ID: 950548218

View in Genome Browser
Species Human (GRCh38)
Location 3:13651656-13651678
Sequence CAGGCTGAACACAGGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950548218_950548224 20 Left 950548218 3:13651656-13651678 CCTACAGCCCTGTGTTCAGCCTG No data
Right 950548224 3:13651699-13651721 GACCTTGCCCAGCCATTTCCTGG No data
950548218_950548225 21 Left 950548218 3:13651656-13651678 CCTACAGCCCTGTGTTCAGCCTG No data
Right 950548225 3:13651700-13651722 ACCTTGCCCAGCCATTTCCTGGG No data
950548218_950548227 22 Left 950548218 3:13651656-13651678 CCTACAGCCCTGTGTTCAGCCTG No data
Right 950548227 3:13651701-13651723 CCTTGCCCAGCCATTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950548218 Original CRISPR CAGGCTGAACACAGGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr