ID: 950541016

View in Genome Browser
Species Human (GRCh38)
Location 3:13613021-13613043
Sequence TGGAGCTAGATGACCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950541016 Original CRISPR TGGAGCTAGATGACCTAGGA TGG Intronic
900686570 1:3952257-3952279 TGGATGGAGATGACCCAGGAAGG + Intergenic
902885678 1:19403087-19403109 GGGAGCCAGATAACCCAGGATGG - Intronic
905732401 1:40305855-40305877 TGGAACCAGATGAGCTGGGACGG + Intronic
907267509 1:53271823-53271845 TGGAGCCAGCTGCCCCAGGAGGG - Intronic
907859855 1:58342293-58342315 TGGAGGGAGATGAACTTGGAAGG + Intronic
910757394 1:90707482-90707504 TGGAGCTAGGTAACCTGGGCTGG - Intergenic
911302530 1:96192700-96192722 TGGAGCTAGAGCAGCTGGGATGG - Intergenic
912971649 1:114289435-114289457 CGCAGCCAGATGAACTAGGAAGG - Intergenic
913260979 1:116997885-116997907 AGGAGCTGGATGGTCTAGGATGG - Intergenic
913654593 1:120948875-120948897 TGGGGCTGGATGGTCTAGGATGG + Intergenic
914456791 1:147843893-147843915 TGGAATTAGAAGGCCTAGGAAGG + Intergenic
914520282 1:148409013-148409035 TGGGGCTGGATGGTCTAGGATGG + Intergenic
914644789 1:149643037-149643059 TGGGGCTGGATGGTCTAGGATGG + Intergenic
917029329 1:170671777-170671799 TGGGGCCAGATGACCGTGGATGG + Intronic
918726601 1:187933446-187933468 TGGATTTAGATGACCCAGAAAGG - Intergenic
919522792 1:198609846-198609868 TGGAGGCAGATGACCTGGGCTGG - Intergenic
919561333 1:199123692-199123714 TGGCGGTAGATGGTCTAGGATGG + Intergenic
921130774 1:212217728-212217750 TGGGGCTGGATGGTCTAGGAGGG + Intergenic
921607716 1:217175038-217175060 TGGGGCTGGATGATCCAGGATGG + Intergenic
924441934 1:244093430-244093452 TGGAGGTGGATGACCTGAGATGG + Intergenic
924494461 1:244573549-244573571 TGCAACTACATGACCTAAGATGG + Intronic
1066492364 10:35906191-35906213 TGGACCTAGAAGACCCAGGATGG - Intergenic
1070174298 10:73957167-73957189 TGGAGGTGGAGGAACTAGGAGGG - Intergenic
1071756270 10:88543992-88544014 TAGAGCCAGATGGCCTAGGAAGG + Intronic
1074901884 10:117824130-117824152 TGGTGCTCCATGACCTGGGATGG - Intergenic
1075059689 10:119247115-119247137 TGGAGTTGGACGCCCTAGGACGG - Intronic
1078223199 11:9369012-9369034 TAGAACAAGATGACCTAAGATGG - Intergenic
1079295503 11:19229770-19229792 TGCAGGTAGATGGCATAGGATGG + Exonic
1079754558 11:24240118-24240140 AGGAGCTATATGACTCAGGATGG + Intergenic
1081522874 11:43899604-43899626 TGGAGCTGGCTGTCCGAGGAGGG - Intronic
1085386488 11:76161044-76161066 TGGAGCTGCATGACCCAGTACGG + Intergenic
1089000505 11:115048080-115048102 TAGAGCCAGATTACCTAGGCTGG + Intergenic
1090175745 11:124647829-124647851 GGTGGCTGGATGACCTAGGATGG - Intronic
1091813109 12:3416122-3416144 TGGAGCGAGGAGACCTAGGCAGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095459438 12:42426884-42426906 TGGTGGTAGATGAGCTGGGAAGG + Intronic
1096259342 12:50081251-50081273 TTGTGCTTAATGACCTAGGACGG - Exonic
1096961551 12:55583443-55583465 TAGAGGTGGATGACCTAGGTGGG - Intergenic
1098538431 12:71622326-71622348 TGGAGCTAGATGTCGAAGCATGG - Intronic
1099363604 12:81739964-81739986 TGGGGCTTCTTGACCTAGGAGGG + Intronic
