ID: 950560568

View in Genome Browser
Species Human (GRCh38)
Location 3:13719191-13719213
Sequence AGCTACCTTCTGTTTACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950560568_950560569 -6 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560569 3:13719208-13719230 GTAGCTATGACAATAGCACATGG No data
950560568_950560572 25 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560572 3:13719239-13719261 CAAGACCATTACGTTCCAGTGGG No data
950560568_950560570 0 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560570 3:13719214-13719236 ATGACAATAGCACATGGTGATGG No data
950560568_950560573 26 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560573 3:13719240-13719262 AAGACCATTACGTTCCAGTGGGG No data
950560568_950560571 24 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560571 3:13719238-13719260 GCAAGACCATTACGTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950560568 Original CRISPR AGCTACCTTCTGTTTACAGA AGG (reversed) Intergenic
No off target data available for this crispr