ID: 950573712

View in Genome Browser
Species Human (GRCh38)
Location 3:13817988-13818010
Sequence CAGCTGTGCAAGGGGCCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950573706_950573712 5 Left 950573706 3:13817960-13817982 CCCACTTGGCAAACAGAACTCAA 0: 1
1: 0
2: 2
3: 13
4: 190
Right 950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG 0: 1
1: 0
2: 6
3: 20
4: 279
950573702_950573712 30 Left 950573702 3:13817935-13817957 CCCAGGCATCCAGGGGCAGCTTG 0: 1
1: 0
2: 1
3: 29
4: 402
Right 950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG 0: 1
1: 0
2: 6
3: 20
4: 279
950573703_950573712 29 Left 950573703 3:13817936-13817958 CCAGGCATCCAGGGGCAGCTTGT 0: 1
1: 0
2: 4
3: 28
4: 208
Right 950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG 0: 1
1: 0
2: 6
3: 20
4: 279
950573707_950573712 4 Left 950573707 3:13817961-13817983 CCACTTGGCAAACAGAACTCAAG 0: 1
1: 0
2: 0
3: 21
4: 191
Right 950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG 0: 1
1: 0
2: 6
3: 20
4: 279
950573704_950573712 21 Left 950573704 3:13817944-13817966 CCAGGGGCAGCTTGTGCCCACTT 0: 1
1: 0
2: 0
3: 13
4: 172
Right 950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG 0: 1
1: 0
2: 6
3: 20
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950573712 Original CRISPR CAGCTGTGCAAGGGGCCCCA TGG Exonic
900186556 1:1335803-1335825 CAGCTGTGCCCAGGCCCCCAGGG - Exonic
900589161 1:3452126-3452148 CAGCTGGGAAAGGGCCCCAAGGG - Intergenic
900791680 1:4684857-4684879 GAGCTGTCAAAGGGGCCACAAGG + Intronic
902753040 1:18530752-18530774 CAGATGGGCAATGGTCCCCAAGG + Intergenic
902993285 1:20204641-20204663 CAGCTCTGAAAGGGACCCCGGGG - Intergenic
903217469 1:21851424-21851446 CATCTGTGCAATGGGGTCCAGGG + Intronic
904237489 1:29124331-29124353 CATCTGTGCAATGGGCACCAAGG + Intergenic
906128117 1:43439878-43439900 CAGCTCAGAATGGGGCCCCACGG + Exonic
906381465 1:45334694-45334716 TAGCTGAGCAAGTGGCCTCAAGG + Intronic
906660092 1:47575812-47575834 CATCAGTGCAGGGGGCCCTAGGG - Intergenic
908081323 1:60582016-60582038 CAGCTGTGCTAGGGACGTCAGGG + Intergenic
908437879 1:64124484-64124506 CAGCTGAGCAATGCTCCCCATGG - Intronic
908574908 1:65449405-65449427 CAGCTGTGCAGGGGAGCACAGGG - Intronic
910445577 1:87296317-87296339 CAGTTGTGCAAGTGTCCTCATGG - Intergenic
911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG + Intronic
911139402 1:94482605-94482627 CAGATGTGCATGGGTCCACAAGG - Intronic
912935851 1:114003179-114003201 CAGCTGTGCAGCAGACCCCAAGG + Intergenic
913089868 1:115469358-115469380 CTGTTGTCCAAGAGGCCCCAGGG - Intergenic
913260201 1:116990855-116990877 CAGCTGTTCCAGGGGCCCGCAGG - Intergenic
915164488 1:153941089-153941111 CATCTGGGGAAGGGTCCCCAGGG - Intronic
915300314 1:154947846-154947868 CAGCTGTTCAGGGTGCCCCTTGG - Intronic
915489164 1:156241986-156242008 CTGCTGGGCCAGGGGCCCCTGGG - Exonic