1100721882 12:97368045-97368067 TGGGGCTGGATGGTCTAGGATGG + Intergenic
1101589150 12:106111002-106111024 CAGAGCTTGGTGACCTAGGAAGG + Intronic
1101805422 12:108059440-108059462 TGGGGCTGGCTGATCTAGGATGG + Intergenic
1102799768 12:115721951-115721973 TAGGACTAGATGACCTATGAAGG + Intergenic
1104117491 12:125763885-125763907 TGGAGCTAGATGATTGATGATGG - Intergenic
1105848831 13:24316697-24316719 TGCATCTATATGACCTAGGTTGG + Intronic
1114560043 14:23583021-23583043 TGGAGCTAGGTGTCCAAAGATGG + Intergenic
1115857351 14:37644845-37644867 TAGAGTTAGATGACCTAGGTTGG + Intronic
1116122887 14:40743079-40743101 AGGAGCTAGAAAACCTAGGTAGG + Intergenic
1116804663 14:49481227-49481249 TGGTGATAGCTGATCTAGGATGG - Intergenic
1118919620 14:70138177-70138199 TGGAGCCAGCAGCCCTAGGATGG + Intronic
1122260913 14:100522563-100522585 TAGAGCTAGAGTCCCTAGGATGG - Intronic
1126469481 15:48992691-48992713 TGAAGCCAGATGACCTGGAATGG - Exonic
1127901112 15:63341620-63341642 TGGATCTAGAGGAGCTTGGATGG + Intronic
1128724362 15:69976823-69976845 TGGGGCTGGGTGATCTAGGATGG + Intergenic
1128964080 15:72040096-72040118 TGGAGCTTGATGGCCCAGGCAGG - Intronic
1131342162 15:91612424-91612446 TGGAGCAAGATGAGATAGGAGGG - Intergenic
1131705025 15:94984468-94984490 GGGAGCTAAATGACGCAGGAAGG + Intergenic
1132830966 16:1928136-1928158 AGGAGCTCCTTGACCTAGGATGG + Intergenic
1135038463 16:19098196-19098218 TGGAGCTGAGTGATCTAGGATGG - Intergenic
1136112741 16:28075059-28075081 TGGAGGGAGCTGACCTAGGAAGG + Intergenic
1136559258 16:31029249-31029271 GGGAGCCAGATGACCTGGGTTGG - Intergenic
1137986742 16:53115218-53115240 TCAACCTAGATGACCTAAGAAGG + Intronic
1140506020 16:75473327-75473349 TGGAGCTGGCTGGTCTAGGATGG + Exonic
1144769184 17:17749830-17749852 TGGAGCTACATGCCCTATGCTGG - Intronic
1145998569 17:29118193-29118215 TGGAGATAGATGACCTCAAAGGG + Intronic
1146523860 17:33549192-33549214 TGGAGCAAGAAGACCTCTGAAGG + Intronic
1152220624 17:79063230-79063252 TGGAGCCAGGTGGCCTATGATGG + Intergenic
1152348516 17:79769704-79769726 TGGGGCTGGATGGCCTGGGATGG - Intergenic
1156936871 18:42719926-42719948 TGGAGCTAGAGAGCCTAGAAGGG - Intergenic
1157682429 18:49617425-49617447 TGGTGCTAGATTACCTTGAAAGG - Intergenic
1158451136 18:57566493-57566515 TGGAGAGAGATGGCCTAGAAAGG - Exonic
1159028049 18:63204509-63204531 TGGGGCTAGATGGTCTAAGATGG - Intronic
1160443576 18:78911532-78911554 TGGAGCTGGAGGACCTGGGGTGG - Intergenic
1160443606 18:78911615-78911637 TGGAGCTGGAGGACCTGGGGTGG - Intergenic
1162435016 19:10653165-10653187 TGGAGCAAGAAGAGCAAGGAAGG - Intergenic
1166425196 19:42671140-42671162 TTTAGCTAGATGACCTAGGGAGG + Intronic
1166544991 19:43628852-43628874 TGGGGCTGGATGATCCAGGATGG - Intronic
925290253 2:2743338-2743360 TGGAGCTGGCTGGCCTAGGATGG + Intergenic
926449424 2:12984079-12984101 GGGAGGTAGATGCCCTGGGAGGG + Intergenic
927792050 2:26018010-26018032 TGGATACAGATGACATAGGATGG - Intergenic
928036152 2:27825391-27825413 AGGTTCTAGATGACCTAGAAGGG + Intronic
931227816 2:60349205-60349227 TGGAACAAGATGCCCAAGGATGG + Intergenic
