ID: 950554189

View in Genome Browser
Species Human (GRCh38)
Location 3:13685385-13685407
Sequence GTGGAAACCCAAATTTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950554189_950554194 13 Left 950554189 3:13685385-13685407 CCCATACAAATTTGGGTTTCCAC No data
Right 950554194 3:13685421-13685443 ATTAGAAACTTTGGTTGTACTGG No data
950554189_950554193 4 Left 950554189 3:13685385-13685407 CCCATACAAATTTGGGTTTCCAC No data
Right 950554193 3:13685412-13685434 TCTTGAAGAATTAGAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950554189 Original CRISPR GTGGAAACCCAAATTTGTAT GGG (reversed) Intergenic
No off target data available for this crispr