergenic
1165332902 19:35151181-35151203 CAGAGCCAGGACTGGGCTCCAGG + Intronic
1165462829 19:35954125-35954147 CAGAGGCAGGAGAGGGCACCAGG - Intergenic
1165727576 19:38123859-38123881 CACCTCCCGGACAGGGCGGCTGG + Intronic
1165843841 19:38805592-38805614 CAGGGCCAGGACAGGAGGGTGGG - Intronic
1165844408 19:38809024-38809046 GAGGCCGAGGACAGGGCGGCAGG - Intronic
1165912365 19:39237160-39237182 CAGAGCCAGGTGAGTGGGGCTGG + Intergenic
1165917416 19:39269263-39269285 CAGAGCCAGGTGAGTGGGGCTGG - Intronic
1166162648 19:40965530-40965552 CACCTCCAGGACAGAGCGGCTGG + Intergenic
1166198794 19:41222996-41223018 CATAGACAGGACAGAGAGGCCGG + Intronic
1166261693 19:41645032-41645054 CACCTCCCGGACAGGGCGGCTGG - Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166425687 19:42676387-42676409 CACCTCCCGGACAGGGCGGCTGG + Intronic
1166827344 19:45617647-45617669 CACAGCCAGGACAGAGCCACTGG + Exonic
1167281023 19:48568617-48568639 CAGAGGCAGGGCAGGGCGCCGGG + Intronic
1167423997 19:49420363-49420385 CAGAGCCAGGGCAGGGTGGGAGG + Intergenic
1167506698 19:49874621-49874643 AAGAGCGAGGGCAGGGGGGCTGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167937403 19:52919765-52919787 CACATCCCAGACAGGGCGGCGGG - Intergenic
1167971091 19:53187932-53187954 CACATCCCAGACAGGGCGGCGGG + Intronic
1167975521 19:53223042-53223064 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1168226516 19:54999108-54999130 CACCTCCCGGACAGGGCGGCTGG + Intronic
1168414902 19:56161562-56161584 CAGCCCCAAGACTGGGCGGCAGG - Intergenic
1168696165 19:58405360-58405382 CATCTCCCGGACAGGGCGGCTGG + Intronic
1168696273 19:58405695-58405717 CACATCCCGGACGGGGCGGCAGG + Intronic
925403667 2:3591595-3591617 CACATCCCAGACAGGGCGGCGGG + Intergenic
925407623 2:3616148-3616170 CACATCCCAGACAGGGCGGCGGG + Intronic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926101815 2:10122751-10122773 AGCAGCCAGGACAGGACGGCTGG - Exonic
926298678 2:11586973-11586995 CAGAGCTAGGACAGGGTGCAGGG + Intronic
926768987 2:16351349-16351371 CAGAGGCTGCACAGGGCAGCAGG - Intergenic
927138216 2:20112786-20112808 CAGAGCCAGAACTGTGGGGCTGG + Intergenic
927757882 2:25723512-25723534 CACATCCCGGACGGGGCGGCAGG + Intergenic
927931771 2:27050120-27050142 ACGCGCCAGGAGAGGGCGGCGGG - Intronic
928003267 2:27540738-27540760 CACATCCCAGACAGGGCGGCGGG + Intronic
928005480 2:27558253-27558275 CACATCCCAGACAGGGCGGCGGG + Intronic
928009434 2:27594206-27594228 CACCTCCCGGACAGGGCGGCCGG + Intronic
928558150 2:32448003-32448025 CACATCCCAGACAGGGCGGCGGG + Intronic
928769043 2:34683863-34683885 CAGAGACAGGATAGGGTGGAAGG + Intergenic
929739481 2:44588084-44588106 CACATCCCAGACAGGGCGGCGGG - Intronic
930703918 2:54485837-54485859 CACATCCCAGACAGGGCGGCGGG - Intronic
930821378 2:55650673-55650695 CACATCCCGGACGGGGCGGCAGG - Intronic
930930458 2:56875495-56875517 GAGTGCCAGCACAGGGCTGCTGG - Intergenic
931752124 2:65339125-65339147 CAGCTCCTGGACCGGGCGGCTGG - Intronic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932329495 2:70889616-70889638 CAGAGCCAGGCCGGCGAGGCGGG + Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
934549048 2:95243496-95243518 CACATCCCGGACGGGGCGGCAGG - Intronic
935483023 2:103616826-103616848 CAAAGCCTGGACAGTGCGGAAGG - Intergenic
935630860 2:105211266-105211288 CACATCCCAGACAGGGCGGCGGG + Intergenic
936396504 2:112135891-112135913 CAGAGAAAGGACAGTGCTGCTGG + Intergenic
936462284 2:112722427-112722449 CAGAGCCTGGACAGGCCTCCAGG + Intronic
936546544 2:113395277-113395299 CACCTCCCGGACAGGGCGGCTGG - Intergenic
937271221 2:120654358-120654380 CAGGGCTAGGACCGGGCGGGAGG - Intergenic
937370461 2:121293944-121293966 TAGAGCCAGGACAGGGCCCAGGG + Intergenic
937734922 2:125277289-125277311 CACATCCCAGACAGGGCGGCGGG + Intergenic
938008128 2:127805583-127805605 CAGAGTCAGGAAGGGGCAGCAGG + Intronic
938533759 2:132221008-132221030 CACATCCCAGACAGGGCGGCGGG - Intronic
940817298 2:158310748-158310770 CACATCCCAGACAGGGCGGCCGG + Intronic
940833318 2:158492556-158492578 CAAAGCCCGGGCAGGGTGGCAGG - Intronic
940907613 2:159183338-159183360 CAGCGCCAGGGCGGGTCGGCAGG + Intronic
941023837 2:160438854-160438876 CACCTCCCGGACAGGGCGGCTGG + Intronic
941024031 2:160439404-160439426 CACATCCCGGACGGGGCGGCAGG + Intronic
