ID: 950560572

View in Genome Browser
Species Human (GRCh38)
Location 3:13719239-13719261
Sequence CAAGACCATTACGTTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950560568_950560572 25 Left 950560568 3:13719191-13719213 CCTTCTGTAAACAGAAGGTAGCT No data
Right 950560572 3:13719239-13719261 CAAGACCATTACGTTCCAGTGGG No data
950560567_950560572 28 Left 950560567 3:13719188-13719210 CCACCTTCTGTAAACAGAAGGTA No data
Right 950560572 3:13719239-13719261 CAAGACCATTACGTTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950560572 Original CRISPR CAAGACCATTACGTTCCAGT GGG Intergenic
No off target data available for this crispr