ID: 950541409

View in Genome Browser
Species Human (GRCh38)
Location 3:13615391-13615413
Sequence TGCCCAGGACAAATCCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950541409_950541414 -9 Left 950541409 3:13615391-13615413 CCCCTGTGGATTTGTCCTGGGCA 0: 1
1: 0
2: 0
3: 18
4: 175
Right 950541414 3:13615405-13615427 TCCTGGGCACTTCATGGAGTGGG 0: 1
1: 0
2: 1
3: 21
4: 208
950541409_950541413 -10 Left 950541409 3:13615391-13615413 CCCCTGTGGATTTGTCCTGGGCA 0: 1
1: 0
2: 0
3: 18
4: 175
Right 950541413 3:13615404-13615426 GTCCTGGGCACTTCATGGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 188
950541409_950541417 17 Left 950541409 3:13615391-13615413 CCCCTGTGGATTTGTCCTGGGCA 0: 1
1: 0
2: 0
3: 18
4: 175
Right 950541417 3:13615431-13615453 TAAAGCCACAGATGAGGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 209
950541409_950541416 11 Left 950541409 3:13615391-13615413 CCCCTGTGGATTTGTCCTGGGCA 0: 1
1: 0
2: 0
3: 18
4: 175
Right 950541416 3:13615425-13615447 GGGAATTAAAGCCACAGATGAGG 0: 1
1: 0
2: 3
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950541409 Original CRISPR TGCCCAGGACAAATCCACAG GGG (reversed) Intronic
904755193 1:32765159-32765181 TGCCCAGAGCAGAACCACAGTGG - Intronic
905470829 1:38190506-38190528 TACCCAGCACACTTCCACAGGGG + Intergenic
905603289 1:39272598-39272620 AGCCCTGGACTAATCAACAGAGG - Intronic
905989716 1:42325516-42325538 TGCCCAGGACACAGCAAAAGAGG + Intronic
906786856 1:48623608-48623630 AGCCCAAGACAAATTCACTGTGG - Intronic
906940814 1:50253495-50253517 AACCCTGGACAAAACCACAGTGG - Intergenic
908587998 1:65595059-65595081 TGACTATGACACATCCACAGGGG + Intronic
909924360 1:81421582-81421604 TGGGCAAGACAGATCCACAGAGG - Intronic
912420700 1:109540453-109540475 TGCCCAGCCCAAGGCCACAGAGG - Intronic
912632092 1:111254825-111254847 TGCCCATGGCAAATTCACACAGG + Intergenic
918145501 1:181752508-181752530 GCCCCAGGACAAAGCCACACAGG - Intronic
918766232 1:188487231-188487253 TGAGAAGGACAAATGCACAGAGG - Intergenic
1064977902 10:21137446-21137468 TGCCCAGGGCAAAACCAGATTGG - Intronic
1067467350 10:46510950-46510972 TGCCCAGGACAAGACTGCAGGGG - Intergenic
1067619836 10:47873655-47873677 TGCCCAGGACAAGACTGCAGGGG + Intergenic
1067804946 10:49385917-49385939 TCCCAAGGGCCAATCCACAGAGG + Intronic
1068514558 10:58009726-58009748 GGTCCAGAACAAATCCAAAGAGG + Intergenic
1069864296 10:71491981-71492003 TGCCCAGCACAGCTTCACAGTGG + Intronic
1071596662 10:86932882-86932904 TGCCCTTAACAAACCCACAGGGG - Intergenic
1073289804 10:102407989-102408011 TCCCCAGGCCAACTGCACAGAGG - Intronic
1074832974 10:117262853-117262875 TGGCCAGGACACATTCAAAGAGG - Intronic
1074973963 10:118565763-118565785 TACCCAGACCAAAACCACAGGGG + Intergenic
1075406016 10:122196129-122196151 TGGCCAGGGCAAGTACACAGTGG - Intronic
1076275728 10:129196843-129196865 TCCCCAACACAAATCCATAGTGG + Intergenic
1076431791 10:130409108-130409130 TGCTCAGGAGAAATCTACAAAGG - Intergenic