941603218 2:167564212-167564234 CACATCCCGGACGGGGCGGCAGG + Intergenic
941769208 2:169328085-169328107 CACCTCCTGGACAGGGCGGCTGG - Intronic
941793196 2:169575105-169575127 CACCTCCCGGACAGGGCGGCTGG + Intergenic
942297014 2:174527575-174527597 CAGAGGGAGGCCAGGGTGGCTGG + Intergenic
942565836 2:177264400-177264422 CAGAGCCAGGACCGCGGCGCTGG - Intronic
943648366 2:190431094-190431116 CACATCCCAGACAGGGCGGCGGG + Intronic
943739788 2:191397914-191397936 CACCTCCCGGACAGGGCGGCTGG + Intronic
943740058 2:191398617-191398639 CACATCCCAGACAGGGCGGCGGG + Intronic
944255294 2:197618732-197618754 CACATCCCGGACGGGGCGGCAGG - Intronic
944255395 2:197619031-197619053 CACCTCCCGGACAGGGCGGCTGG - Intronic
944533091 2:200684104-200684126 CACATCCCAGACAGGGCGGCAGG + Intergenic
944860675 2:203812978-203813000 GAGAGCCAGGACAGTGAGGAAGG - Intergenic
945232913 2:207610441-207610463 CACATCCCAGACAGGGCGGCGGG - Exonic
945251033 2:207767029-207767051 CACAGGCAGGACCGGGCCGCCGG - Exonic
946172103 2:217901795-217901817 CGGAGCCAGGAGAGGGGTGCAGG - Intronic
946179565 2:217941483-217941505 CAGTGCCAGGGCAGAGCGTCGGG + Intronic
946301598 2:218827643-218827665 CAGAGTCAGGCCAGGGGAGCCGG + Intronic
946318101 2:218931445-218931467 CACATCCCGGACGGGGCGGCAGG - Intergenic
946318260 2:218931872-218931894 CACCTCCCGGACAGGGCGGCTGG - Intergenic
946374523 2:219300042-219300064 CAGAGCCAGCCCACGGTGGCAGG - Exonic
946651026 2:221892433-221892455 CACCTCCTGGACAGGGCGGCTGG - Intergenic
946751506 2:222897274-222897296 CACATCCCAGACAGGGCGGCGGG + Intronic
947669511 2:231927354-231927376 CAGAGGCTGGACTGGGCCGCTGG - Intergenic
947874210 2:233457780-233457802 GAGAGACAGGAGAGGGCTGCAGG + Intronic
948000417 2:234562812-234562834 CACATCCCAGACAGGGCGGCGGG - Intergenic
948124548 2:235555262-235555284 AAGAGACAGGGCAGGGCGGCAGG - Intronic
948530108 2:238598734-238598756 CTGAGCCAGGACAGGGTAGAAGG - Intergenic
948657781 2:239487312-239487334 CTGAGTGAGGCCAGGGCGGCAGG + Intergenic
948979159 2:241484053-241484075 CAGAGGCAGGAAAGGGCCACAGG - Intronic
1168762992 20:362462-362484 CAGAGCAAGGCCAGGGTTGCCGG - Intergenic
1168856533 20:1013053-1013075 CAGGGCCAGGACTGGTGGGCAGG + Intergenic
1169108655 20:3018819-3018841 CACCTCCCGGACAGGGCGGCTGG + Intronic
1169108902 20:3019463-3019485 CACATCCCGGACGGGGCGGCAGG + Intronic
1170162014 20:13322877-13322899 GAGAGACAGGTCAGGGCAGCGGG - Intergenic
1170645780 20:18194775-18194797 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1170893674 20:20396082-20396104 CAGACCCAGGACAGAAAGGCAGG + Intronic
1171460843 20:25297073-25297095 CAGAGCCAGGACAGAGGGCAGGG - Exonic
1171971766 20:31569315-31569337 CAGCTCCAGGACAGGGCAGGGGG + Exonic
1172379204 20:34474758-34474780 CACCTCCAGGACAGGGCGGCTGG + Intronic
1172482101 20:35277389-35277411 CAGAGGCAGGACAGGCCTCCTGG - Intergenic
1172717518 20:36976322-36976344 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1172907363 20:38379204-38379226 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174020688 20:47526110-47526132 CACATCCCGGACGGGGCGGCAGG + Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174344824 20:49922096-49922118 CACATCCCGGACGGGGCGGCAGG - Intergenic
1174835856 20:53854620-53854642 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1174897586 20:54467464-54467486 TAGAGCAAGGTCAGGGTGGCTGG - Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175515512 20:59567438-59567460 CACAGCCAGGAGAGGGTGCCCGG - Intergenic
1175812157 20:61864206-61864228 AAGGGCCAGGGCAGGGCTGCTGG + Intronic
1175839876 20:62020027-62020049 CAGAGCCAAGCCAGGGCGGGTGG - Intronic
1175904874 20:62374830-62374852 CAGAGCCAGTTCAGGCGGGCAGG + Intergenic
1175905811 20:62378806-62378828 CAGTGCCAGGGCAGGACAGCAGG - Intergenic
1176098890 20:63356170-63356192 CAGGGCCAGGGCAGGGCAGCAGG + Intronic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176348468 21:5771156-5771178 CACATCCCGGACGGGGCGGCAGG + Intergenic
1176355282 21:5891740-5891762 CACATCCCGGACGGGGCGGCAGG + Intergenic
1176496359 21:7553299-7553321 CACATCCCGGACGGGGCGGCAGG - Intergenic
1176542789 21:8169226-8169248 CACATCCCGGACGGGGCGGCAGG + Intergenic
1176561740 21:8352271-8352293 CACATCCCGGACGGGGCGGCAGG + Intergenic
