ID: 950547703

View in Genome Browser
Species Human (GRCh38)
Location 3:13648434-13648456
Sequence CTGGGGCTGCAGCCACGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950547703_950547716 9 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547716 3:13648466-13648488 TCTGCCTGCAACTAATGGAGGGG No data
950547703_950547712 4 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547712 3:13648461-13648483 GCCGCTCTGCCTGCAACTAATGG No data
950547703_950547720 26 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547720 3:13648483-13648505 GAGGGGTGGATTTGGACAAGTGG No data
950547703_950547715 8 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547715 3:13648465-13648487 CTCTGCCTGCAACTAATGGAGGG No data
950547703_950547714 7 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data
950547703_950547719 18 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547719 3:13648475-13648497 AACTAATGGAGGGGTGGATTTGG No data
950547703_950547717 12 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547717 3:13648469-13648491 GCCTGCAACTAATGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950547703 Original CRISPR CTGGGGCTGCAGCCACGAGG GGG (reversed) Intergenic
No off target data available for this crispr