ID: 950542419

View in Genome Browser
Species Human (GRCh38)
Location 3:13620385-13620407
Sequence AAGTGTCCCCGATGGGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950542413_950542419 0 Left 950542413 3:13620362-13620384 CCGGTTGTTTTAAGGGCAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 950542419 3:13620385-13620407 AAGTGTCCCCGATGGGGAGTGGG 0: 1
1: 0
2: 1
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950542419 Original CRISPR AAGTGTCCCCGATGGGGAGT GGG Intronic
902368475 1:15991786-15991808 ACGTGTGCCCAATGGGGACTGGG + Intergenic
902408411 1:16199108-16199130 AAGTGTCCCTGATGGGGCTTGGG - Intronic
902488586 1:16764338-16764360 ACGTGTCCCAGATGGTGACTGGG + Intronic
905277466 1:36827851-36827873 AAGTGTCAGTGATGGGGTGTGGG - Intronic
913336235 1:117710973-117710995 AAGTGGCACAGATGGGGTGTGGG + Intergenic
913385942 1:118258582-118258604 AAATGTACCAGATGGGGAGCAGG - Intergenic
916513609 1:165495418-165495440 AAGTCTGCCCCCTGGGGAGTTGG + Intergenic
918309870 1:183278258-183278280 ATGTGTTGCCGATGGGGAGAAGG - Intronic
919925584 1:202190252-202190274 AAGAGTCCCTGAAGTGGAGTTGG + Intergenic
923531851 1:234818178-234818200 ACGTGTCCCAGATGGTGACTGGG - Intergenic
1065826327 10:29574962-29574984 CAGTGTCCCTGGTGGGGTGTGGG + Intronic
1065951047 10:30651656-30651678 CAGTGTCCCTGGTGGGGTGTGGG - Intergenic
1065968460 10:30787137-30787159 AAGTGTCTCTGATGGAGAGTGGG - Intergenic
1078706306 11:13747274-13747296 AAATGGCCACCATGGGGAGTGGG - Intergenic
1079531727 11:21462484-21462506 AAGTCTCCCCTATTGGGAGGTGG + Intronic
1083199566 11:61112114-61112136 AAGTGCCACCTGTGGGGAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1096537211 12:52282737-52282759 AGGGGTCACCGATGGGGAGTGGG - Intronic
1097267441 12:57754634-57754656 AAGTGTGATCGATGGGGACTGGG - Intronic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1104593021 12:130099731-130099753 AAGTGTTCCTGGTGGGTAGTGGG + Intergenic
1104593027 12:130099758-130099780 AAGTGTTCCTGGTGGGTAGTGGG + Intergenic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1106353156 13:28954543-28954565 TAGTGGCCCATATGGGGAGTGGG + Intronic
1112478869 13:99755718-99755740 AAGTCTCCCAGAGGGTGAGTGGG + Intronic
1117107158 14:52409651-52409673 AACTGACCCAGATGAGGAGTGGG + Intergenic
1119857199 14:77909498-77909520 ATGTGGTCCCAATGGGGAGTTGG + Intronic
1126589548 15:50325193-50325215 AAGTGTACCCCATGGTAAGTGGG + Intronic
1130551226 15:84891043-84891065 AAGGGCCCAGGATGGGGAGTGGG + Intronic
1131393583 15:92069114-92069136 AAATGTCCCCTGGGGGGAGTGGG - Intronic
1132232252 15:100192903-100192925 AAGTGTGGCCCATGGGCAGTGGG - Intronic
1133367591 16:5223082-5223104 AAGTGTCCCTGATGGGAGTTCGG - Intergenic
1135288142 16:21211628-21211650 AGGTGCCCCCAATGGGGAGAGGG - Exonic
1137009542 16:35309292-35309314 AGGCGTCCCCGATGGGGAAAGGG + Intergenic
1138133713 16:54503316-54503338 AAGTGTCCCTGGATGGGAGTAGG - Intergenic
1140279926 16:73544782-73544804 AAGTGTCCCCCAGGTGGACTGGG - Intergenic
1142398251 16:89845231-89845253 GTGTGTCCCCGAGGGGGAGGTGG + Intronic
1142421854 16:89975752-89975774 ATGTTTCCCCGATGGGGGTTTGG - Intergenic
1144331169 17:14225291-14225313 AGGTGGCCCTGATGGGGTGTTGG - Intergenic
1147458703 17:40554733-40554755 AAGAGTCGCCTATGGGGAGAAGG + Exonic
1152293515 17:79453982-79454004 ATGTGCCCCCCATGGTGAGTTGG + Intronic
1153239419 18:3016908-3016930 AAGTATCCCCGACCTGGAGTTGG + Intergenic
1153295662 18:3543766-3543788 GAGTGGTCCCCATGGGGAGTCGG + Intronic
1156689200 18:39685512-39685534 AAGTGTCCTGGATTGGCAGTGGG + Intergenic