1176863460 21:14027734-14027756 CAGGGACAGGACAGGACGCCCGG - Intergenic
1176866494 21:14057423-14057445 CAGGGCCAGGACAGGCAGGATGG + Intergenic
1176952618 21:15064801-15064823 CCGGGCCAGGACGGGGCGGCAGG - Exonic
1177087100 21:16719201-16719223 GAGAGCTAGGACATGGAGGCAGG + Intergenic
1178075762 21:29012013-29012035 CACCTCCCGGACAGGGCGGCTGG - Intronic
1178090679 21:29159943-29159965 CGGAGTCATGACAAGGCGGCAGG - Exonic
1178805382 21:35834784-35834806 GGGAGCCAGGAGAGGGTGGCGGG + Intronic
1179552174 21:42150462-42150484 TAGAGCCAGGACAGGTGGGGAGG + Intergenic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179965621 21:44802950-44802972 CTGAACCAGGCCAGGGCAGCTGG - Intergenic
1179969135 21:44824728-44824750 CACATCCCAGACAGGGCGGCGGG - Intergenic
1180027784 21:45178211-45178233 CACAGCCAAGCCAGGGAGGCAGG - Intronic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180225639 21:46390533-46390555 CAGGGCCAGGCCAGGGTGACGGG - Intronic
1180667905 22:17529315-17529337 CAGAGCAAGCACAGGAAGGCTGG + Intronic
1180739330 22:18041815-18041837 CACATCCCAGACAGGGCGGCGGG + Intergenic
1180799430 22:18624895-18624917 CAGACCCAGGACAGGCAGGAGGG - Intergenic
1180948046 22:19707631-19707653 CATAGCCAGGAAAGCGGGGCTGG - Intergenic
1181167799 22:20992734-20992756 CAGAGCCTCCACAGTGCGGCTGG - Intronic
1181222288 22:21370371-21370393 CAGACCCAGGACAGGCAGGAGGG + Intergenic
1181583639 22:23841495-23841517 CTGAGCCAGGAAAGGGCTTCAGG + Intergenic
1181586076 22:23854459-23854481 CACATCCCAGACAGGGCGGCGGG - Intergenic
1181586151 22:23854706-23854728 CACCTCCAGGACGGGGCGGCTGG - Intergenic
1181638992 22:24187122-24187144 CAGCCCCAGGACAGGGTGGTCGG - Intronic
1181747899 22:24968459-24968481 CAGAGCCAGGACATGACTGCGGG - Intronic
1182199334 22:28553432-28553454 CACATCCCAGACAGGGCGGCGGG - Intronic
1182377243 22:29857844-29857866 CATCTCCCGGACAGGGCGGCTGG + Intergenic
1182484512 22:30631598-30631620 CACCTCCAGGACGGGGCGGCTGG + Intergenic
1182538849 22:31026925-31026947 CACATCCCAGACAGGGCGGCGGG - Intergenic
1182828068 22:33282861-33282883 CGGAGCCAGGAGATGGCAGCAGG + Intronic
1183262371 22:36803883-36803905 CAGAGCCAGGACTTGGCCTCTGG + Intronic
1183293435 22:37016686-37016708 CAAGGCCAGGAGAGGGCTGCAGG + Intronic
1183437606 22:37804714-37804736 CCGAGCCGGGACAGGGGGGAGGG - Intergenic
1183618009 22:38956718-38956740 AAGAGCCAGAACAGGGGAGCAGG + Intronic
1184030790 22:41893171-41893193 CAGAGCCAGCGCAGGGAGTCAGG - Exonic
1184212218 22:43042844-43042866 AGGAGCCAGGAGAGGACGGCTGG + Intronic
1184423885 22:44397689-44397711 CACAGCCAGCACAGGGCAGGTGG - Intergenic
1184452546 22:44591609-44591631 CACAGGCAGGACAGCCCGGCAGG - Intergenic
1184549464 22:45196828-45196850 CAGAGCGGGGCCAGAGCGGCGGG - Exonic
1184685571 22:46095258-46095280 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685586 22:46095299-46095321 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685601 22:46095340-46095362 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685629 22:46095419-46095441 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685660 22:46095501-46095523 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685675 22:46095542-46095564 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685719 22:46095661-46095683 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685734 22:46095702-46095724 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685763 22:46095780-46095802 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685778 22:46095821-46095843 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184685793 22:46095862-46095884 CCCAGCCAGCCCAGGGCGGCAGG + Intronic
1184924223 22:47626039-47626061 CTGAGACAGGACAGGGAGGTAGG - Intergenic
1184927246 22:47651477-47651499 CAGGGCAAGAACAGGGTGGCAGG + Intergenic
1185045629 22:48527402-48527424 CAGGGCAAGGCCAGGGCAGCAGG + Intronic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185182311 22:49370369-49370391 CAGAGCAGAGACAGGGCTGCAGG + Intergenic
1185344847 22:50306727-50306749 CAGAGTCAGGACAGGGGGTGAGG - Intronic
1203247654 22_KI270733v1_random:85469-85491 CACATCCCGGACGGGGCGGCAGG + Intergenic
949569941 3:5283817-5283839 CACCTCCCGGACAGGGCGGCTGG + Intergenic
