ID: 950564626

View in Genome Browser
Species Human (GRCh38)
Location 3:13761013-13761035
Sequence ATACTTTACCAGGCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950564626_950564631 20 Left 950564626 3:13761013-13761035 CCCGCTGGGGCCTGGTAAAGTAT No data
Right 950564631 3:13761056-13761078 AAATATGATGATTCCTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950564626 Original CRISPR ATACTTTACCAGGCCCCAGC GGG (reversed) Intergenic
No off target data available for this crispr