ID: 950575551

View in Genome Browser
Species Human (GRCh38)
Location 3:13830141-13830163
Sequence CCTGCTTGGGGGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 862
Summary {0: 2, 1: 0, 2: 6, 3: 77, 4: 777}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950575551_950575565 29 Left 950575551 3:13830141-13830163 CCAGCCACCCTCCCCCAAGCAGG 0: 2
1: 0
2: 6
3: 77
4: 777
Right 950575565 3:13830193-13830215 ATCCAAGCCAGCTGATCACATGG 0: 1
1: 0
2: 1
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950575551 Original CRISPR CCTGCTTGGGGGAGGGTGGC TGG (reversed) Intronic
900289246 1:1916904-1916926 CCGGGTTGGGGGCGGGTGGTGGG + Intronic
900345984 1:2210467-2210489 CCTGCTTTGGGGAGGAGGCCAGG + Intronic
900361048 1:2289310-2289332 CCCTCTTCGGTGAGGGTGGCAGG + Intronic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900420035 1:2552263-2552285 CATGCGAGGTGGAGGGTGGCTGG - Intergenic
900507289 1:3036081-3036103 CCTGCGTGGGGTAGGGTAGATGG - Intergenic
900526594 1:3132336-3132358 CCTGCTGGGTGGAGGGTGGATGG + Intronic
900700772 1:4047458-4047480 AGGGATTGGGGGAGGGTGGCAGG + Intergenic
900700865 1:4047917-4047939 CCTGCATGGGGGTGGGGGGTTGG + Intergenic
900722764 1:4188306-4188328 CATGCTGGGGGGTGGGTGGGGGG + Intergenic
901054656 1:6443575-6443597 CCTGCTTGGGTGAGGGAACCAGG - Intronic
901551327 1:9997762-9997784 GCGGCTGCGGGGAGGGTGGCCGG - Intronic
901643430 1:10704559-10704581 CCTCCTGGGGGGAAGGGGGCCGG + Intronic
901911329 1:12460934-12460956 CCTGCTGGGGGGATGGGGGGTGG - Intronic
901931394 1:12597990-12598012 GCTGCCTGGGGGAGCGTGGAAGG - Intronic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
902709808 1:18230927-18230949 CCTGCTTGGAGGAGGGGGGCAGG - Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903275150 1:22216878-22216900 CCTTCTTGCTGGAGGTTGGCGGG + Intergenic
903460968 1:23520882-23520904 CTTGGTTGGGGGAAGGTGTCAGG - Intronic
903710726 1:25322125-25322147 TGTGTGTGGGGGAGGGTGGCGGG + Intronic
903716364 1:25370282-25370304 TGTGTGTGGGGGAGGGTGGCGGG - Intronic
903802303 1:25978297-25978319 CCTGTTTGGAGGTAGGTGGCGGG - Intronic
904821732 1:33249552-33249574 CTTTCTTGGGGGAGTGGGGCAGG - Intergenic
905172734 1:36118677-36118699 GCTGGTTGGGGGTGGGGGGCGGG - Intronic
905311337 1:37051284-37051306 AATGCCTGGGTGAGGGTGGCAGG - Intergenic
905416914 1:37810005-37810027 CCCTATTTGGGGAGGGTGGCTGG - Exonic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
905863370 1:41364414-41364436 CCTGCTGGCGGGGGGGTGGGGGG + Intronic
905896461 1:41549022-41549044 CCTGTTGGGGGGTGGGGGGCAGG - Intronic
905956952 1:42005093-42005115 CCTGTATGGGGTAGGGTGGAGGG - Intronic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906593267 1:47048135-47048157 CCTACTTGGGGGACTGAGGCAGG + Intronic
906622759 1:47297697-47297719 GCTGCTTGGGAGAGTGAGGCAGG - Intronic
906967480 1:50472594-50472616 TTTGGTTGGGGGCGGGTGGCAGG + Intronic
907272524 1:53299200-53299222 CCTGTGTGGGGAGGGGTGGCGGG + Intronic
907417692 1:54325955-54325977 GCTGCTGGGTGGGGGGTGGCGGG - Intronic
907975313 1:59426094-59426116 CCTGCATGGAGGAGGGTGGAGGG + Intronic
908655302 1:66382351-66382373 CATGCTTGTGGGAGTGTGACAGG + Intergenic
909230378 1:73081784-73081806 CCTGTTGGGGGGATGGGGGCTGG - Intergenic
909392412 1:75132597-75132619 CCTGATTAGGCGAGGGTGGGTGG + Intronic
909698051 1:78489696-78489718 CCTGTTAGGGGGTGGGGGGCAGG + Intronic
