ID: 950560569

View in Genome Browser
Species Human (GRCh38)
Location 3:13719208-13719230
Sequence GTAGCTATGACAATAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950560568_950560569 -6 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560569 3:13719208-13719230 GTAGCTATGACAATAGCACATGG No data
950560565_950560569 0 Left 950560565 3:13719185-13719207 CCACCACCTTCTGTAAACAGAAG No data
Right 950560569 3:13719208-13719230 GTAGCTATGACAATAGCACATGG No data
950560567_950560569 -3 Left 950560567 3:13719188-13719210 CCACCTTCTGTAAACAGAAGGTA No data
Right 950560569 3:13719208-13719230 GTAGCTATGACAATAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950560569 Original CRISPR GTAGCTATGACAATAGCACA TGG Intergenic
No off target data available for this crispr