1080387846 11:31820099-31820121 TGCCCGGGACAAATGGAGAGCGG - Intronic
1083476449 11:62918744-62918766 CGCCCAGGACCAATCCCTAGGGG + Intronic
1084314539 11:68337459-68337481 TGCCCAGGCCTGATCCCCAGAGG - Intronic
1087047959 11:93859497-93859519 TGCCCATGACACAGCCTCAGGGG + Intergenic
1087414684 11:97839125-97839147 TGCCCAGTCTAAATCCCCAGGGG + Intergenic
1089014903 11:115157758-115157780 TTCCCAGGACAGAAGCACAGAGG - Intergenic
1089327909 11:117669904-117669926 TGGCAAGGACAAGACCACAGGGG + Intronic
1096222820 12:49842773-49842795 AGCCCAGGCCAGAACCACAGTGG + Intronic
1096387683 12:51205590-51205612 GGCACAGGCCAAATGCACAGAGG - Intronic
1097989882 12:65824069-65824091 TTCCCAGGACAACTGCCCAGGGG + Intergenic
1098361443 12:69658088-69658110 TTCCCAGAACACATCCAGAGTGG - Intronic
1098662573 12:73115197-73115219 TGCCTACAACAAATCCATAGAGG + Intergenic
1100464298 12:94831745-94831767 TGCCCAGGAGAAGTCCCCACAGG - Intergenic
1101403804 12:104411099-104411121 TGGCCAGGACAAGGCCACATAGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1103546915 12:121708800-121708822 TTCCCATTACAAATCCTCAGAGG + Intergenic
1104268744 12:127262915-127262937 TGCCCAGGAAGAATGCACAGGGG - Intergenic
1112682274 13:101780536-101780558 TGACCATGACAAGTCAACAGTGG - Intronic
1114082607 14:19214263-19214285 TGTCGAGGACAAGTACACAGAGG + Intergenic
1118109645 14:62702715-62702737 TTCCCAGTCCAAATCCTCAGTGG + Exonic
1119916866 14:78410407-78410429 TGCTCAGGAGTATTCCACAGTGG + Intronic
1126927246 15:53603480-53603502 TGGCCAGGGCAATTCCACAAGGG + Intronic
1130061318 15:80572200-80572222 GGGCCAGGGCAAATGCACAGGGG + Intronic
1130386587 15:83417352-83417374 AGCCCAGGACAAAGGCCCAGCGG + Intergenic
1133334962 16:5000988-5001010 AGCCCAGCACATATGCACAGTGG - Intronic
1134199603 16:12187191-12187213 TGCCCAGGGGACATGCACAGGGG - Intronic
1134558819 16:15189687-15189709 GGGCCAGGACAAAACCACAAGGG + Intergenic
1134919352 16:18101288-18101310 GGGCCAGGACAAAACCACAAGGG + Intergenic
1136411575 16:30080831-30080853 TGCCCAGGGCAGGCCCACAGTGG - Intronic
1136482189 16:30549027-30549049 TGTCCAGGATAAAAACACAGAGG + Intronic
1136683032 16:31978886-31978908 TCCCCAGGACATCTCCACTGGGG - Intergenic
1136783670 16:32922442-32922464 TCCCCAGGACATCTCCACTGGGG - Intergenic
1136886118 16:33931364-33931386 TCCCCAGGACATCTCCACTGGGG + Intergenic
1138263676 16:55644057-55644079 TGCGCAGGACAAAGGCAAAGGGG + Intergenic
1141135563 16:81462956-81462978 TGCCCAGGGAGTATCCACAGAGG + Intronic
1142127799 16:88418939-88418961 AGCCCAGGAGAAAAGCACAGGGG - Intergenic
1203086321 16_KI270728v1_random:1186443-1186465 TCCCCAGGACATCTCCACTGGGG - Intergenic
1142559917 17:803717-803739 TGCCAAGTACAAAGCCAAAGAGG - Exonic
1144247123 17:13378000-13378022 TGCCCACGAATAATCCAGAGAGG + Intergenic
1146654745 17:34628664-34628686 AGCCCAGGCCACATCCACGGTGG - Exonic
1147143939 17:38474595-38474617 TCCCCAGGACACCTCCACTGGGG - Intronic
1147986064 17:44308503-44308525 GGCCGAGGACCAATCCGCAGAGG - Intronic
