ID: 950572677

View in Genome Browser
Species Human (GRCh38)
Location 3:13811743-13811765
Sequence CAGGCGGGTGAGGGTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950572677_950572692 13 Left 950572677 3:13811743-13811765 CCCAAGACACCCTCACCCGCCTG No data
Right 950572692 3:13811779-13811801 AGCAATGCACACACTGGGCCAGG No data
950572677_950572686 7 Left 950572677 3:13811743-13811765 CCCAAGACACCCTCACCCGCCTG No data
Right 950572686 3:13811773-13811795 GCCCCCAGCAATGCACACACTGG No data
950572677_950572693 17 Left 950572677 3:13811743-13811765 CCCAAGACACCCTCACCCGCCTG No data
Right 950572693 3:13811783-13811805 ATGCACACACTGGGCCAGGCAGG No data
950572677_950572688 8 Left 950572677 3:13811743-13811765 CCCAAGACACCCTCACCCGCCTG No data
Right 950572688 3:13811774-13811796 CCCCCAGCAATGCACACACTGGG No data
950572677_950572694 23 Left 950572677 3:13811743-13811765 CCCAAGACACCCTCACCCGCCTG No data
Right 950572694 3:13811789-13811811 ACACTGGGCCAGGCAGGTGCAGG No data
950572677_950572695 24 Left 950572677 3:13811743-13811765 CCCAAGACACCCTCACCCGCCTG No data
Right 950572695 3:13811790-13811812 CACTGGGCCAGGCAGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950572677 Original CRISPR CAGGCGGGTGAGGGTGTCTT GGG (reversed) Intergenic
No off target data available for this crispr