950448978 3:13055054-13055076 CAGAGCCAGGACAGGAAGGCCGG - Intronic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950949200 3:16980485-16980507 CACATCCCGGACGGGGCGGCAGG + Intronic
951964949 3:28371773-28371795 CAAAGACAGGACAGGGTGGGTGG + Intronic
952330749 3:32362502-32362524 GAGAGCCAGGAATGGGAGGCAGG + Intronic
952513072 3:34076442-34076464 CAGAGAGAGGGCAGGGCAGCTGG + Intergenic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954116664 3:48470389-48470411 CAGCCCCAGGGCAGGGAGGCTGG + Intronic
954523434 3:51249223-51249245 CACCTCCCGGACAGGGCGGCTGG - Intronic
955362791 3:58289830-58289852 CACCACCCGGACAGGGCGGCTGG + Intronic
955674454 3:61434690-61434712 CACATCCCGGACGGGGCGGCTGG + Intergenic
957939908 3:86991192-86991214 CTGTGCGAGGACAGGGAGGCGGG + Intergenic
959415790 3:106075138-106075160 CACATCCCAGACAGGGCGGCGGG + Intergenic
959519210 3:107306588-107306610 CAGAGCGAGCACAGGCCTGCTGG - Intergenic
959683825 3:109124305-109124327 CACCTCCCGGACAGGGCGGCTGG - Intergenic
961058500 3:123809031-123809053 CAGAGCCAGGACAGGACACCAGG - Intronic
961163685 3:124750081-124750103 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961715797 3:128856630-128856652 CACAGCCAGGCCGGGGCGGGTGG + Intergenic
961733335 3:128983937-128983959 CAGAGAAAGGCCAGGCCGGCAGG + Intronic
961783270 3:129334095-129334117 ATGAGCCAGGGAAGGGCGGCCGG - Intergenic
961784419 3:129339807-129339829 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961788730 3:129362596-129362618 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961789059 3:129363374-129363396 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961962376 3:130867937-130867959 CACATCCCAGACAGGGCGGCAGG - Intronic
962245292 3:133785649-133785671 CACCTCCCGGACAGGGCGGCTGG - Intronic
963911650 3:150821185-150821207 CACATCCCAGACAGGGCGGCGGG + Intergenic
965376432 3:167930060-167930082 CAGAGACAGGTCAGGGAGACGGG + Intergenic
966015043 3:175131737-175131759 CACCCCCCGGACAGGGCGGCTGG + Intronic
966420241 3:179728331-179728353 CACATCCCGGACGGGGCGGCAGG + Intronic
966783810 3:183607982-183608004 CACATCCCAGACAGGGCGGCGGG - Intergenic
967176260 3:186864726-186864748 CACCTCCCGGACAGGGCGGCCGG - Intergenic
967578496 3:191125014-191125036 CACTTCCCGGACAGGGCGGCTGG + Intergenic
967870364 3:194224269-194224291 CAGAGCCGGGGCAGTGGGGCTGG - Intergenic
968411622 4:395640-395662 CACATCCTGGACGGGGCGGCAGG - Intergenic
968429841 4:550525-550547 CACATCCCAGACAGGGCGGCGGG + Intergenic
968439874 4:617832-617854 CAGAGCCAGGGCTGTCCGGCCGG - Intergenic
968507124 4:975990-976012 CACATCCCAGACAGGGCGGCGGG - Intronic
968924348 4:3539098-3539120 CACATCCCAGACAGGGCGGCAGG + Intergenic
968931367 4:3581315-3581337 CAGAGCCAGGTCTGGGCTGCAGG + Intronic
968975060 4:3817743-3817765 CAGAGCCTGGACGGGGCGCTGGG - Intergenic
969185011 4:5468403-5468425 CAGAGCCAGGACTTGGCCCCAGG - Intronic
969371325 4:6733288-6733310 CAGGGCCAGGACTGGGCCTCAGG - Intergenic
969414503 4:7049864-7049886 TAGCGGCAGGACAGAGCGGCCGG - Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969707709 4:8820814-8820836 CAGAGCCAGGACAGGCAGCCCGG + Intergenic
970286136 4:14518321-14518343 CAGAGCCAGGAGAGAGCCTCTGG + Intergenic
970371546 4:15412126-15412148 CAGAGCCAGGACAGATCATCGGG - Intronic
970409210 4:15790822-15790844 CACATCCCAGACAGGGCGGCGGG - Intronic
970434712 4:16022200-16022222 AAAAGCCAGGACAGGAAGGCAGG + Intronic
970472773 4:16393650-16393672 CACATCCCGGACGGGGCGGCGGG + Intergenic
971282009 4:25249406-25249428 CACCCCCCGGACAGGGCGGCTGG + Intronic
972484399 4:39527852-39527874 CTCGGCCAGGACAGGGCAGCGGG - Intronic
973109060 4:46377381-46377403 CACATCCCGGACGGGGCGGCAGG - Intronic
975042423 4:69762005-69762027 CACATCCCGGACAGGGCGACAGG - Intronic
975662591 4:76702572-76702594 CAGAGCCAGAACAGGACCCCAGG + Intronic
975685545 4:76916698-76916720 CACATCCCAGACAGGGCGGCGGG - Intergenic
976072508 4:81257972-81257994 CAGAGCCATGACATGCCTGCTGG - Intergenic
976266030 4:83186355-83186377 CACATCCCAGACAGGGCGGCGGG + Intergenic
976607372 4:86995918-86995940 CACATCCCGGACGGGGCGGCAGG - Intronic
976607439 4:86996124-86996146 CACCTCCCGGACAGGGCGGCTGG - Intronic
977106586 4:92893431-92893453 CAGAGCCAGGACAAGGGCTCAGG - Intronic
977809665 4:101345924-101345946 AAGAGCAATGACAGGTCGGCGGG + Intronic
