ID: 950547714

View in Genome Browser
Species Human (GRCh38)
Location 3:13648464-13648486
Sequence GCTCTGCCTGCAACTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950547704_950547714 6 Left 950547704 3:13648435-13648457 CCCCTCGTGGCTGCAGCCCCAGC No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data
950547705_950547714 5 Left 950547705 3:13648436-13648458 CCCTCGTGGCTGCAGCCCCAGCC No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data
950547706_950547714 4 Left 950547706 3:13648437-13648459 CCTCGTGGCTGCAGCCCCAGCCT No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data
950547708_950547714 -10 Left 950547708 3:13648451-13648473 CCCCAGCCTGGCCGCTCTGCCTG No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data
950547703_950547714 7 Left 950547703 3:13648434-13648456 CCCCCTCGTGGCTGCAGCCCCAG No data
Right 950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950547714 Original CRISPR GCTCTGCCTGCAACTAATGG AGG Intergenic
No off target data available for this crispr