911028910 1:93465351-93465373 CCTGTTGGGGGGTGGGAGGCTGG - Intronic
911146706 1:94559377-94559399 CCTGTTGCGGGGAGGGGGGCTGG + Intergenic
911189970 1:94938385-94938407 GCTGCTTGAGAGAGGGTGTCTGG + Intergenic
912345209 1:108957361-108957383 CCTGGTTGGGAGAGGGCAGCTGG - Intronic
912574881 1:110659919-110659941 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
912796796 1:112698400-112698422 CCTTCTTGGAGGAGGGGGCCAGG - Exonic
913020399 1:114783847-114783869 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
913027860 1:114863965-114863987 CCTGTTGGGGGGTGGGGGGCAGG + Intronic
913074220 1:115327811-115327833 CCTGCTTGGGAGGTGGGGGCAGG + Intronic
913130984 1:115838485-115838507 CCTGCTGTGGGGAGGGGGCCCGG - Exonic
913627970 1:120679262-120679284 CCTGTTTGGGGTTGGGGGGCGGG + Intergenic
914492114 1:148158805-148158827 GCTGCCTGGGGGAGTGGGGCGGG - Intergenic
914562131 1:148830573-148830595 CCTGTTTGGGGTGGGGGGGCGGG - Intronic
914610699 1:149299649-149299671 CCTGTTTGGGGTGGGGGGGCGGG + Intergenic
914679239 1:149927573-149927595 CCTGTTGGGGGCGGGGTGGCCGG - Intronic
915091787 1:153431432-153431454 CCTGGCTGGAGGAGGGTGGATGG - Intergenic
915156008 1:153876925-153876947 CCTGGTGAGGGGAGGGCGGCGGG + Intronic
915305645 1:154975918-154975940 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
915709144 1:157877375-157877397 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
915928665 1:160043818-160043840 ACTGCTTGGGCAAGGGTGCCAGG - Intronic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
916268825 1:162918932-162918954 CCTGCCTGGTGAAGAGTGGCAGG + Intergenic
916719609 1:167474341-167474363 CCTGCTTGGGTAGGGGTGGGAGG + Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
917289527 1:173457959-173457981 CCTGCCGGGGGGTGGGGGGCTGG + Intergenic
917866640 1:179201935-179201957 CCTGGCTGGGGTTGGGTGGCAGG - Intronic
917939297 1:179902135-179902157 CCTGCTTGGGGGGCTGAGGCAGG - Intronic
919919176 1:202158135-202158157 GTTGCTTGGGGCTGGGTGGCTGG + Exonic
920951928 1:210580488-210580510 CCTGCTGGGGGGTGGGGGGTGGG - Intronic
921222396 1:212982360-212982382 CTTGTTTGGAGGAGGATGGCAGG + Intronic
921788515 1:219262720-219262742 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
921987344 1:221326676-221326698 TCTACTTGGAGGAGGATGGCAGG - Intergenic
922164463 1:223103342-223103364 CCTGCTTCCTGAAGGGTGGCTGG + Intergenic
922453490 1:225755628-225755650 CCTGCTTGTGGGAGGATGAAGGG - Intergenic
922777397 1:228221826-228221848 GCTGCCTGGGGCAGGGTGGAGGG - Intronic
922926279 1:229349367-229349389 CCAGCATGGGGGAGGGTTACAGG - Intergenic
923431150 1:233921793-233921815 CCTGTTGGGGGGAGGGGGGAGGG - Intronic
923516026 1:234698669-234698691 CTAGCTAGAGGGAGGGTGGCAGG - Intergenic
923540042 1:234882063-234882085 CCTGCCTGAGGGTGGGAGGCTGG - Intergenic
924267758 1:242300412-242300434 CCAGCCTGGGGTGGGGTGGCGGG + Intronic
924864912 1:247968492-247968514 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
924936983 1:248780331-248780353 CATGCTGGGGGGAGGGGGGAGGG - Intergenic
1063423986 10:5937184-5937206 CCTGCTCCGGGGAGGCTGTCAGG - Exonic
1063458474 10:6201468-6201490 GAGGCGTGGGGGAGGGTGGCGGG + Intronic
1063459084 10:6204002-6204024 CCGGCTTTGGGGAGGGTCGGTGG + Intronic
1064026948 10:11856508-11856530 GCTGCTTTTGTGAGGGTGGCTGG + Intronic
1064144934 10:12819827-12819849 CCTGCGCGGGGCAGCGTGGCAGG + Intronic
1065789857 10:29250686-29250708 CCTTCTTGGGGGATGATGACTGG - Intergenic