916141726 1:161705692-161705714 CTTCTGTGCAGGTGGCCCCAGGG - Intergenic
918046561 1:180945102-180945124 CCGCTGTGCAAGGCCCCCCAAGG - Intronic
920366572 1:205451058-205451080 CAGCAGCCCAAGGGGCCCAAGGG + Intronic
923085951 1:230703780-230703802 CAGATGTGCATGGTGCCACATGG + Intronic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
923511252 1:234655718-234655740 GGGCTGTGCAGGTGGCCCCAAGG + Intergenic
924271384 1:242336658-242336680 CATCTGGGCAAGGGGACACAGGG + Intronic
1063010774 10:2019992-2020014 CAGCCTTGCAAGGAGCCTCAGGG + Intergenic
1063224725 10:4005068-4005090 CAGCTGCGGGAGGGGCACCACGG - Intergenic
1065877099 10:30006933-30006955 CAGCTCAGCAAGGGACTCCACGG + Intergenic
1066713281 10:38259470-38259492 CATCTGGGCAAGGGGACACAGGG - Intergenic
1067083443 10:43226095-43226117 CAGTGGTGCCAGGGGCCGCAGGG + Intronic
1067479393 10:46585248-46585270 AAGGTGTTTAAGGGGCCCCAGGG + Intronic
1067615345 10:47756550-47756572 AAGGTGTTTAAGGGGCCCCAGGG - Intergenic
1070882807 10:79864206-79864228 AAGCTGTGCAAGTGTCCCCAAGG - Intergenic
1071630747 10:87216501-87216523 AAGGTGTTTAAGGGGCCCCAGGG - Intergenic
1071649372 10:87380508-87380530 AAGCTGTGCAAGTGTCCCCAAGG - Intergenic
1072633478 10:97163206-97163228 CAGCTGTGAAAGTGGTCACAAGG - Intronic
1072930691 10:99659510-99659532 CGGCTGGGCAAGGGGCCGCGGGG + Exonic
1073125886 10:101148883-101148905 CAGCACTACAAGGGACCCCAAGG + Intergenic
1075872016 10:125777989-125778011 CAGCAGTGCAGGGGGTGCCAGGG - Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1077109439 11:855600-855622 GAGCTCTCCAAGGGACCCCAGGG - Intronic
1080663278 11:34314515-34314537 CACCTGTGCTAGGTGCCACAGGG + Intronic
1080737993 11:35036168-35036190 CAGCTGTTGAAATGGCCCCAAGG - Intergenic
1081636524 11:44726046-44726068 CAGCTCTGCAGGAGGCCCCTTGG - Intergenic
1083144525 11:60748677-60748699 CACCTGTGCAATGGGGCCCATGG - Intergenic
1084771129 11:71343556-71343578 CAGCCGTGTCAGGGGCCGCAGGG - Intergenic
1085284739 11:75352220-75352242 CAGCTAAGCGAGGGGCCGCAGGG - Intergenic
1087891368 11:103541718-103541740 CAGCCCTGCAAGGGGTCTCATGG - Intergenic
1089696648 11:120219993-120220015 CAGCTGTGCGACAGACCCCAGGG + Intronic
1090564144 11:127968339-127968361 GAGCTGTGCTGGTGGCCCCATGG + Intergenic
1091996386 12:4997418-4997440 CAGCTCTTCACTGGGCCCCAGGG - Intergenic
1092177947 12:6423833-6423855 CAGTTATGCAACTGGCCCCAAGG + Intergenic
1094481492 12:30885797-30885819 CAGCTGTGGCTTGGGCCCCAGGG - Intergenic
1098543540 12:71686172-71686194 CAGCTGCGCAAGCCGCCCTAGGG - Exonic
1101589423 12:106112648-106112670 CAGCTCTGCCTGGGGGCCCATGG + Intronic
1101815202 12:108140809-108140831 CAGCTCTGGAAGGGGTCCCAGGG + Intronic
1102679664 12:114682940-114682962 CAGATGCGCCTGGGGCCCCAGGG + Exonic
1102959775 12:117085044-117085066 CAGCTGGCCAAGGGGCACCAGGG + Intronic
