ID: 950547706

View in Genome Browser
Species Human (GRCh38)
Location 3:13648437-13648459
Sequence AGGCTGGGGCTGCAGCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950547706_950547712 1 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547712 3:13648461-13648483 GCCGCTCTGCCTGCAACTAATGG No data
950547706_950547720 23 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547720 3:13648483-13648505 GAGGGGTGGATTTGGACAAGTGG No data
950547706_950547714 4 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data
950547706_950547722 29 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547722 3:13648489-13648511 TGGATTTGGACAAGTGGCACGGG No data
950547706_950547719 15 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547719 3:13648475-13648497 AACTAATGGAGGGGTGGATTTGG No data
950547706_950547723 30 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547723 3:13648490-13648512 GGATTTGGACAAGTGGCACGGGG No data
950547706_950547716 6 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547716 3:13648466-13648488 TCTGCCTGCAACTAATGGAGGGG No data
950547706_950547721 28 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547721 3:13648488-13648510 GTGGATTTGGACAAGTGGCACGG No data
950547706_950547715 5 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547715 3:13648465-13648487 CTCTGCCTGCAACTAATGGAGGG No data
950547706_950547717 9 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547717 3:13648469-13648491 GCCTGCAACTAATGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950547706 Original CRISPR AGGCTGGGGCTGCAGCCACG AGG (reversed) Intergenic
No off target data available for this crispr