1066169631 10:32827637-32827659 CCTGTCTGGGGGTGGGGGGCTGG + Intronic
1066280906 10:33917713-33917735 CCTGGTTGGGGGAGTGAGACAGG - Intergenic
1066717135 10:38298331-38298353 CCAGCCTGGGGTGGGGTGGCAGG - Intergenic
1066747613 10:38616421-38616443 CCTGCTTGGGGGAGTGGGAGTGG - Intergenic
1067077388 10:43196016-43196038 CCTGCTTTGGGGAGGGGGAGGGG - Exonic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067474899 10:46558430-46558452 CCTTCTTGGGGCTGGGTGTCAGG + Intergenic
1067575418 10:47405499-47405521 CCTGAATGGAGGAGGGTGCCAGG - Intergenic
1067657939 10:48211460-48211482 CCTGCTTGGAGGAAAGTGTCTGG + Intronic
1069580045 10:69559639-69559661 AGTGCTAGGGGGAGGGTGGGGGG + Intergenic
1070007722 10:72441398-72441420 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1070460122 10:76658067-76658089 CCTAGATGGGGGAGGGTGGAAGG + Intergenic
1070580739 10:77717225-77717247 CCTCCCTGGGGGATGGTGGAGGG + Intergenic
1071443469 10:85725022-85725044 CCTTCTTGGTGGAGGGTAGAGGG - Intronic
1073026357 10:100489889-100489911 CCTGTTGGGTGGAGGGTGGCTGG - Intronic
1073082469 10:100868689-100868711 CCTGGGTTGGGGGGGGTGGCTGG - Intergenic
1074214502 10:111370950-111370972 CCTACTTGAGGGTGGGTGGTAGG - Intergenic
1074412051 10:113236678-113236700 CATGTTTGTGGGAGGCTGGCTGG + Intergenic
1074556542 10:114496491-114496513 GCCTGTTGGGGGAGGGTGGCGGG + Intronic
1074761381 10:116669799-116669821 CCTGCCTGGAGGAGGTGGGCAGG + Intronic
1074813867 10:117130529-117130551 CCTGCCTGGGGAAAGGTGGAAGG - Intronic
1075843223 10:125522372-125522394 ACTGCTTGGGGGTCGGGGGCGGG + Intergenic
1075879736 10:125840557-125840579 CTTGCTTGGGGCATGGTGACGGG - Intronic
1075946852 10:126440645-126440667 CCTGCTTCAGTGAAGGTGGCAGG - Intronic
1076148082 10:128141140-128141162 CCTACTTGGGGGACTGAGGCAGG - Intergenic
1076157328 10:128213788-128213810 CCTGCCTGGGGGATGGTTGGTGG - Intergenic
1076185113 10:128440670-128440692 TCTGCTGGAGGGAGGGAGGCTGG + Intergenic
1076384890 10:130048812-130048834 GCTGCTTGGGGGACTGAGGCGGG - Intergenic
1076546928 10:131251483-131251505 GCAGCTTGGGTGAGGGTGGCTGG - Intronic
1076771945 10:132670561-132670583 CTTGCTGGGGGGAGAGTGGTTGG + Intronic
1076853110 10:133102810-133102832 GCTGCCTGGGGTACGGTGGCTGG - Exonic
1076888167 10:133272003-133272025 CCTGGTGGGGTGAGGGTGGCAGG - Intronic
1077461686 11:2714023-2714045 CCTGTGTGGGGGAGGGCTGCAGG - Intronic
1078690550 11:13575750-13575772 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
1078875296 11:15388882-15388904 CCTGTTAGGGGGTGGGAGGCTGG - Intergenic
1079327197 11:19504474-19504496 GCTGCTTTGGGGAGGGAGGGAGG + Intronic
1079379845 11:19928569-19928591 CCAGTTTGGGGGAAGGTGGGTGG - Intronic
1080205401 11:29723465-29723487 CCTGCTTGGGTGAGGTTGTTGGG + Intergenic
1080713001 11:34769489-34769511 GCTGCTGGGGGGAGGGGGGTGGG - Intergenic
1081669863 11:44936928-44936950 CCCGCTTGGGAGAGGGTGGGGGG + Intronic
1081794225 11:45808636-45808658 CCTGCTGGGGGTAGGGTGAGGGG - Intronic
1081937844 11:46917586-46917608 CCTGGCTGGGGTAGGGGGGCAGG - Intronic
1083257614 11:61506216-61506238 ACTGCTTGGGGGTGGGGGGAGGG + Intergenic
1083923671 11:65793519-65793541 CCTGCTGGGGTGGGGGTGGGAGG + Intronic
1084087213 11:66860129-66860151 GCTGCTCGGGGCAGGGTGCCGGG + Exonic
1084385729 11:68841738-68841760 CCCGCGGTGGGGAGGGTGGCGGG - Intronic
1084488335 11:69463994-69464016 CCTGCTGGGGGGAGTGGGACTGG - Intergenic