978409096 4:108409469-108409491 CACATCCCAGACAGGGCGGCGGG - Intergenic
979622616 4:122812594-122812616 CACCTCCCGGACAGGGCGGCTGG - Intergenic
981342139 4:143634022-143634044 CAGAGCCCAAACAGGGCAGCTGG + Intronic
981970850 4:150660505-150660527 CACCTCCCGGACAGGGCGGCTGG - Intronic
982040375 4:151390817-151390839 CACATCCCAGACAGGGCGGCGGG - Intergenic
982040452 4:151391065-151391087 CACCTCCCGGACAGGGCGGCTGG - Intergenic
982053662 4:151526873-151526895 CACATCCCGGACGGGGCGGCAGG + Intronic
983218058 4:165019930-165019952 CACCTCCCGGACAGGGCGGCTGG + Intergenic
983218106 4:165020054-165020076 CACCTCCCGGACAGGGCGGCTGG + Intergenic
983524265 4:168744465-168744487 CAGAGCCAAGACAAGGTGTCTGG + Intronic
983652191 4:170046360-170046382 CACATCCCGGACCGGGCGGCAGG - Intergenic
983652418 4:170046964-170046986 CACCTCCCGGACAGGGCGGCTGG - Intergenic
984533679 4:180945336-180945358 CACCTCCCGGACAGGGCGGCTGG - Intergenic
984557679 4:181234803-181234825 CAGAGCCAGGACTGGCATGCTGG - Intergenic
984852817 4:184168778-184168800 CAGAGCCCGGGCAGGGCCGGCGG + Intronic
985445268 4:190018251-190018273 CTGGGCCAGAACAGGGGGGCAGG - Intergenic
985488916 5:167693-167715 CAAAGCCTGGCCTGGGCGGCGGG - Intronic
985620607 5:952865-952887 TTGAGCCAGGACAGGCCTGCAGG + Intergenic
985627577 5:997851-997873 CAGAGCCAGGTGAGGGCAGATGG - Intergenic
985720018 5:1484055-1484077 CAGGGGCAGGTGAGGGCGGCGGG - Intronic
985964873 5:3332217-3332239 CAGAGCCATGGCAGGGCTGCTGG - Intergenic
988544296 5:32142250-32142272 CACATCCCGGACGGGGCGGCAGG - Intronic
989588039 5:43088470-43088492 CACATCCCAGACAGGGCGGCGGG + Intronic
989663440 5:43824516-43824538 CACTTCCCGGACAGGGCGGCTGG + Intergenic
990459055 5:56015076-56015098 CACCTCCCGGACAGGGCGGCTGG + Intergenic
991377077 5:65977506-65977528 CACATCCCGGACGGGGCGGCAGG + Intronic
991600643 5:68348667-68348689 CAGAGGCTGGGCAGGGCAGCAGG - Intergenic
992098040 5:73380756-73380778 AAACGCCAGGACAGGGCGGCTGG + Intergenic
992374171 5:76172317-76172339 CACCTCCCGGACAGGGCGGCTGG - Intronic
992374225 5:76172446-76172468 CACCTCCCGGACAGGGCGGCTGG - Intronic
992469496 5:77042405-77042427 CACCTCCCGGACAGGGCGGCTGG + Intronic
992574517 5:78096908-78096930 CACCTCCCGGACAGGGCGGCTGG - Intronic
992662030 5:78971267-78971289 CTAAGCCAGGACAAGGAGGCAGG - Intronic
992978283 5:82140268-82140290 CACCTCCCGGACAGGGCGGCTGG - Intronic
993162808 5:84312475-84312497 CACCTCCCGGACAGGGCGGCTGG + Intronic
993496564 5:88615800-88615822 CACATCCCGGACGGGGCGGCAGG - Intergenic
993657921 5:90596139-90596161 CACATCCCAGACAGGGCGGCGGG + Intronic
993953786 5:94207386-94207408 TAGAACCAGGACAGGGCTGCTGG - Intronic
994083175 5:95731021-95731043 CAGAGCCAGGAAAGGGGGGTGGG - Intronic
995193648 5:109342223-109342245 CACCTCCTGGACAGGGCGGCTGG - Intronic
995994448 5:118282628-118282650 CACATCCCAGACAGGGCGGCGGG - Intergenic
997335971 5:133109046-133109068 CACCTCCCGGACAGGGCGGCTGG - Intergenic
997336024 5:133109174-133109196 CACCTCCCGGACAGGGCGGCTGG - Intergenic
997354429 5:133253321-133253343 CAGAGCCAGGCCTGGGGGCCAGG - Intronic
997736555 5:136216593-136216615 CAGAGCCAGGCCAAGGCCCCTGG - Intronic
997874774 5:137537844-137537866 CACCTCCCGGACAGGGCGGCTGG + Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998074410 5:139224483-139224505 CACATCCCAGACAGGGCGGCAGG - Intronic
998239443 5:140427739-140427761 CACCTCCCGGACAGGGCGGCTGG + Intronic
998239518 5:140427985-140428007 CACATCCCGGACAGGGCGGCAGG + Intronic
999491556 5:152056296-152056318 CACAGTAAGGACAGGGCCGCTGG + Intergenic
1000264225 5:159619469-159619491 CAGAGCAAGGACCCGGGGGCAGG - Intergenic
1001133751 5:169085211-169085233 CAGAGCCAGAGCAGGTCGGCTGG + Intronic
1001422660 5:171599385-171599407 CAGAGCCAGGAAATGGCAGCCGG + Intergenic
1001959683 5:175872492-175872514 GAGATCCAGGACAGAGCTGCTGG + Intronic
1002094552 5:176823334-176823356 CAGAGTGTGGACAGGGCGCCTGG + Intronic
1002296714 5:178235437-178235459 CACAGCCAGGACATAGTGGCAGG - Intergenic
1002529436 5:179835115-179835137 CACATCCCAGACAGGGCGGCGGG + Intronic
1005069912 6:21852335-21852357 CACATCCCAGACAGGGCGGCGGG + Intergenic
1005644749 6:27827825-27827847 CACATCCCAGACAGGGCGGCGGG + Intergenic
