ID: 950547708

View in Genome Browser
Species Human (GRCh38)
Location 3:13648451-13648473
Sequence CAGGCAGAGCGGCCAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950547708_950547724 17 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547724 3:13648491-13648513 GATTTGGACAAGTGGCACGGGGG No data
950547708_950547723 16 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547723 3:13648490-13648512 GGATTTGGACAAGTGGCACGGGG No data
950547708_950547725 22 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547725 3:13648496-13648518 GGACAAGTGGCACGGGGGAAAGG No data
950547708_950547716 -8 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547716 3:13648466-13648488 TCTGCCTGCAACTAATGGAGGGG No data
950547708_950547717 -5 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547717 3:13648469-13648491 GCCTGCAACTAATGGAGGGGTGG No data
950547708_950547722 15 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547722 3:13648489-13648511 TGGATTTGGACAAGTGGCACGGG No data
950547708_950547719 1 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547719 3:13648475-13648497 AACTAATGGAGGGGTGGATTTGG No data
950547708_950547715 -9 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547715 3:13648465-13648487 CTCTGCCTGCAACTAATGGAGGG No data
950547708_950547720 9 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547720 3:13648483-13648505 GAGGGGTGGATTTGGACAAGTGG No data
950547708_950547721 14 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547721 3:13648488-13648510 GTGGATTTGGACAAGTGGCACGG No data
950547708_950547714 -10 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950547708 Original CRISPR CAGGCAGAGCGGCCAGGCTG GGG (reversed) Intergenic
No off target data available for this crispr