1084598857 11:70133074-70133096 CCTGCTTGGGGCAGGCTCCCGGG + Intronic
1084778297 11:71391844-71391866 TATGTTTGGGGGAGGGTGGGGGG + Intergenic
1085017278 11:73183078-73183100 CCTGCTTGGAGGTGGGGTGCTGG - Intergenic
1085050504 11:73377686-73377708 CCTGCGCGGGGGAGGGGGGCGGG - Intronic
1085424419 11:76391275-76391297 CTTGCCTGGGGCAGGATGGCAGG + Intronic
1086457391 11:86972675-86972697 CCAGACTGGGGCAGGGTGGCGGG + Intergenic
1086645554 11:89215363-89215385 CCTGTTTGGGGGTGGGGGGCTGG + Intronic
1086869306 11:92017829-92017851 CCTGCTCTGGTGAAGGTGGCAGG + Intergenic
1087874577 11:103340201-103340223 CCTGCATGGGGGATGATTGCTGG + Intronic
1088259359 11:107929173-107929195 CCTGCTTGGAGGAGGGTGGTCGG - Intronic
1088410163 11:109525365-109525387 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1089209342 11:116790018-116790040 CCTGTTGGGTGGAGGGTGGAAGG - Exonic
1089564574 11:119363993-119364015 CATGCTGGGGGGCGGGCGGCGGG + Intronic
1089866180 11:121634180-121634202 ACTGGGTGGGGGAGGGAGGCAGG + Intergenic
1089934790 11:122352885-122352907 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1089935129 11:122356872-122356894 CCTGGTGGGGGGAGGGGGGAGGG - Intergenic
1089982066 11:122780710-122780732 CCTGCAGGCGGGCGGGTGGCAGG + Intronic
1090276249 11:125421873-125421895 CCTTCTTGGGGTATGCTGGCTGG + Intronic
1090404199 11:126467369-126467391 CCTGCTTGGGTGGCAGTGGCTGG + Intronic
1090554818 11:127862924-127862946 CCTGCTGGGGGGTTGGGGGCTGG - Intergenic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1092216849 12:6689418-6689440 CCTGTTGGGGGGAGGGAGGGGGG - Exonic
1092532003 12:9352628-9352650 CCTTCTTGGGGGAGGGGGAGAGG - Intergenic
1092559949 12:9601721-9601743 TCAGCTTGGGGGATGGGGGCAGG + Intronic
1092957103 12:13561021-13561043 CCTGTGTAGGGGAGGATGGCAGG + Exonic
1093253701 12:16839691-16839713 CCTACTGGGTGGAGGGTGGGAGG + Intergenic
1093303287 12:17479421-17479443 CCTGCTAGAGGCAGGGAGGCCGG + Intergenic
1093678170 12:21968197-21968219 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1093808444 12:23464546-23464568 CCTGCTGGAGGCAGGGAGGCTGG + Intergenic
1095614302 12:44170287-44170309 CCTGCTGGGGGGTGGGGGGAGGG + Intronic
1096664538 12:53154499-53154521 CCTGGCTGGGGCTGGGTGGCAGG - Intergenic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1096818420 12:54216141-54216163 CCTGAGTGGGGGTGTGTGGCGGG + Intergenic
1097135100 12:56846315-56846337 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1097251197 12:57632996-57633018 CCTGCCCGGGGGCGGTTGGCGGG + Exonic
1097275153 12:57808118-57808140 CCTGCTGGGGGCAGGGGTGCAGG - Intronic
1097578811 12:61428477-61428499 GCTGCTGGGGGTAGGGTGGGAGG + Intergenic
1097679827 12:62637979-62638001 CCTGGTTGGGGGCGGGGGGGGGG + Intergenic
1098291136 12:68957839-68957861 CCTGTCAGGGGGTGGGTGGCTGG - Intronic
1098785255 12:74745298-74745320 CCTGCTTGAGGGAGGAGGGTAGG - Intergenic
1098944012 12:76570289-76570311 CCTACTTGGGAGATTGTGGCAGG + Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1099409725 12:82310638-82310660 CCTGTTGGGGGGCGGGGGGCTGG - Intronic
1099637019 12:85226678-85226700 CCTGCTGGGGGGTGGGGGGAGGG - Intronic
1100183393 12:92109770-92109792 CCTACTTGGGGGATGGAGGTGGG - Intronic
1100381905 12:94070244-94070266 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1100399105 12:94212473-94212495 CCTGCCGGGGGGTGGGGGGCTGG - Intronic