1006014129 6:31067197-31067219 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1006141312 6:31931858-31931880 CACCTCCCGGACAGGGCGGCTGG + Intronic
1006148863 6:31975874-31975896 CACCTCCCGGACAGGGCGGCTGG + Intronic
1006281928 6:33060102-33060124 CACATCCCGGACGGGGCGGCAGG + Intergenic
1006429149 6:33984498-33984520 CTGAGCCAGGCCAGGGGCGCTGG + Intergenic
1006735665 6:36270758-36270780 CAAAGCCAGGCCTGGGTGGCAGG + Intronic
1007250595 6:40492358-40492380 CTGGGCCAGGACAGGGGAGCAGG - Intronic
1007252149 6:40503064-40503086 GAGAGCAAGGACAGGGCAGAGGG + Intronic
1007414358 6:41683359-41683381 CAGAGCCAGAGCGGGGCGGGGGG + Intergenic
1007651530 6:43425394-43425416 CACCTCCAGGACAGGGCAGCTGG - Intergenic
1008106401 6:47444279-47444301 CACATCCCAGACAGGGCGGCGGG + Intergenic
1008480658 6:51981964-51981986 CACATCCCAGACAGGGCGGCGGG - Intronic
1008624691 6:53305294-53305316 CACCTCCCGGACAGGGCGGCTGG + Intronic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010753561 6:79641441-79641463 CATAGCCAGGACAGAGAGGTAGG - Intronic
1014904384 6:127008606-127008628 CAGAGCCTGCACTGGGCGGGTGG - Intergenic
1015220810 6:130802287-130802309 CACATCCCGGACGGGGCGGCAGG - Intergenic
1015643663 6:135364035-135364057 CACCTCCCGGACAGGGCGGCTGG + Intronic
1015643726 6:135364241-135364263 CACATCCTGGACGGGGCGGCAGG + Intronic
1016802251 6:148179173-148179195 CACATCCCGGACGGGGCGGCAGG + Intergenic
1016973488 6:149786232-149786254 CCCAGACGGGACAGGGCGGCTGG + Intronic
1017129922 6:151099410-151099432 CAGAGCCACTACAGTGAGGCTGG + Intronic
1017830809 6:158127268-158127290 CACCTCCCGGACAGGGCGGCTGG - Intronic
1017955979 6:159178051-159178073 CAGAGCCATGAAAGGCCAGCAGG + Intronic
1018915509 6:168130269-168130291 CAGAGCCAGGACAGGCAGCCAGG + Intergenic
1019188506 6:170235978-170236000 GAGAGCCAGGGGAGGGCCGCTGG + Intergenic
1019384417 7:746549-746571 CAGAGCCTGGGCACGGCGGGCGG - Intronic
1019420337 7:947895-947917 CAGAGCCAGGGCGGGGAGACGGG - Intronic
1019459172 7:1147314-1147336 CACATCCCAGACAGGGCGGCGGG + Intergenic
1019520729 7:1459553-1459575 CGGAGGCAGGACTTGGCGGCTGG - Intergenic
1019715045 7:2534635-2534657 CACATCCCAGACAGGGCGGCGGG + Intergenic
1019779536 7:2931201-2931223 CAGAGGGAGGCCAGGGCGGGGGG - Intronic
1019869635 7:3747824-3747846 CAGACCCTGTACAGGGAGGCTGG + Intronic
1020284946 7:6671778-6671800 CACATCCCAGACAGGGCGGCGGG + Intergenic
1020325936 7:6975178-6975200 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1021440191 7:20668368-20668390 CACATCCCAGACAGGGCGGCGGG - Intronic
1021735277 7:23636507-23636529 CACATCCCAGACAGGGCGGCGGG - Intronic
1021872688 7:25019438-25019460 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1021994483 7:26166491-26166513 CAGAACCAGGATTTGGCGGCAGG - Intronic
1022285934 7:28956432-28956454 CAGAGCCAGGAGAGGCCGTTGGG + Exonic
1022510907 7:30934281-30934303 CAGAGCAAGGACAGGTGAGCTGG - Intergenic
1023160627 7:37292813-37292835 CACCTCCCGGACAGGGCGGCTGG - Intronic
1023337454 7:39185300-39185322 CAGATCCAGGACAGCGCCACTGG + Intronic
1023761518 7:43468897-43468919 CTGAGACAGGTCAGGGCGGACGG - Intronic
1023888808 7:44378376-44378398 CAGAGGCAGGGCAGGGCTGTAGG - Intergenic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1024399886 7:48912313-48912335 CAGAGCCATGACACAGAGGCTGG - Intergenic
1024575941 7:50764186-50764208 CAGGGACAGGACAGGGTGGATGG - Intronic
1024982528 7:55169737-55169759 CAGTGGCAGGACGGGGCTGCAGG - Intronic
1024993590 7:55254785-55254807 CGGAGCCAGCCCAGGGCTGCCGG - Intronic
1025853374 7:65259386-65259408 CACCTCCCGGACAGGGCGGCCGG - Intergenic
1026766043 7:73160525-73160547 CAGACCCGGGACAGGGTCGCTGG - Intergenic
1026862119 7:73797431-73797453 CACATCCCGGACGGGGCGGCGGG + Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1026940515 7:74285161-74285183 CAGAGGCTGCACAGGGTGGCAGG - Intergenic
1027042518 7:74970221-74970243 CAGACCCGGGACAGGGTCGCTGG - Intronic
1027081125 7:75232136-75232158 CAGACCCGGGACAGGGTCGCTGG + Intergenic
1027224343 7:76234590-76234612 CAGAGCCAGGATAGTGGGCCTGG + Intronic
1027239643 7:76318576-76318598 CAGAGCCGGGAAGGGTCGGCAGG + Intergenic
1027895660 7:84040578-84040600 GAGAGCCATGTCAGGGAGGCCGG + Intronic
1028548121 7:92026938-92026960 CACATCCCAGACAGGGCGGCCGG - Intronic