1148124239 17:45228784-45228806 AGCCCAGCACAGAGCCACAGAGG - Intronic
1148399242 17:47339657-47339679 TGCCCAGGCTAAAAGCACAGTGG - Intronic
1151323490 17:73365328-73365350 TTCCCAGGACACATTCACTGAGG + Exonic
1151455433 17:74222884-74222906 GGCACAGGACAAACCCACATTGG - Intronic
1155169540 18:23257111-23257133 TGCTCAGGAGAAATCCACTTTGG - Intronic
1157305634 18:46515261-46515283 TGCCCATGACACATGCCCAGTGG + Intronic
1157847439 18:51017196-51017218 AGCCAAGGACAAAGCCACGGTGG - Intronic
1160988676 19:1851842-1851864 TCCCCAGGAAAAAACCACTGTGG - Intergenic
1162148724 19:8630140-8630162 TGCACAGTTCAAATCCACACTGG + Intergenic
1164561546 19:29295731-29295753 TGCCCAGGACATGGCCACACGGG + Intergenic
1164730756 19:30502472-30502494 TGTCCAGGACAAGTCCACTGAGG + Intronic
1165892267 19:39120656-39120678 TGCCCAGATCCAGTCCACAGTGG + Intergenic
926063126 2:9816854-9816876 TGCCCATGTCCAATCCACAGGGG + Intergenic
926787383 2:16531498-16531520 TACCCAGGACAAATCAGCATGGG + Intergenic
927179025 2:20430887-20430909 TGCCCAGGACAGACCAACAGAGG + Intergenic
927514055 2:23661661-23661683 TTCCCAGGACAAGTGCCCAGGGG - Intronic
928197269 2:29224890-29224912 TGCCCAGGACAGATGGGCAGAGG - Intronic
930048861 2:47198186-47198208 GGCCCAAGAGAAATCCACAAGGG - Intergenic
930406139 2:50958048-50958070 TGCGCAAGACAAATAAACAGAGG - Intronic
931247402 2:60503111-60503133 TTGCCAGGACAAATGCAGAGTGG - Intronic
931287068 2:60841183-60841205 TGCCCGGGACCCATCCACAGAGG + Intergenic
931926963 2:67084333-67084355 TGCTCAGGAAAAATCCACTGGGG + Intergenic
935802038 2:106707459-106707481 TGCACAGGACCAAGTCACAGAGG - Intergenic
936260845 2:110958755-110958777 TCCCCTGGACAATGCCACAGAGG + Intronic
937919801 2:127121029-127121051 GACCCAGGACCAATCCCCAGGGG - Intergenic
938161154 2:128985619-128985641 TTCCCAGGACAGAAACACAGTGG - Intergenic
940737360 2:157468420-157468442 AACCCAGGACTACTCCACAGAGG - Intronic
941540179 2:166772241-166772263 TGCCCATGACACATCCTCAGGGG - Intergenic
943174724 2:184456487-184456509 TTCCCATGACAAAACCACAAGGG - Intergenic
943816283 2:192260460-192260482 TGCTCAGGAGAAATTCACAGAGG - Intergenic
944885774 2:204061209-204061231 TGCTCTGGACAAATTCATAGAGG - Intergenic
1168833471 20:860455-860477 TGCCCAGAACTACTCCACAGAGG - Intergenic
1168841288 20:911621-911643 GCCCCAGGAGAGATCCACAGAGG + Intronic
1168976337 20:1968824-1968846 AGCCCAGGAGAAACCCACAGGGG + Intergenic
1169041403 20:2498474-2498496 TGCCAAGTAGAAAACCACAGAGG + Intronic
1171406543 20:24915655-24915677 TGCCAAGGGCAACTCCAGAGAGG + Intergenic
1172314192 20:33940842-33940864 TGCCCAGGACACCTGCAGAGAGG - Intergenic
1173926183 20:46783136-46783158 TGCCCTGGAGAAATACAGAGAGG - Intergenic
1175162460 20:57019144-57019166 TGCACAGGACAGCCCCACAGCGG - Intergenic
1176613950 21:9012025-9012047 TGTCGAGGACAAGTACACAGAGG + Intergenic
1176711253 21:10151864-10151886 TGTCGAGGACAAGTACACAGAGG - Intergenic
1177850781 21:26345680-26345702 AGGACAGGACAAATACACAGTGG + Intergenic