1100658856 12:96675931-96675953 CCTGTTTTGGGGTGGGGGGCAGG + Intronic
1101131715 12:101697573-101697595 CCTGCTAGGGGCGGGGAGGCGGG - Intronic
1102247583 12:111365059-111365081 ACTCCTTGGGGGAAGGTGGATGG - Intronic
1102291394 12:111703244-111703266 GGTGCTGGGAGGAGGGTGGCAGG - Intronic
1102722404 12:115028676-115028698 CCTGCCTGGCTGAGGGTGTCAGG + Intergenic
1102865384 12:116370015-116370037 ATGGCCTGGGGGAGGGTGGCAGG + Intergenic
1103120778 12:118377516-118377538 CCTGTTTCCGGGAGGGGGGCGGG - Intronic
1104012738 12:124943441-124943463 GCTGCTTCGGGGAAGGTGGAAGG + Intergenic
1104014701 12:124954056-124954078 CCTGCCCGTTGGAGGGTGGCGGG - Intronic
1104406462 12:128521452-128521474 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1104517107 12:129437887-129437909 CCTGTCGGGGGGAGGGGGGCTGG - Intronic
1104719952 12:131039697-131039719 ACTCCCTGGAGGAGGGTGGCTGG + Intronic
1104910091 12:132236200-132236222 GATGCCTGGGGGAGGGAGGCTGG - Intronic
1104978491 12:132562490-132562512 ACTGCCTGGGGGTTGGTGGCTGG + Intronic
1104997830 12:132669812-132669834 CCTGTTGGGCGGAGGGTGGCTGG - Intronic
1105851389 13:24339431-24339453 CTTTCTTGGGGGGGGGTGGGGGG + Intergenic
1107361224 13:39619412-39619434 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1107370314 13:39738187-39738209 CCTGCTTGGGGGACGATCTCTGG + Intronic
1107634552 13:42379052-42379074 ATTTATTGGGGGAGGGTGGCTGG - Intergenic
1107678823 13:42825966-42825988 ACTGCCTGTGGGAGGGTGGCAGG - Intergenic
1107803615 13:44133447-44133469 CCTGGTTGGGGAAGGGAGCCTGG - Intergenic
1107986562 13:45781464-45781486 TGTGATTGGAGGAGGGTGGCTGG + Exonic
1108248467 13:48541239-48541261 CCTGTTTGGGGGTGGGGGTCTGG + Intergenic
1108252208 13:48578505-48578527 CCTGCTTGTGGTTGGGTGTCAGG - Intergenic
1108412793 13:50166943-50166965 CCTGTTAGGGGGTGGGGGGCTGG + Intronic
1108500270 13:51064004-51064026 TCTGTTTGGGGAAGGGTGGTAGG - Intergenic
1108672553 13:52706803-52706825 TTTGCTTTGGGGAGGGTGTCTGG + Intronic
1108883170 13:55146375-55146397 CCTGCTTCAGGGAGGAAGGCTGG + Intergenic
1109162831 13:58997356-58997378 CCTGCTGGGGGGTGGGAGGAGGG - Intergenic
1109899916 13:68753917-68753939 CCTGCTGGGGGGTGCGGGGCTGG + Intergenic
1110406731 13:75159308-75159330 CCTGCTTGAGGGAGGAGGGTAGG + Intergenic
1110782018 13:79477683-79477705 CCTGCTTCTGGGAAGGTGGGAGG + Intergenic
1110804226 13:79736198-79736220 CCTGCCTGGTGAAGGGTGGATGG + Intergenic
1111194576 13:84857282-84857304 CCTGTCTGGGGGTGGGGGGCTGG - Intergenic
1112293206 13:98163311-98163333 CCTACTTGGAGAAGGGTGGCAGG + Intronic
1112684309 13:101805730-101805752 CCTGCTTGTGGGAAGGGGGGTGG - Intronic
1113572864 13:111370981-111371003 CCTGCTCGGAGGAGGGAGGCGGG - Intergenic
1113909593 13:113835889-113835911 CCTGCTTGGTGGAGGGGTGGGGG + Intronic
1115035436 14:28851206-28851228 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1117247550 14:53900820-53900842 CCTGTTGGGGGTAGGGTGGGAGG + Intergenic
1118110308 14:62711222-62711244 CTTGGTTGGGGGTGGGTGGGGGG - Intronic
1119666600 14:76489410-76489432 CCTGCATGGGAGAGGGTGTGTGG - Intronic
1119683337 14:76609540-76609562 CCTGTTGCGGGGTGGGTGGCGGG + Intergenic
1120865784 14:89294195-89294217 CCTGCTGTGGGGAGAGAGGCTGG - Intronic
1121049123 14:90808779-90808801 CATGCTTGGTAGATGGTGGCGGG - Intronic
1121173147 14:91870997-91871019 CCTGCTTCAGGGTGGGAGGCAGG + Intronic