935678922 2:105619509-105619531 GGGGTCTAGATGACTTAGGAAGG + Intergenic
936948157 2:117949896-117949918 TGGAGTTAGCAGACGTAGGAAGG + Intronic
937784182 2:125875939-125875961 TGGGTCTGGCTGACCTAGGATGG + Intergenic
942924691 2:181417842-181417864 TGGAGCCAGATGAAGAAGGAGGG - Intergenic
943266144 2:185735699-185735721 TAGGGCTAGATCATCTAGGATGG - Intergenic
946096857 2:217281879-217281901 GGGGGCTGGATGACTTAGGATGG + Intergenic
946224896 2:218259218-218259240 AGGAACTAGATGATCTAGGAAGG + Intergenic
946696053 2:222360348-222360370 GGGAGCTGGCTGATCTAGGATGG - Intergenic
946960500 2:224979925-224979947 TGGAGCCAGAACACCTAGGTTGG - Intronic
947170064 2:227301905-227301927 TGGAGCAAGAAGACCAAAGAAGG - Intronic
947490345 2:230589499-230589521 TGGAGAAAGATGACAAAGGAAGG + Intergenic
948433288 2:237934428-237934450 TGGGGCTGGATGGCCAAGGAGGG - Intergenic
1169487521 20:6045754-6045776 TGGGGCCAGATGATCTGGGATGG + Intronic
1172581130 20:36049915-36049937 TGGAGCTGGAAGACCTGAGAAGG - Intergenic
1173047475 20:39526283-39526305 AGGAGCTGGTTGATCTAGGATGG - Intergenic
1173071711 20:39774680-39774702 AAGAGTTAGATGACCTAAGATGG + Intergenic
1173408282 20:42786449-42786471 TAGAGCCAGAGGACCTGGGATGG + Intronic
1174528030 20:51189232-51189254 TGGGCTAAGATGACCTAGGAGGG + Intergenic
1175992670 20:62797178-62797200 TGGTCCCAGATGACCTTGGATGG - Exonic
1177099733 21:16885440-16885462 TGAAGCTGGATGGTCTAGGATGG + Intergenic
1178759988 21:35393102-35393124 TGGAGCTAGATGTCTTGGAAAGG + Intronic
1181573612 22:23780800-23780822 TGGAGCTGGATGTCCTGGGCAGG + Intronic
1184855943 22:47146812-47146834 TGCAGCTAGACGACAGAGGAGGG - Intronic
950541016 3:13613021-13613043 TGGAGCTAGATGACCTAGGATGG + Intronic
951928266 3:27934424-27934446 TGGAGCTAGGTGCCAAAGGATGG + Intergenic
955052416 3:55425417-55425439 TGGGGCTGGCTGATCTAGGATGG + Intergenic
958616720 3:96503021-96503043 AGGAGCTAGAGCATCTAGGAAGG - Intergenic
960582650 3:119294242-119294264 TGGAGCTAGAGGAAGTAGGTGGG - Intergenic
961841817 3:129720553-129720575 TGGACCTAGATGGTCTAAGATGG - Intronic
962417613 3:135197493-135197515 TTGAGCTAGATGAGCTTGAAAGG + Intronic
962715879 3:138125747-138125769 TGGAACTATATGAACCAGGAAGG - Intronic
967394576 3:188992612-188992634 TGGAGTTAAATGACTAAGGAAGG + Intronic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
970993466 4:22238734-22238756 TGTTGCTAGATGCCCCAGGAAGG - Intergenic
971068013 4:23057136-23057158 TGGACCTGGCTGATCTAGGATGG - Intergenic
971370957 4:26018420-26018442 TGGAGCTAGATGGTCTAGGAGGG + Intergenic
975326743 4:73067343-73067365 AGGAGCTAGATCATCAAGGAAGG - Intronic
975788994 4:77927076-77927098 TGTAAGTAGATGACCAAGGAGGG - Intronic
976718852 4:88151115-88151137 TGGGGCTAGAAGACATAGGGAGG + Intronic
980939430 4:139259512-139259534 TGGAGCTCGATGGTCTGGGATGG + Intergenic
983617919 4:169728384-169728406 TTTAACTAGATGACCTGGGATGG + Intergenic
983804129 4:171971917-171971939 TTCAGCTAGGTTACCTAGGACGG + Intronic
986039225 5:3971524-3971546 TGGAGTTGGATGATCAAGGATGG + Intergenic
987989235 5:25189984-25190006 TGGAGCTGGAAGACCTGAGAAGG - Intergenic