1157671249 18:49530685-49530707 AAGTGTCCCTTATGGGAAATGGG + Intergenic
1160855252 19:1214440-1214462 AAGTGTCCCCGTTGAGGTGGAGG + Intronic
1167445573 19:49535127-49535149 AAACGTCCCGGCTGGGGAGTGGG - Intronic
1167616446 19:50536932-50536954 AGGTGTCCCCTAGGAGGAGTTGG + Intronic
929922816 2:46184664-46184686 GAGGGCCCCCCATGGGGAGTGGG - Intronic
930862522 2:56089711-56089733 AACTGTCCTGGATGGGGAATGGG + Intergenic
937080402 2:119136253-119136275 AAGTGTCCTGGAGAGGGAGTGGG - Intergenic
937443966 2:121940961-121940983 AAGAGTCCCTCATGGTGAGTAGG + Intergenic
944414837 2:199470627-199470649 AAGTGCCCCCGAGGAGGATTGGG + Intronic
944454485 2:199878911-199878933 AGGTGCTCCCAATGGGGAGTGGG + Intergenic
946411410 2:219517077-219517099 TTGTGTCCCCGAGCGGGAGTTGG + Intronic
948203004 2:236143210-236143232 AGGAGTCCACGATGGGGAGCAGG + Intergenic
1171087874 20:22255073-22255095 AAGAGTCCCAGAGGGGGATTGGG - Intergenic
1172973154 20:38888161-38888183 TAGTGTCCACGGTGGGGATTAGG + Intronic
1179455173 21:41494366-41494388 CACTGTCCCGGATGGGGATTTGG + Exonic
1180018660 21:45104705-45104727 AAGCGTGCCCTCTGGGGAGTAGG + Intronic
1180043321 21:45291695-45291717 ATGGGTCCCCGGTGGGGGGTGGG - Intergenic
950021371 3:9789978-9790000 AAGTGTCACTGAGGGGGAGAAGG + Intronic
950351749 3:12361606-12361628 AAATGTCACTGCTGGGGAGTGGG - Intronic
950542419 3:13620385-13620407 AAGTGTCCCCGATGGGGAGTGGG + Intronic
950627833 3:14261121-14261143 ATGTGTCCACCATGGGGACTTGG - Intergenic
955956258 3:64293101-64293123 AAATGTCCCCGGTGTGGGGTAGG + Intronic
956456433 3:69425445-69425467 AACTTTCCCCCATGGGCAGTAGG - Intronic
961559596 3:127719351-127719373 AAATATCCTAGATGGGGAGTGGG + Intronic
964213583 3:154254811-154254833 ACGTGTCAGCGATGGTGAGTGGG + Exonic
968967723 4:3777465-3777487 AAGTGTCCAGGGTAGGGAGTGGG + Intergenic
969316480 4:6384204-6384226 TAGGGTCCCCGATGGGGCGCTGG + Intronic
969367271 4:6703791-6703813 AGGTGTCCTGGTTGGGGAGTGGG - Intergenic
969836852 4:9849234-9849256 AAGTGTCCCCGATGCAGAGTGGG + Intronic
973942378 4:55924002-55924024 CAGAGTCTCAGATGGGGAGTTGG - Intergenic
983499864 4:168486916-168486938 AAGTGACCCTGATGGGGACAGGG + Intronic
984761477 4:183366494-183366516 AAGTGTGCGCGATGAGGAGAGGG + Intergenic
985767210 5:1786304-1786326 AAGGGACCCCAAGGGGGAGTTGG + Intergenic
995708741 5:115013318-115013340 GAGTGTTCCAGATGGGGAGCTGG + Intergenic
1003512096 6:6790236-6790258 ATGTGTCCCGCATGGGGAATAGG - Intergenic
1006417682 6:33914313-33914335 AAGTGACTGCGATGGGGAGCTGG - Intergenic
1016911261 6:149201356-149201378 AGGTGTCCCCCCTGGGGACTGGG + Intergenic
1018879212 6:167859439-167859461 CAGTTTCCTCCATGGGGAGTAGG + Intronic
1019602192 7:1890260-1890282 AAGTGTGGCCTATGGGGAGGAGG + Intronic
1019614277 7:1952018-1952040 AAATGTCACCGATGGGGGCTTGG - Intronic
1027887929 7:83933342-83933364 AAGTGTTGCTGATGAGGAGTGGG - Intergenic
1029540723 7:101180467-101180489 CTGTGTCCCGGCTGGGGAGTGGG + Intergenic
1046018893 8:108639789-108639811 AAGTTTCCTCGATCGGGAATAGG + Intronic
1050311268 9:4355199-4355221 AAGTGTCCTGGATTTGGAGTTGG + Intergenic
1053559061 9:39170650-39170672 AACAGGCCCTGATGGGGAGTGGG + Intronic
1053823181 9:41990891-41990913 AACAGGCCCTGATGGGGAGTGGG + Intronic
1054138050 9:61448296-61448318 AACAGGCCCTGATGGGGAGTGGG - Intergenic
1060510574 9:124229123-124229145 GGGTGGCCCCGATGGGGAGTTGG + Intergenic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1187774128 X:22736083-22736105 GAGTGTCCACTTTGGGGAGTGGG + Intergenic
1190483510 X:50901120-50901142 ATGGGTCCCTTATGGGGAGTTGG - Intergenic
1200418345 Y:2935809-2935831 AAATGTCCGCGAAGGGGAGGAGG + Intronic