1121180513 14:91925430-91925452 CATGCTTGGGGAAGGGTCTCTGG - Intronic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1121425148 14:93845354-93845376 CATGCTTTGGGGAGTGTGGAGGG + Intergenic
1122778464 14:104133585-104133607 AGTGCTTGGGGGAGGGTGGCCGG - Intergenic
1122791881 14:104187478-104187500 CCTCCTTGGGGGAGGGTCCTGGG - Intergenic
1122856101 14:104560987-104561009 CCTGCCTGGTGGAGGGAAGCAGG - Intronic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1123496638 15:20833573-20833595 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1123553873 15:21407165-21407187 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1123574953 15:21656818-21656840 CCTGCTTGGGGGAGCAGGGAAGG - Intergenic
1123590117 15:21844530-21844552 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1123611568 15:22099307-22099329 CCTGCTTGGGGGAGCAGGGAAGG - Intergenic
1124228349 15:27917039-27917061 GCTGCTTGGGGTAGGGGAGCTGG + Intronic
1124437906 15:29666259-29666281 CCTGCTGGGATGAAGGTGGCTGG - Intergenic
1124531395 15:30510840-30510862 TCTTGTTGGGGGAGGGTGGGAGG - Intergenic
1124559350 15:30757539-30757561 CATGCTTGGGGGCAGGTGCCCGG + Intronic
1124631937 15:31342998-31343020 CCTGCTTGCTGGAGGGGGTCGGG + Intronic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1124671903 15:31648182-31648204 CATGCTTGGGGGCAGGTGCCCGG - Intronic
1124767260 15:32496856-32496878 TCTTGTTGGGGGAGGGTGGGAGG + Intergenic
1124798342 15:32804658-32804680 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1125371591 15:38983778-38983800 CCTGGATGGGGGCGGGGGGCGGG + Intergenic
1125604202 15:40930764-40930786 CGGGCTTGGGGGTGGGAGGCAGG + Intronic
1125749303 15:42018042-42018064 CATGCTGGGAGGAAGGTGGCAGG + Intronic
1125766588 15:42140652-42140674 CCAGGTTGGGGAAGGGTGACTGG - Exonic
1125920286 15:43521379-43521401 CCTGCTTAGGGGAAGGTGATTGG + Exonic
1126009446 15:44288830-44288852 CCTGATTTGAGGAGGGGGGCGGG + Exonic
1126237253 15:46400475-46400497 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1126568626 15:50126710-50126732 CATGCTTGGTGGAGGGTGGCAGG + Intronic
1127309435 15:57739322-57739344 CCTGTTGGGGGGAGGGGGGCAGG + Intronic
1127477071 15:59344732-59344754 CCTGCTTGGGGAAAGGTGGGAGG - Intronic
1127920255 15:63488711-63488733 GATGCTTGGGGAAGGGAGGCGGG - Intergenic
1128374436 15:67065463-67065485 CCTGCTCCGGGGAGGGCGCCCGG - Intronic
1128481627 15:68045354-68045376 GCTGCTGTGGGGAGGGTGCCAGG + Intergenic
1128523921 15:68395718-68395740 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1128994814 15:72288651-72288673 CCTGCTTGGGGAAGGGCTCCTGG - Intronic
1129070510 15:72946541-72946563 CATGCTTGGGTGCTGGTGGCAGG - Intergenic
1129157071 15:73724893-73724915 CCTGCTTGGGGCTGGGTCTCAGG + Intergenic
1129727762 15:77910276-77910298 CATGCTTGGTGGGGGGTGGGAGG - Intergenic
1129840115 15:78738584-78738606 CATGCTTGGTGGGGGGTGGGAGG + Intergenic
1129884607 15:79029705-79029727 CCTGCTTGTGGGAGCGTGAAAGG + Intronic
1129893976 15:79090255-79090277 CCGGCTTGGGGGAGGGCGCGCGG + Exonic
1129973202 15:79798589-79798611 CTTGTTTGGGGCAGGGTGGTTGG - Intergenic
1130282543 15:82531227-82531249 CATGCTTGGTGGAGGGTGGGAGG + Intergenic
1130292349 15:82613974-82613996 ACTGCTTGGCGGAGGCTTGCCGG - Intronic
1131086032 15:89576126-89576148 CCTGCTTAGGGGTGGGCGGCAGG - Exonic
1131348325 15:91672360-91672382 CCTCCCTGGAGCAGGGTGGCTGG + Intergenic
1131548878 15:93339307-93339329 ACTGCCAGGGGGAGGGTGACAGG - Intergenic