1028583691 7:92432650-92432672 TAGAGCCAAGAGAGGGCTGCAGG - Intergenic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029334355 7:99887904-99887926 CACCTCCCGGACAGGGCGGCTGG + Intronic
1029568983 7:101358719-101358741 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1029977285 7:104846753-104846775 CAGAGCCAGGACAGGGACCTGGG - Intronic
1032456102 7:132074704-132074726 CAGTGGCATGACAGGGAGGCCGG + Intergenic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032859411 7:135863083-135863105 CAGAGGCAGGCCAGAGCAGCTGG + Intergenic
1033323727 7:140362196-140362218 CACATCCCAGACAGGGCGGCGGG - Intronic
1034553103 7:151833538-151833560 GAGAGCCAGAGCGGGGCGGCAGG + Intronic
1034638887 7:152586585-152586607 CACATCCCAGACAGGGCGGCGGG + Intergenic
1034723289 7:153314765-153314787 CACCTCCTGGACAGGGCGGCTGG + Intergenic
1034723426 7:153315091-153315113 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1035108254 7:156459807-156459829 CAGGGGCAGAACAGGGCGGCGGG - Intergenic
1035265581 7:157688946-157688968 CAGAGCCAGGAGAGGGGTCCCGG + Intronic
1035368531 7:158363716-158363738 GAGAGCCAGGAGAGGTCGGGAGG + Intronic
1035608702 8:946917-946939 CGGCAGCAGGACAGGGCGGCCGG - Intergenic
1036095961 8:5725365-5725387 CACATCCCGGACAGGGCGACAGG - Intergenic
1037587168 8:20285301-20285323 CTGAGGCAGGTCAGGGTGGCAGG - Intronic
1037876491 8:22551420-22551442 CGGAGCCAGGACAAGGGGGCAGG - Intronic
1037957683 8:23071590-23071612 CAGAGCCAGGACCTGGGGTCCGG - Intergenic
1037962027 8:23105001-23105023 CAGAGCCAGGACCTGGGGTCAGG - Intronic
1037969427 8:23161408-23161430 CAGAGCCAGGACCTGGGGTCAGG + Intronic
1038459203 8:27702377-27702399 CAGTGCCAGGACTGGGCAGCGGG - Intergenic
1038537969 8:28368167-28368189 CAGAGCCAGGACTGGAGGGAGGG + Intronic
1038744914 8:30247232-30247254 CACATCCCAGACAGGGCGGCGGG + Intergenic
1038777840 8:30546915-30546937 AAGAGCCAGGCCTGGGAGGCAGG - Intronic
1039964549 8:42274464-42274486 CAGAGGCAGGAAAGGGTGGTGGG - Intronic
1040043544 8:42939832-42939854 CACATCCCGGACGGGGCGGCAGG + Intronic
1040070049 8:43180445-43180467 CACATCCCAGACAGGGCGGCGGG + Intronic
1040618894 8:49066869-49066891 CAGAGCCAGGACACGGGAGGAGG - Intronic
1040818613 8:51534130-51534152 CACATCCCAGACAGGGCGGCGGG - Intronic
1041358015 8:57021880-57021902 CACATCCCAGACAGGGCGGCGGG - Intergenic
1041491471 8:58438024-58438046 CAGAGGCTGCACAGGGCAGCTGG - Intronic
1041677320 8:60548989-60549011 CACATCCCGGACGGGGCGGCAGG + Intronic
1041693592 8:60714074-60714096 CAGAGCCAGGCCTCGGCGGGCGG + Intronic
1041920880 8:63180284-63180306 CACATCCCGGACGGGGCGGCAGG + Intronic
1043864467 8:85359618-85359640 GTGAGACAGGACAGGGCAGCTGG + Intronic
1044223626 8:89698718-89698740 CACATCCCGGACGGGGCGGCAGG - Intergenic
1044660981 8:94591625-94591647 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1045120485 8:99029127-99029149 CACATCCCAGACAGGGCGGCGGG + Intronic
1046636235 8:116678639-116678661 CACATCCCAGACAGGGCGGCGGG - Intronic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1047782171 8:128119087-128119109 CACATCCCGGACGGGGCGGCAGG + Intergenic
1048195269 8:132327491-132327513 CAGAGCCAGGACAGGGTCCCTGG - Intronic
1049098138 8:140560804-140560826 CAAAGCCAGGACAGGGAGTCTGG - Intronic
1049161836 8:141102961-141102983 CTGAGCCTGGACAGGGCTGCCGG - Intergenic
1049383878 8:142331235-142331257 CAGAGCCAGGGCAAGACTGCTGG - Intronic
1049580583 8:143408836-143408858 CAGAGCCTGGACAGGGCCAGTGG + Intergenic
1049748129 8:144271599-144271621 CAGGGCAAGGCCAGGGCGGGAGG + Intronic
1049812187 8:144580572-144580594 CAGGGCCAGGTGAGGGCGGTGGG - Intronic
1049822698 8:144645809-144645831 CTGAGCGAGGCCAGGGCTGCAGG + Intergenic
1050537715 9:6645190-6645212 CAGAGCCCGGGCAGGGCGGAGGG + Intronic
1051016467 9:12481648-12481670 CAGAACAAAGACAGGTCGGCAGG + Intergenic
1051430674 9:16977680-16977702 CACATCCCGGACGGGGCGGCAGG + Intergenic
1051636629 9:19186664-19186686 CAGAGCCAGGACAGGACTCTAGG - Intergenic
1051661923 9:19434122-19434144 CACATCCCAGACAGGGCGGCGGG + Intronic
1052828721 9:33197438-33197460 CAAGGCCAGGACTGGGAGGCTGG + Intergenic
1053315994 9:37052328-37052350 CAGAGACTGGTCAGGGAGGCTGG + Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1054458758 9:65450616-65450638 CAGAGCCAGGTATGGGCTGCAGG - Intergenic