1104590241 12:130078879-130078901 CAGCTGTGCAAGGGGAGCAGAGG - Intergenic
1105069809 12:133227594-133227616 CATCTGTGTATGTGGCCCCACGG - Intronic
1106513253 13:30429837-30429859 CAGGGGTGCATGGGGCCCCTTGG + Intergenic
1108616379 13:52137692-52137714 CAGCTGTGAAAAGCCCCCCAGGG + Intronic
1110014827 13:70387082-70387104 CAGCTGTGCCTGGGACCACAGGG + Intergenic
1112307286 13:98286391-98286413 GTGTTGTGCAAGGGACCCCATGG + Intronic
1112380112 13:98880914-98880936 CACCTGTGCCAGGGGCTTCAAGG + Intronic
1118254212 14:64190976-64190998 CAGCTGCACAAGTGGTCCCAAGG - Intronic
1118766267 14:68911741-68911763 CAGATCTGCAAGGGCCGCCATGG - Intronic
1119266488 14:73265648-73265670 CAGCTGGGCAAAGGGCTCCTTGG + Intronic
1121464173 14:94103552-94103574 CAGCTCCCAAAGGGGCCCCAAGG + Intronic
1121505328 14:94472846-94472868 CACCTGTGCAAGGGCCCAGAGGG + Intronic
1121895059 14:97639230-97639252 CTGCTGTGCAGTGGGCCCCCTGG + Intergenic
1121954870 14:98204689-98204711 CCTCTCTGCAAGGGGCCCCAGGG - Intergenic
1122202203 14:100129432-100129454 CAGCACTGCAAGGGGCCTCAGGG - Intronic
1122475953 14:102009105-102009127 CAGCTGTCGGAGAGGCCCCAGGG + Intronic
1122980800 14:105191665-105191687 CTGGTGTCCCAGGGGCCCCATGG - Intergenic
1123115829 14:105893652-105893674 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123117857 14:105902762-105902784 CAGCTGAGCCAGGGGCCCCCAGG + Intergenic
1123120071 14:105912367-105912389 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123402809 15:20003953-20003975 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123456760 15:20433378-20433400 AAGCTGTGGTAGGGGCCACATGG - Intergenic
1123512146 15:21010607-21010629 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123661302 15:22566978-22567000 AAGCTGTGGTAGGGGCCACATGG + Intergenic
1124262908 15:28208532-28208554 AAGCTGTGGTAGGGGCCACATGG - Intronic
1124315102 15:28661214-28661236 AAGCTGTGGTAGGGGCCACATGG + Intergenic
1124396442 15:29306087-29306109 CAGCGCTGCCTGGGGCCCCAAGG - Intronic
1129160089 15:73742583-73742605 CAGTTTTGCAGGGGGCCGCAGGG - Intronic
1129394681 15:75237448-75237470 CAGCTGTGCAGGGAGGCGCATGG - Intergenic
1129743392 15:78001170-78001192 AAGCTGGGCAAGGGGCAGCAAGG - Intronic
1130098493 15:80873954-80873976 CACCTGTGGATGTGGCCCCAGGG - Exonic
1131058334 15:89389674-89389696 CAGGGGGGCAAGGGGGCCCAAGG + Intergenic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1131119652 15:89814495-89814517 CATCTGGGGAGGGGGCCCCAGGG - Intronic
1131440307 15:92454729-92454751 CAGCAGAGCCAGGGGCCCCTGGG - Intronic
1132309296 15:100845184-100845206 GAGGTGTGCAAGTGGCCCTAGGG + Intergenic
1132891732 16:2208100-2208122 CAACTGTGCATGGGGACCCCGGG - Intronic
1134632310 16:15765675-15765697 GAGCTGGGCCAGGGACCCCATGG - Intronic
1135040888 16:19115704-19115726 CTGCTGCGCAAGGGGGCCCCTGG + Exonic
