ID: 950550398

View in Genome Browser
Species Human (GRCh38)
Location 3:13662645-13662667
Sequence CCCACGGCTGTGCCCACGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950550389_950550398 16 Left 950550389 3:13662606-13662628 CCGTGTGTGGCGTGGTGGGAAAG No data
Right 950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG No data
950550384_950550398 25 Left 950550384 3:13662597-13662619 CCTAGTGGCCCGTGTGTGGCGTG No data
Right 950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG No data
950550388_950550398 17 Left 950550388 3:13662605-13662627 CCCGTGTGTGGCGTGGTGGGAAA No data
Right 950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG No data
950550382_950550398 30 Left 950550382 3:13662592-13662614 CCGTTCCTAGTGGCCCGTGTGTG No data
Right 950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950550398 Original CRISPR CCCACGGCTGTGCCCACGCT AGG Intergenic
No off target data available for this crispr