1055138546 9:72851018-72851040 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1055138776 9:72851618-72851640 CACATCCCGGACGGGGCGGCAGG + Intergenic
1055506722 9:76955746-76955768 CACCTCCTGGACAGGGCGGCTGG - Intergenic
1055580481 9:77702817-77702839 CAGCTCCCGGACGGGGCGGCTGG + Intergenic
1055580500 9:77702859-77702881 CAGCTCCCGGACGGGGCGGCTGG + Intergenic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1056681395 9:88722084-88722106 TAGAGCCAGGACTGGGCCCCAGG + Intergenic
1056873410 9:90305698-90305720 CAGAGCAAGGACAGCGCCACGGG - Intergenic
1056935800 9:90914102-90914124 CAGAGCCAGAACATGCCAGCTGG - Intergenic
1057080463 9:92171109-92171131 AAGGGCCTGGCCAGGGCGGCTGG - Intergenic
1057087782 9:92227400-92227422 CACCTCCCGGACAGGGCGGCTGG + Intronic
1057155142 9:92831808-92831830 CACATCCCGGACGGGGCGGCAGG + Intergenic
1057596598 9:96419399-96419421 CAGAGGAAGGACCGGGCGGAGGG + Intergenic
1057674875 9:97130640-97130662 CACCTCCTGGACAGGGCGGCCGG + Intergenic
1057739236 9:97697356-97697378 CAGAGGCGGTGCAGGGCGGCTGG - Exonic
1057751475 9:97796530-97796552 CACATCCCGGACGGGGCGGCAGG - Intergenic
1058729489 9:107836241-107836263 CAGTGCCAGGAGAGTGTGGCTGG - Intergenic
1059211278 9:112514879-112514901 CACCTCCCGGACAGGGCGGCTGG - Intronic
1059707823 9:116840727-116840749 CACATCCCGGACGGGGCGGCAGG + Intronic
1060065272 9:120496407-120496429 CACCTCCCGGACAGGGCGGCTGG - Intronic
1060350059 9:122852143-122852165 CACATCCCAGACAGGGCGGCGGG - Intronic
1060350241 9:122852654-122852676 CACCTCCCGGACAGGGCGGCTGG - Intronic
1060351911 9:122867480-122867502 CACATCCCCGACAGGGCGGCTGG - Intronic
1060352130 9:122868141-122868163 CACATCCCCGACAGGGCGGCTGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060542731 9:124441542-124441564 CAGAGCCGGGCCAGGGCGGTGGG - Intergenic
1060682303 9:125577165-125577187 CACATCCCGGACGGGGCGGCAGG - Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060869475 9:127028278-127028300 CACAGCCAGAACAGAGCTGCAGG - Intronic
1061519915 9:131111884-131111906 CAGGGCCAGGACCGGGCTGCAGG - Intronic
1061719885 9:132545002-132545024 CAGAGCAAGGAAAGGGCTCCAGG + Intronic
1061745086 9:132733765-132733787 CAGAGCCAGGAAAGGGAGAAAGG + Intronic
1061754045 9:132800264-132800286 CAGTGCCAGGACCTGGCGCCAGG + Intronic
1061834668 9:133320995-133321017 CAGAGCCAGGCCATGGGGGAAGG - Intergenic
1061866459 9:133494021-133494043 GAGAGCCAGGTCAGGGCAGAGGG + Intergenic
1062048677 9:134436248-134436270 CAGAGCCAGGACAGAGTGAAGGG - Intronic
1062694310 9:137865330-137865352 AAGAGGCAGGACAGGGCAACGGG + Intronic
1185558639 X:1041157-1041179 CAGAGGCCGGGCAGGGAGGCGGG + Intergenic
1186277545 X:7956442-7956464 CAGAGTCAGAACAGGGCTGTAGG - Intergenic
1188368025 X:29334665-29334687 CACATCCCAGACAGGGCGGCGGG + Intronic
1189837583 X:45040363-45040385 CACCTCCCGGACAGGGCGGCTGG + Intronic
1190159078 X:48017155-48017177 CACCTCCTGGACAGGGCGGCTGG - Intronic
1190241281 X:48659535-48659557 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1190241417 X:48659917-48659939 CACATCCCAGACAGGGCGGCGGG + Intergenic
1190279847 X:48922451-48922473 CTGGGCAAGGGCAGGGCGGCAGG - Exonic
1190778931 X:53578168-53578190 CACATCCCAGACAGGGCGGCGGG - Intronic
1190891552 X:54572895-54572917 CACATCCCAGACAGGGCGGCGGG + Intergenic
1191835326 X:65457088-65457110 CACATCCCAGACAGGGCGGCGGG - Intronic
1192180141 X:68911125-68911147 CAGAGTAAGGACAGGGCTACTGG + Intergenic
1192206816 X:69101854-69101876 AAGAGCAAGGAAAGGGGGGCCGG - Intergenic
1192567663 X:72178590-72178612 CACATCCCAGACAGGGCGGCGGG - Intergenic
1193046863 X:77063106-77063128 CAGTGCCATGACAGGTGGGCAGG + Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193328952 X:80215106-80215128 CACATCCCAGACAGGGCGGCGGG - Intergenic
1197620196 X:128739277-128739299 CAGAGTCAGGACAGGGACCCAGG - Intergenic
1199717132 X:150514923-150514945 CAGAGCTAGGACAGAGGGGTCGG + Intergenic
1200102630 X:153695526-153695548 CAGAGCCTGGAGAGGTGGGCAGG - Exonic
1200110216 X:153737131-153737153 CAGAGACAGCACAGCGGGGCTGG - Intronic
1200242831 X:154506782-154506804 CAGTGCCAGGACCGGGCCGAGGG - Exonic
1200374803 X:155768207-155768229 CAGAGACAGCACAGGATGGCTGG - Intronic
1201335832 Y:12878952-12878974 CACCTCCAGGACAGGGCGGCTGG - Intergenic