1136139505 16:28279659-28279681 CAGCTGTCCCTGGGGCCCCTGGG - Intergenic
1136500767 16:30668840-30668862 CTGCGGTGCAGGCGGCCCCATGG - Exonic
1137398170 16:48131752-48131774 CTGCTGTTAAATGGGCCCCATGG + Intronic
1137551403 16:49440076-49440098 CAGCAGTGCCAGGGCTCCCAGGG + Intergenic
1138372459 16:56538079-56538101 CATCTGTGGAAGGAGACCCAGGG - Intergenic
1140760717 16:78106246-78106268 CAGCTCTGCAAGGGGCTGGAAGG + Intronic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1141098108 16:81177284-81177306 CTGCTTTGCAAGCAGCCCCAGGG - Intergenic
1141993079 16:87621384-87621406 CGGCTGCGCAAGGGGCTTCAGGG + Intronic
1142138110 16:88460854-88460876 CAGCTGTTCATGGGGCCACTGGG + Intronic
1142247231 16:88975730-88975752 CAGCTGCCCGTGGGGCCCCAGGG - Intronic
1143090135 17:4445195-4445217 CAGGTGGGGAAGGGGCCTCAGGG - Intronic
1143220177 17:5255058-5255080 CAGGACTGCAAGAGGCCCCAAGG + Intergenic
1147685942 17:42287029-42287051 ATGCTCTGCAGGGGGCCCCAGGG - Intergenic
1147883340 17:43668265-43668287 CAGCTGAACAAGGTGCCGCAGGG - Intergenic
1148164844 17:45476263-45476285 CAGATGTGTCAGGGGCCCCGTGG - Intronic
1148777506 17:50104003-50104025 CTGCAGTGCCAAGGGCCCCAGGG - Intronic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1149540217 17:57462993-57463015 CTGTGGTGGAAGGGGCCCCATGG - Intronic
1149578626 17:57731512-57731534 CAGCTGTGGAAAGAGTCCCAGGG - Intergenic
1150396062 17:64822926-64822948 CAGATGTGTCAGGGGCCCCGTGG - Intergenic
1150624604 17:66833736-66833758 GAGCTGTGCAAGAGGCTCCTGGG + Intergenic
1151101771 17:71563949-71563971 CAGCTGTCCAGGGGCCCCAAAGG + Intergenic
1151445544 17:74161146-74161168 CAGATATCCAAGGGGTCCCAGGG + Intergenic
1151869556 17:76827154-76827176 GGGCTGAGCAAGGGGCCCCTAGG + Intergenic
1151954417 17:77373344-77373366 CAGCTGAGCCAGGGGGCCTAGGG + Intronic
1151973985 17:77474209-77474231 GAGCTTTGGCAGGGGCCCCAGGG + Intronic
1152030897 17:77842354-77842376 GAGCTTTGCAAGGGGCCCCCAGG + Intergenic
1152225391 17:79090400-79090422 CAGCTGTGCCAGGGGGCCGGCGG - Intronic
1152467196 17:80473088-80473110 CAGATGTTGATGGGGCCCCAAGG - Intronic
1152753990 17:82079337-82079359 CAGGTGCGCAAGGGGCCTGACGG - Exonic
1152779506 17:82220005-82220027 CTGCTGTGAAAGGGCCCCCCCGG - Intergenic
1152947087 17:83203776-83203798 CAGCCCTGCAAGGGACCCCTAGG - Intergenic
1153357788 18:4156878-4156900 CAGCTGTGCACTCGGCCCTATGG - Intronic
1153770239 18:8409398-8409420 CAGCTGTGGAAAGGCCCACATGG - Intergenic
1154008964 18:10559531-10559553 CAGGGGTGCAAGGGGCTCCCAGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156676228 18:39529968-39529990 CAGATGGGCAGGGAGCCCCACGG - Intergenic
1159960954 18:74555455-74555477 CAGATGTGCAGGTGGCCCCTGGG + Intronic
1160112765 18:76049070-76049092 CAGCAGTGCAAAGGGCCAGAGGG + Intergenic
1160592841 18:79953328-79953350 CATCTGTGCACGGGGCCTCCAGG + Intergenic