1180498170 22:15908407-15908429 TGTCGAGGACAAGTACACAGAGG - Intergenic
1181796112 22:25312279-25312301 TCCCCCAGATAAATCCACAGGGG - Intergenic
1181836656 22:25615889-25615911 TCCCCCAGATAAATCCACAGGGG - Intronic
1183273026 22:36873728-36873750 TGCTCAGGACAACCCCACAAGGG - Intronic
1183745424 22:39689005-39689027 TGGCCAGGACAAGTCAACATGGG + Exonic
1184434725 22:44463578-44463600 TGCTCAGGACAAATTCCCAGAGG - Intergenic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
955114664 3:55985682-55985704 TGCTCAGGAGAAATGCACTGGGG + Intronic
955327757 3:58022173-58022195 TGCCAAGGTCAGAGCCACAGAGG - Intronic
957934073 3:86920162-86920184 TCCTCAGGTCAAATCCAGAGTGG - Intergenic
959564964 3:107824775-107824797 TCCCCTGGAAAAATCCACTGGGG - Intergenic
959970034 3:112399485-112399507 TGCCCATGACACAGCCTCAGGGG + Intergenic
960954666 3:123023695-123023717 TCCCCCAGACAAACCCACAGGGG + Intronic
962410081 3:135133266-135133288 TGCCCAGCACAAAAGCAAAGAGG + Intronic
962481531 3:135802368-135802390 TTCCAAGGAAAAATCCACTGCGG - Intergenic
962852628 3:139319302-139319324 TTCCCAGGACAAAGCCATTGAGG - Intronic
966599147 3:181757978-181758000 TTCCTATGACAAATCCACAGAGG + Intergenic
967130995 3:186470588-186470610 GGCCAAGGACAGAGCCACAGTGG - Intergenic
968132281 3:196198656-196198678 TGCCCTGGAGAAAACCCCAGAGG + Intronic
968482045 4:837593-837615 TGCTCAGGGCAAAGGCACAGAGG - Intergenic
969222549 4:5770633-5770655 TGCCCTGGACACAACCCCAGGGG - Intronic
969370449 4:6727956-6727978 AGACAAGGACAAATACACAGAGG - Intergenic
974808252 4:66910729-66910751 TGTCCAGGACTAATACACATGGG - Intergenic
976106014 4:81618329-81618351 TGCCCTGGGCACATCCACATAGG - Intronic
976134867 4:81924818-81924840 TGCCATGGACAAAGGCACAGTGG + Intronic
977666574 4:99651588-99651610 TGCTCAGGCCACCTCCACAGCGG - Exonic
981032416 4:140138698-140138720 TGCCCAGTTCTAATCCACTGTGG - Intronic
983832066 4:172339718-172339740 TGGCCTGGACAAATCCCCAGTGG + Intronic
984756321 4:183328730-183328752 TCACCAGGACAGATCCAGAGGGG + Intergenic
985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG + Intergenic
985814329 5:2115334-2115356 TGCCCATGTCAAATCATCAGGGG + Intergenic
987347608 5:16992315-16992337 TGTCCTGGGCAATTCCACAGTGG - Intergenic
987510369 5:18829100-18829122 TGCACAGTGCAAAGCCACAGGGG + Intergenic
987841175 5:23224370-23224392 TGCTCACTACAAATCCTCAGTGG - Intergenic
990427889 5:55706544-55706566 TGCTCAGAACAAATACACATAGG - Intronic
995424979 5:112010957-112010979 TGTCAAAGACAAATCCAGAGAGG + Intergenic
999509730 5:152236784-152236806 AACCCAGCAGAAATCCACAGTGG - Intergenic
999981943 5:156966308-156966330 TGCTCAGGAATAATCCACAAAGG + Intergenic
1001382283 5:171312465-171312487 TCCCCAGGTCAAATCCACCTGGG + Intergenic
1002168958 5:177364633-177364655 TGCCCAGGACAGAGCCAGAGAGG + Intronic
1004005322 6:11632740-11632762 TGCCCAGGACAAGTCCTGAGTGG + Intergenic
1004825657 6:19417838-19417860 TGCTAAGCACAAATCAACAGAGG - Intergenic