1132185215 15:99797648-99797670 CATGCTTGGTGGGGGGTGGGAGG + Intergenic
1132431773 15:101766907-101766929 CATGCTTGGTGGGGGGTGGGAGG - Intergenic
1202962219 15_KI270727v1_random:134361-134383 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1202983821 15_KI270727v1_random:391062-391084 CCTGCTTGGGGGAGCAGGGAAGG - Intergenic
1132554528 16:566688-566710 CCTGCTTGGGGGTGGCAGCCTGG + Intergenic
1132607274 16:798824-798846 CCTGCGGGTGGGCGGGTGGCAGG + Exonic
1132928301 16:2445000-2445022 CCTACTTGGGGGACTGAGGCAGG - Intronic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133786297 16:8976055-8976077 CCTGCTGGGGGGTGGGGGGAGGG - Intergenic
1134631594 16:15759983-15760005 GCTGCTTGGGGGACTGAGGCAGG + Intronic
1134766666 16:16764858-16764880 CCTGCTTGAGGGAGGAGGGTGGG - Intergenic
1135007460 16:18839341-18839363 CCTACTTGAGGGTGGGGGGCAGG - Intronic
1136163688 16:28438296-28438318 GCTGCTTGGGGGACTGAGGCAGG + Intergenic
1136186597 16:28592136-28592158 CATGCCTGGGGGAGGAAGGCAGG + Exonic
1136189218 16:28605929-28605951 CATGCCTGGGGGAGGAAGGCAGG + Exonic
1136199276 16:28676690-28676712 GCTGCTTGGGGGACTGAGGCAGG - Intergenic
1136215621 16:28790865-28790887 GCTGCTTGGGGGACTGAGGCAGG - Intergenic
1136250258 16:28999751-28999773 CCTGCTTGGAGGAGGGAGCTGGG + Intergenic
1136260346 16:29070704-29070726 GCTGCTTGGGGGACTGAGGCAGG - Intergenic
1136317814 16:29464445-29464467 CATGCCTGGGGGAGGAAGGCAGG - Exonic
1136432389 16:30203790-30203812 CATGCCTGGGGGAGGAAGGCAGG - Exonic
1136478389 16:30526795-30526817 CCTGTGCGGGGGAGGGTGGGGGG - Intronic
1136610941 16:31364642-31364664 CCAGCATGGGGGAGGATGCCCGG - Intronic
1137370681 16:47903100-47903122 CCTGCTAGGGGGTGGGTGTTGGG + Intergenic
1137729801 16:50681089-50681111 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1137750602 16:50858593-50858615 CGTGCTTTGGCGATGGTGGCAGG + Intergenic
1138266647 16:55664503-55664525 CTTGTGTGGTGGAGGGTGGCTGG - Intronic
1138452995 16:57104921-57104943 CAAGCGAGGGGGAGGGTGGCAGG + Intronic
1139420003 16:66844329-66844351 CCTGCTGGGGGGTGGGGGGCGGG + Intronic
1139505565 16:67396557-67396579 CCTGCTGGGGTGGGGGTGGGTGG + Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139650762 16:68361103-68361125 GGTGCTTGGGGGAGGAGGGCAGG - Exonic
1141040181 16:80666476-80666498 CCTTCATGGGGGAGGGAGCCTGG + Intronic
1141265755 16:82495465-82495487 AGTGCCAGGGGGAGGGTGGCAGG + Intergenic
1141672328 16:85498838-85498860 TCTGCAGGGGGAAGGGTGGCTGG - Intergenic
1141715310 16:85723688-85723710 CCTGCTTGGGCAAGGCAGGCCGG + Intronic
1142172761 16:88631472-88631494 TCTGCTCTGGGGAGGGAGGCTGG - Exonic
1142186109 16:88695435-88695457 CCTGCTGGGAGGTGGGTGGCGGG + Intergenic
1142198831 16:88751410-88751432 TCTGCTTCCGGGAGGGTGGAAGG - Intronic
1142490398 17:274665-274687 CCTGCATGGGGCAGGGTCACAGG + Intronic
1142713073 17:1733788-1733810 CCATCTCGGGGGTGGGTGGCGGG + Exonic
1143015187 17:3887832-3887854 CCTGCTGGGAGGAGCCTGGCGGG - Intronic
1143107811 17:4538236-4538258 CTGGCTTGGGGGGTGGTGGCAGG - Exonic
1143447595 17:7018455-7018477 CATGGTTGGGAGAGGGGGGCCGG + Intergenic
1143542576 17:7578495-7578517 CCTGGCTGGGGCTGGGTGGCAGG - Exonic
1143561455 17:7697977-7697999 CCTGTTTGGGAGAGTGAGGCAGG - Intronic
1143893698 17:10120831-10120853 GCTGCTAGGGGGAGGGAGGGTGG + Intronic
1144250244 17:13409115-13409137 ACTGCTTAGGGGAGGATGACTGG - Intergenic
1144587315 17:16495043-16495065 CCTGCTTGAGGGTGTGTGGTTGG + Intergenic