1161066358 19:2240299-2240321 CAGCAGAGCAAGGGGGTCCAGGG - Intronic
1161297555 19:3527422-3527444 CAGCTGTGGAAGGGAGGCCAGGG + Intronic
1162348751 19:10136381-10136403 CTCCTGTGCAAGGGGCCCCCTGG + Intronic
1162351304 19:10151370-10151392 GAGCTGACCAAGGGGCTCCAAGG + Intronic
1162353364 19:10165321-10165343 CTCCTGTGCAAGGGGCCCCCTGG + Intronic
1162502569 19:11062386-11062408 CCTCTGTGAAACGGGCCCCATGG - Intronic
1163740354 19:19008016-19008038 CAGCTGAGCCAGGGGCCTAAGGG - Intronic
1165175905 19:33929556-33929578 CACCTGGGCCAGGGGCCGCACGG + Intergenic
1165767105 19:38358478-38358500 CAGCACTGCAATGGCCCCCAAGG + Exonic
1165902465 19:39175146-39175168 CAGCTGTGCTCCGGGCCCCTGGG + Intronic
1166000828 19:39876560-39876582 AAGCTGTGAAAGGGGCCCAGGGG + Intronic
1166003609 19:39892813-39892835 AAGCTGTGAAAGGGGCCCAGGGG + Intronic
1166851430 19:45763344-45763366 CAGCTGTGGAAGCGGTTCCAGGG - Exonic
1166998203 19:46729897-46729919 CAGCTGGGCCAGGGCCCCCTGGG + Intronic
1167096600 19:47377881-47377903 CAGCAGAGCCATGGGCCCCATGG + Intronic
1167335090 19:48880254-48880276 TAGCTGAGCAAGAGGCCTCAGGG - Intergenic
1167594930 19:50422576-50422598 TATCTGTGAAATGGGCCCCAAGG - Intronic
924986627 2:276815-276837 CAGCTGCAGAAGGGGCCACACGG + Intronic
926119157 2:10232162-10232184 CAGCTCTGGAAGGGGGCCCTGGG + Intergenic
929439658 2:41955211-41955233 CACCTGTGGAAGGGTGCCCAGGG - Intergenic
932470290 2:71950742-71950764 GAGCTGTGCAATGGGCATCAGGG - Intergenic
932574318 2:72954505-72954527 CAGCTGTTGCAGGGGCCCCTGGG - Intronic
933897560 2:86825256-86825278 CAGGTGTGCAGGTGGTCCCAGGG + Intronic
934655464 2:96114933-96114955 AAGCACTGCAAGGTGCCCCATGG - Exonic
936125691 2:109787623-109787645 CAGGTGTCCAGGGGGCCACAGGG + Intergenic
936219002 2:110583845-110583867 CAGGTGTCCAGGGGGCCACAGGG - Intergenic
936350167 2:111706572-111706594 TAGCTGTCCAAGGGGGCGCAGGG + Intergenic
936404192 2:112187639-112187661 CAGCGTTGCACGGCGCCCCATGG + Exonic
937436344 2:121884938-121884960 CAGCTGGGAAAGGGGCTGCAGGG - Intergenic
940850767 2:158686210-158686232 CAGCGGTGGAAGCTGCCCCATGG - Intergenic
942397729 2:175569309-175569331 AAGCTGTGCAAGTAGCCACAAGG + Intergenic
946299925 2:218816620-218816642 CAGCTGTGAAAGGGTGACCACGG - Intergenic
947714695 2:232333656-232333678 TTGCTGCACAAGGGGCCCCAGGG - Intronic
948429578 2:237911275-237911297 CAGAGCTGCGAGGGGCCCCACGG + Intronic
948585392 2:239015837-239015859 CAGCTGTGCAGAAGGCCGCAGGG - Intergenic
948646068 2:239405944-239405966 AAGCTGGGCAAGGGGACCCAGGG - Intergenic
1171400629 20:24871178-24871200 CAGCTGTGCAAGGACCACAAGGG - Intergenic
1171455693 20:25270890-25270912 CCGCAGTACCAGGGGCCCCAAGG - Intronic
1171556012 20:26083198-26083220 CAGGTGTGCATCGGTCCCCAGGG - Intergenic
1173144699 20:40514549-40514571 AAGCGGTGCTATGGGCCCCAGGG + Intergenic