994030346 5:95134537-95134559 TGGGGCAGGATGGCCTAGGAAGG + Intronic
997346349 5:133195275-133195297 TGGAGTTAGATGACCAAGACTGG - Intergenic
997658745 5:135574479-135574501 TGGGGCTAGATGACCTGGTGGGG + Intronic
999528612 5:152436502-152436524 AGGATCTAGATGACTTAGCAAGG + Intergenic
1001253072 5:170163345-170163367 TGGAGCCAGATGGCCTTGGTCGG - Intergenic
1003474636 6:6470090-6470112 TGGAGCTAGCTGTTCTGGGATGG - Intergenic
1005134862 6:22556359-22556381 TGGACCAAGTTGACCTAGGTGGG + Intergenic
1005423975 6:25681985-25682007 TGGATCTAAATGACTTAGCAAGG + Exonic
1005512482 6:26522725-26522747 TGGAGCTCGAAGACCTGAGAAGG + Intergenic
1006788435 6:36683309-36683331 TGGAGCCAGATCACCTGGGCTGG - Intronic
1007238411 6:40407506-40407528 TGGTACCAGATGACCCAGGAAGG - Intronic
1009992353 6:70859281-70859303 AGGTGCTAGATGAACCAGGAAGG + Exonic
1014951826 6:127564984-127565006 TGAAGCTGGATGGCCTAGGATGG + Intronic
1017115946 6:150976383-150976405 TGGTGCTGGCTGACCTGGGAGGG - Intronic
1017174994 6:151494224-151494246 TGGGGATAGACGACCCAGGAGGG + Intronic
1018935363 6:168270724-168270746 GGGTGCTAGCTGTCCTAGGAGGG + Intergenic
1020279073 7:6641201-6641223 TCGAGCTGGATGAGCTAGGGTGG + Intronic
1021688139 7:23206924-23206946 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1021885263 7:25131481-25131503 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1021956996 7:25835210-25835232 TGGAGCTAGATGGTCTAGCATGG - Intergenic
1025233644 7:57219298-57219320 TGGAGCTGGAAGACCCCGGAAGG - Intergenic
1026744343 7:72999405-72999427 TGGAGGGAGATGACCCTGGAAGG + Intergenic
1027030449 7:74884078-74884100 TGGAGGGAGATGACCCTGGAAGG + Intergenic
1027099394 7:75365687-75365709 TGGAGGGAGATGACCCTGGAAGG - Intergenic
1029378648 7:100198210-100198232 TGGAGGGAGATGACCCTGGAAGG - Intronic
1034220239 7:149438783-149438805 GGGTGCTAGATGACCTAAGCTGG + Intronic
1034896117 7:154877620-154877642 TGGAGGTAGATGACGAAGCATGG - Intronic
1038780466 8:30565222-30565244 AGGAGAGAGATGTCCTAGGAAGG + Intronic
1043497376 8:80817266-80817288 GGGAGCTAACTGACCAAGGAAGG + Intronic
1043805513 8:84667870-84667892 TGGAGTTATATAACCTAGGGAGG + Intronic
1044809342 8:96041668-96041690 TTGAGCAAAATGACATAGGAAGG - Intergenic
1045030407 8:98129766-98129788 TAGAGCTAGGAGACCTAGGAAGG - Intronic
1049036591 8:140081108-140081130 TGGGGATAGATGGCATAGGATGG - Intronic
1051014243 9:12456473-12456495 TGGAGCTGGATGACTTAAGGAGG - Intergenic
1058349166 9:104000258-104000280 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1060474026 9:123971605-123971627 TGGAGCTGGAATACCAAGGAGGG + Intergenic
1186032926 X:5390273-5390295 TTGAGCAAGATTTCCTAGGATGG + Intergenic
1186296063 X:8149734-8149756 TGGAAGTAGATGGCCAAGGATGG - Intergenic
1188050128 X:25474408-25474430 AATGGCTAGATGACCTAGGAAGG - Intergenic
1188302382 X:28520924-28520946 TGAAGCTGAATGTCCTAGGATGG + Intergenic
1188354975 X:29179497-29179519 TGGAGCTATGTTACCTAGTATGG + Intronic
1188400042 X:29733000-29733022 TGGAGCAAGGTGGCCAAGGAAGG + Intronic
1193397482 X:81003190-81003212 AGGAGCTAGAAGACCTGAGAAGG - Intergenic