1005399589 6:25417987-25418009 TGCACAGGACACATCCACCAGGG + Intronic
1006938073 6:37732339-37732361 TGTCCAGGACTGAACCACAGAGG - Intergenic
1014622408 6:123684730-123684752 TGCCCAGTTCAAATCCACTAAGG + Intergenic
1015800020 6:137051265-137051287 TGCTCAGGACAAATCAAAACAGG - Intergenic
1017787876 6:157771665-157771687 TGCCAGGGACATATCCAGAGTGG + Intronic
1018631957 6:165829235-165829257 TGCCCAGGGCAGCTCCACTGGGG - Intronic
1018973135 6:168542900-168542922 TGCCCAGTAAAACTCCTCAGGGG - Intronic
1022264136 7:28736862-28736884 TGGCCAGGAAAAACCCACAGAGG - Intronic
1022307591 7:29162162-29162184 TGCCTAGGATAAATGCCCAGAGG - Intronic
1026142568 7:67718788-67718810 TGCCCAGGACACAGCCTCAGGGG - Intergenic
1031167159 7:118243092-118243114 TGCCTAGGACAACTCCTCATGGG + Intergenic
1032548532 7:132763106-132763128 TGCCAAGGACAAGAACACAGAGG + Intergenic
1032695194 7:134329880-134329902 CTCCCAGGACAAACTCACAGTGG - Intergenic
1034163312 7:149007813-149007835 GGCCCAGGCCAAACCCACAGTGG + Intronic
1040565612 8:48564448-48564470 TGCCCAGGACACAGGCACATGGG - Intergenic
1041111487 8:54487102-54487124 TTCCCAGGTCAAAGTCACAGAGG - Intergenic
1042436382 8:68770930-68770952 TGCTAAGGACAAAAACACAGTGG - Intronic
1045007259 8:97927445-97927467 AGACCAGGCCAAATGCACAGTGG - Intronic
1047421145 8:124709399-124709421 TTCTCAGGTGAAATCCACAGTGG - Intronic
1048985512 8:139732692-139732714 TCCCCAGGAGGAATGCACAGTGG + Intronic
1053648243 9:40137555-40137577 TGTCGAGGACAAGTACACAGAGG - Intergenic
1053757495 9:41326286-41326308 TGTCGAGGACAAGTACACAGAGG + Intergenic
1054329217 9:63735498-63735520 TGTCGAGGACAAGTACACAGAGG - Intergenic
1054536340 9:66238615-66238637 TGTCGAGGACAAGTACACAGAGG + Intergenic
1054923362 9:70563910-70563932 TGCCTAAGAGAAAACCACAGAGG - Intronic
1057020100 9:91690753-91690775 GGCCCAGGACAGCTTCACAGTGG + Intronic
1059807222 9:117815478-117815500 CACCCAGGTCAAACCCACAGAGG - Intergenic
1060983275 9:127805800-127805822 GCCCCAGGGCAAAGCCACAGTGG - Intronic
1061604715 9:131700082-131700104 TGCTCAGGAGAAAACCACTGGGG + Intronic
1202796008 9_KI270719v1_random:120853-120875 TGTCGAGGACAAGTACACAGAGG - Intergenic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1185576534 X:1179010-1179032 AGCCCAGGCAAGATCCACAGAGG + Intergenic
1187076908 X:15944375-15944397 AGCCCAGGACAATTCTGCAGAGG + Intergenic
1187900672 X:24025043-24025065 TTCCCAGGACTTATCCAGAGGGG - Exonic
1189718612 X:43891285-43891307 TGCCCATAAAAAATCTACAGTGG + Intergenic
1189910795 X:45809072-45809094 TGCCCTGGACAAAGCCTCACAGG - Intergenic
1190442435 X:50488524-50488546 TGCCCAGGAGAAAAACAGAGTGG + Intergenic
1193640168 X:84002787-84002809 TGCCTTGGTCAAATCCAAAGAGG + Intergenic
1194620282 X:96162543-96162565 TGCCCAGGAGAAATCTGGAGAGG + Intergenic
1195062391 X:101208968-101208990 TCCCAAGGACATATACACAGTGG - Intergenic
1196720314 X:118847689-118847711 TTCACAGGAAAAATCCTCAGTGG - Intergenic
1199900350 X:152166591-152166613 AGCCCAGGGTAAAGCCACAGAGG - Exonic