1174066255 20:47867914-47867936 CAGCTGTGCTGGGGACCTCAGGG + Intergenic
1174207830 20:48853972-48853994 GAGGTGTGCACGGGACCCCATGG - Intergenic
1174279404 20:49427915-49427937 CAGCTGAGAAAAGGGCCCCCCGG - Intronic
1175297574 20:57919586-57919608 CACTTGGGCAAGGAGCCCCATGG - Intergenic
1175413200 20:58784968-58784990 CACCTGTGCAAGGCCACCCAGGG + Intergenic
1176269071 20:64226107-64226129 CAGCTGTTCAAGTGGCCACTTGG - Intronic
1178051653 21:28754144-28754166 CAACTGTGCGAGGGGGCCCTTGG - Intergenic
1178491243 21:33053462-33053484 CCTCTGTGCAATGGGCCCAAAGG + Intergenic
1179502843 21:41820888-41820910 CAGCTGGGCTAGGGGCAGCAGGG - Intronic
1180070180 21:45432011-45432033 CAGCTGTGGGAGGGTCTCCATGG - Intronic
1181136755 22:20772608-20772630 CGGGTGTGCAAGGGGCCCATGGG - Intronic
1182112109 22:27731244-27731266 CAGCTGTATAATGGGCTCCATGG - Intergenic
1182148388 22:28011694-28011716 CAGGTATGCAAGGGGCCCAGTGG + Intronic
1183028412 22:35083901-35083923 CAGCCGGCCAAGAGGCCCCAGGG + Intronic
1183193259 22:36335475-36335497 CAGCTGAGGAAGGAGCGCCATGG - Intronic
1183587718 22:38762584-38762606 CAGCGTAGCAAGAGGCCCCATGG - Intronic
1184091713 22:42296429-42296451 CAGCTGTGCCCGGCTCCCCAAGG + Intronic
1184171387 22:42761713-42761735 CTGCTGGGCAATGGGCCCCAGGG + Intergenic
1184370010 22:44076203-44076225 CAGCTGAGTTGGGGGCCCCATGG + Intronic
1184402376 22:44281506-44281528 CAACTGTGCAAGGAGGGCCAAGG + Intronic
1184660224 22:45962214-45962236 CAGGGGTGCAATGGACCCCATGG - Intronic
1185326206 22:50227013-50227035 CACCTGTGGAGGAGGCCCCAGGG - Exonic
950194158 3:10997374-10997396 TGGCTGTGAAAGGGGCCCCCTGG + Intronic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
950654390 3:14427709-14427731 CAGCTGCCCAAGGTGTCCCAGGG + Intronic
952901513 3:38114716-38114738 CAACTGTGCCAGGGGCCCCAGGG - Intronic
953537294 3:43786180-43786202 CTGCTGGGCATGGGCCCCCAAGG + Intergenic
954532714 3:51334622-51334644 CTGCTGTAAAAGGGGCCCCAAGG - Intronic
954788552 3:53113471-53113493 CAGCTCTGGAAGTGGGCCCAAGG + Intronic
956823291 3:72973204-72973226 CAGCTGGGGGAGGGGCACCAGGG + Intronic
957685561 3:83500934-83500956 CAGCCCTGCAAGGGGTCTCATGG - Intergenic
959951617 3:112185570-112185592 CACCTGTGCCCGGGGTCCCAGGG + Intronic
961517653 3:127448201-127448223 CAGCTGTGCCAGAAGTCCCAAGG - Intergenic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
961742437 3:129041036-129041058 CAGCTCTGCACATGGCCCCAGGG - Intergenic
962462215 3:135624872-135624894 CACCTGTGCCAGAGGCCACATGG + Intergenic
963100759 3:141601279-141601301 TAGCTGTGCATGGTGGCCCACGG + Intronic
967990216 3:195125134-195125156 GAGGTGTGTAAGGGGCCACATGG + Intronic
968573630 4:1355004-1355026 CAGGTGTGCCAGGGACCCCCCGG + Intronic
968660854 4:1798182-1798204 CAGATGTGCAGGTGGCCCCTGGG - Intronic
970166904 4:13248053-13248075 CACCTGTTCAAGTGCCCCCACGG + Intergenic
