ID: 950560565

View in Genome Browser
Species Human (GRCh38)
Location 3:13719185-13719207
Sequence CTTCTGTTTACAGAAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950560565_950560571 30 Left 950560565 3:13719185-13719207 CCACCACCTTCTGTAAACAGAAG No data
Right 950560571 3:13719238-13719260 GCAAGACCATTACGTTCCAGTGG No data
950560565_950560569 0 Left 950560565 3:13719185-13719207 CCACCACCTTCTGTAAACAGAAG No data
Right 950560569 3:13719208-13719230 GTAGCTATGACAATAGCACATGG No data
950560565_950560570 6 Left 950560565 3:13719185-13719207 CCACCACCTTCTGTAAACAGAAG No data
Right 950560570 3:13719214-13719236 ATGACAATAGCACATGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950560565 Original CRISPR CTTCTGTTTACAGAAGGTGG TGG (reversed) Intergenic
No off target data available for this crispr