ID: 950549968

View in Genome Browser
Species Human (GRCh38)
Location 3:13660280-13660302
Sequence CTGTGAAAGGGGCAGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950549956_950549968 29 Left 950549956 3:13660228-13660250 CCAGTCACCTGAGATGTCCAAGC No data
Right 950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG No data
950549960_950549968 2 Left 950549960 3:13660255-13660277 CCTGGCTGACCATCTGCCAGTAA No data
Right 950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG No data
950549955_950549968 30 Left 950549955 3:13660227-13660249 CCCAGTCACCTGAGATGTCCAAG No data
Right 950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG No data
950549957_950549968 22 Left 950549957 3:13660235-13660257 CCTGAGATGTCCAAGCAGCACCT No data
Right 950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG No data
950549961_950549968 -7 Left 950549961 3:13660264-13660286 CCATCTGCCAGTAATGCTGTGAA No data
Right 950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG No data
950549959_950549968 12 Left 950549959 3:13660245-13660267 CCAAGCAGCACCTGGCTGACCAT No data
Right 950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950549968 Original CRISPR CTGTGAAAGGGGCAGGTGTT GGG Intergenic
No off target data available for this crispr