970707883 4:18826764-18826786 CTGCTGTGCAAGGGACCCGGTGG - Intergenic
977574940 4:98665474-98665496 CAGCCCTGCAAGGGGTCTCATGG - Intergenic
978542953 4:109838356-109838378 AAGCAGAGCAAGAGGCCCCAGGG - Intronic
979669417 4:123346560-123346582 CAGCTCTGCAAGGAGCCTAACGG + Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
981130248 4:141150483-141150505 CAGCTGTGTAAGGGAGGCCAGGG - Intronic
983997575 4:174204375-174204397 TAGCTGTGAATGAGGCCCCACGG + Intergenic
984761584 4:183367004-183367026 CAGCTGCACAAGAGACCCCAAGG + Intergenic
985486334 5:153547-153569 CAGCTGTGGAAGAAGCCCCGCGG - Intronic
985564109 5:606721-606743 CCGCTCTGCAAGGGGCCCAGAGG - Intergenic
985590063 5:759907-759929 CTGCTGGCCAAGGGGCCCGAGGG + Intronic
985622090 5:961075-961097 CAGCTTGGCAAGTGGTCCCACGG - Intergenic
985672284 5:1213108-1213130 CATCTGGGGAAGGGGGCCCAGGG - Intronic
985899127 5:2773642-2773664 GAGATGTGCAAGGAGACCCAGGG - Intergenic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
987394766 5:17412835-17412857 GAGCTGAGCAAGGCGCCTCATGG - Intergenic
988202382 5:28084040-28084062 CAGCCCTGCATGGAGCCCCAAGG - Intergenic
989992268 5:50781575-50781597 GAGCTGGGAAAGGGGACCCAGGG - Intronic
990996455 5:61736876-61736898 CAGTTGTGCCAGGGTCTCCATGG - Intronic
995524523 5:113039809-113039831 CAGCTGTGCTTGGGTCCCGAGGG + Intronic
996612891 5:125404990-125405012 CAGCTGCGTAAGTGGCCTCATGG - Intergenic
997422112 5:133778046-133778068 CAGCTGGTCAGTGGGCCCCAAGG + Intergenic
998629274 5:143880505-143880527 CAACTGTGGAAGGGGCGCAATGG - Intergenic
999265021 5:150261192-150261214 CAGCTGGGCAAGGGGCACATGGG + Intronic
1000343750 5:160297167-160297189 CAGCTATGCTAAGGGCCTCAGGG + Intronic
1000656459 5:163884990-163885012 CACCTCTGCAAGGGTCACCAAGG - Intergenic
1002164549 5:177336347-177336369 GAGCTCTGCAGGGGGCGCCAGGG - Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1006075510 6:31529749-31529771 CAGCTGTGCGGTGGGTCCCAGGG - Exonic
1006556736 6:34873329-34873351 CAGATGTGCCAGGGACCCCAGGG - Exonic
1006815219 6:36845447-36845469 CATCTGGGCAAGAAGCCCCATGG + Intergenic
1006935601 6:37715481-37715503 CTGCCCTGCAAGGGGCCCCTGGG + Intergenic
1007109950 6:39307568-39307590 CAGCTCTGAGAGGAGCCCCATGG + Intronic
1007710968 6:43824070-43824092 CAGCTGTGGAAGGGGCTCCTGGG + Intergenic
1012416578 6:99019864-99019886 CAGCCCTGCAAGGGGTCTCATGG - Intergenic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1014752019 6:125267658-125267680 CAGTTCTGCAAGGGGTCTCATGG + Intronic
1018561663 6:165106487-165106509 CAGGTGTGGCAGGGTCCCCATGG + Intergenic
1019615524 7:1957922-1957944 CAGCTGAGCAGGGGCCGCCACGG - Intronic
1019745793 7:2699877-2699899 CAGAAGGGCAAGGGCCCCCAAGG - Intronic
1022031273 7:26493583-26493605 CAGGTTTGCAAGGTGTCCCAGGG - Intergenic
