ID: 950549130

View in Genome Browser
Species Human (GRCh38)
Location 3:13655640-13655662
Sequence ACAGGCACTAATGGCACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950549130_950549141 22 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549141 3:13655685-13655707 GGACCTGCCAAGCTAACCCTAGG No data
950549130_950549135 -7 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549135 3:13655656-13655678 TGCCTGTGTGAGTGGGACCTGGG No data
950549130_950549138 0 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549138 3:13655663-13655685 GTGAGTGGGACCTGGGTTGGAGG No data
950549130_950549143 24 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549143 3:13655687-13655709 ACCTGCCAAGCTAACCCTAGGGG No data
950549130_950549137 -3 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549137 3:13655660-13655682 TGTGTGAGTGGGACCTGGGTTGG No data
950549130_950549139 1 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549139 3:13655664-13655686 TGAGTGGGACCTGGGTTGGAGGG No data
950549130_950549134 -8 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549134 3:13655655-13655677 GTGCCTGTGTGAGTGGGACCTGG No data
950549130_950549142 23 Left 950549130 3:13655640-13655662 CCATTAGTGCCATTAGTGCCTGT No data
Right 950549142 3:13655686-13655708 GACCTGCCAAGCTAACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950549130 Original CRISPR ACAGGCACTAATGGCACTAA TGG (reversed) Intergenic
No off target data available for this crispr