1023095231 7:36653655-36653677 CAGCAGTTCAGGAGGCCCCAGGG + Intronic
1023479049 7:40613266-40613288 CAGCTGTGAAAGCAGCCTCATGG - Intronic
1023513218 7:40975334-40975356 CAGCTGTGATATGGGACCCAAGG - Intergenic
1023930279 7:44701135-44701157 CAGCAGTCCAAGGGCCCACAGGG + Intronic
1024533218 7:50409990-50410012 CAGTTGTGCCCGGGGACCCATGG - Intergenic
1025025588 7:55513775-55513797 CAGCTCTTCAAAGGGCCACAGGG + Intronic
1026778577 7:73247970-73247992 CAGCTGTGCGGGTGGCCTCAGGG + Intergenic
1027019434 7:74801376-74801398 CAGCTGTGCGGGTGGCCTCAGGG + Intronic
1027068592 7:75144565-75144587 CAGCTGTGCGGGTGGCCTCAGGG - Intronic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029317739 7:99729726-99729748 CAGCAGTGGAGGGGGCCACAAGG - Intronic
1029652564 7:101903387-101903409 CGGCTCTGCAAGGAGCCCAAAGG - Intronic
1035105161 7:156435835-156435857 CAGCAGAGCAAGGCGCCCAAAGG + Intergenic
1035296632 7:157871055-157871077 CAGCTGGGGTAGGGGCCTCAGGG + Intronic
1035688007 8:1539814-1539836 CAGCTGTGCCATGAGCACCACGG + Intronic
1037995467 8:23349160-23349182 CAGCTGTGCAAGGAGAATCATGG + Intronic
1038438858 8:27558067-27558089 AAGCTCTGCAAGGGGCCCAGGGG - Intergenic
1039963282 8:42265959-42265981 CAGCTCTGCATGGAGCCCAAAGG + Intergenic
1040018985 8:42723604-42723626 CTGCTGTGAAGGGGGCCCCCAGG - Intronic
1040549430 8:48427266-48427288 CGGCAGTGCAGGAGGCCCCAGGG - Intergenic
1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG + Intergenic
1041342604 8:56861926-56861948 CAGATGTGCGAGGGGCACCCTGG + Intergenic
1044428557 8:92082527-92082549 CAGCTGTGTGTGGGGCCTCAAGG - Intronic
1045510441 8:102808667-102808689 CATCCCTGCAGGGGGCCCCAAGG + Intergenic
1049425248 8:142535295-142535317 CAGATGTGCAAGAAGCCTCATGG + Intronic
1051186296 9:14464687-14464709 CAGCTCTCCAAGGGGCCCTGGGG - Intergenic
1051356115 9:16240858-16240880 CAGCTATGTTAGGGGCCCCATGG + Intronic
1055949736 9:81719650-81719672 AAGCCGTGCAAGTGTCCCCAAGG + Intergenic
1056295149 9:85185474-85185496 CAGCTGTGGAAGGGCCTGCAGGG - Intergenic
1056754869 9:89375304-89375326 CAGCTGTGAGAGCGGCCACAGGG + Intronic
1057606024 9:96498331-96498353 CAGCAGATCAAGGGTCCCCAAGG + Intronic
1059225456 9:112668827-112668849 CAGCTGAGCAAGAGGACCCTGGG - Intronic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061010097 9:127949715-127949737 CGCCTCTGCAAGGGGACCCAGGG - Intronic
1061207512 9:129173460-129173482 CTGCTGCGCCAGTGGCCCCAGGG + Intergenic
1061245423 9:129399069-129399091 CAGGTGGGCAAGGGGTCCCCAGG - Intergenic
1061987760 9:134139966-134139988 AAGGTGTCCAAGGGGCCCCTGGG - Intronic
1188835350 X:34948099-34948121 CAGCTGTGATGTGGGCCCCAGGG - Intergenic
1190200271 X:48355213-48355235 CACCTTTGCAAGGAGACCCACGG - Exonic
1191902872 X:66056772-66056794 CAGCTGGGCCTCGGGCCCCAGGG - Intergenic
1198582517 X:138081634-138081656 CTGCTTTCCAAGGGGTCCCAGGG + Intergenic