1144640960 17:16936251-16936273 CCTGGTGGGGGAAGGGTAGCTGG - Intronic
1144784986 17:17826606-17826628 CAGGCTTGGGGAGGGGTGGCAGG - Intronic
1145846405 17:28042251-28042273 CCTGATTGGGGAGGGGGGGCGGG - Exonic
1147160775 17:38568344-38568366 CCTGCTCCTGGGAGGGTGGAGGG - Intronic
1147190390 17:38735103-38735125 CCACCTTGGGGGTGGGGGGCGGG - Exonic
1147335708 17:39725875-39725897 GCTGCCTGGAGGAGGGTGGGAGG + Intronic
1147517731 17:41138051-41138073 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1147629139 17:41918804-41918826 CCGGGTTGGGGGACGGAGGCAGG + Intronic
1147793137 17:43025485-43025507 GCTGCTGGGGGGTGGGTGACAGG + Intronic
1148028021 17:44601685-44601707 CCTGCTTGTGGGTGGGAGGTGGG - Intergenic
1148074402 17:44927162-44927184 CGGGCATGGGGGAGGGTGGTTGG + Intronic
1148093217 17:45034999-45035021 CCTGCTTGGGAGAGGCCAGCGGG + Exonic
1148240775 17:45998232-45998254 CCTGGGTGGGGGGAGGTGGCAGG - Intronic
1148463064 17:47849117-47849139 CCTGCTTGAGGGAAGGGGGTGGG - Intronic
1148556559 17:48582099-48582121 CCTGGACGGCGGAGGGTGGCTGG - Intronic
1148645453 17:49217586-49217608 CCTGGTGGGGGGCGGGGGGCGGG + Intronic
1148739317 17:49883335-49883357 AATGCCTGGGGGAGGGTGGGTGG + Intergenic
1148749002 17:49934168-49934190 ACTGCCTGGGGGAAAGTGGCAGG - Intergenic
1148931510 17:51130912-51130934 GCTGATGGGGGGCGGGTGGCGGG - Intergenic
1148942736 17:51228891-51228913 CCTTCTCGGGGGTGGGTGGGTGG + Intronic
1151351001 17:73532200-73532222 CTTGGTTGGGGGTGGGTGGGGGG - Intronic
1151558736 17:74860018-74860040 CCAGCTTGGGGGAGTGGGGGTGG - Intronic
1151705600 17:75765313-75765335 GCTGCTGGGTGGTGGGTGGCAGG + Exonic
1151973508 17:77471269-77471291 CCTGCTTGGGGGTAGGGGACAGG - Intronic
1152110864 17:78357256-78357278 CCTGCCTGGGTGGGGGAGGCTGG - Exonic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152140795 17:78535195-78535217 CCTGCTTTGGGGACAGTGGGAGG + Intronic
1152317100 17:79587506-79587528 CCTGTTTGGGAGAAGGCGGCTGG + Intergenic
1152460114 17:80438189-80438211 GCTGCTCTGGGGAGGGGGGCGGG + Intergenic
1152713702 17:81888056-81888078 CCTGGTTGGGGGGCGGTGGCTGG - Exonic
1152750010 17:82058309-82058331 CCTGCTGCGGGGCGGGTGGTAGG + Intronic
1152798125 17:82317812-82317834 CCTGGCTGGGGACGGGTGGCAGG + Intergenic
1152918473 17:83053362-83053384 CCTGCTTGGAGGAGGTTGACTGG + Intergenic
1154346293 18:13546099-13546121 CCTGCTTGGTGGGGAGTGGGTGG + Intronic
1154378307 18:13827011-13827033 CCTGCTAGGTGGAGGGTGGATGG - Intergenic
1154454548 18:14509257-14509279 GCTGGTTTGGGGTGGGTGGCTGG + Intronic
1155722899 18:29041304-29041326 CCTGTTGGGGGGTGGGGGGCGGG - Intergenic
1156338039 18:36187177-36187199 CCTGCGAGGAGGAGGGTCGCGGG + Intergenic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157395731 18:47339497-47339519 CCTGTTGGGGGGAGGGGGGAGGG - Intergenic
1157572197 18:48720631-48720653 CCTGCTTGGGGGTGGGCGTGAGG - Intronic
1157818478 18:50748475-50748497 CTTGCTTGGGGCCTGGTGGCGGG - Intergenic
1157916600 18:51669705-51669727 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1158937447 18:62377522-62377544 CGAGCATGGGGGTGGGTGGCAGG - Intronic
1159116125 18:64114983-64115005 CCTGCATGGAGGAGGGTGGGAGG - Intergenic
1159425639 18:68282058-68282080 CCAGTTTGGTGGTGGGTGGCGGG - Intergenic
1160434300 18:78833613-78833635 CCGGCTGGGGAGAGGGTGCCGGG - Intergenic
1160532081 18:79571525-79571547 CCTGCCTGGTGAGGGGTGGCAGG - Intergenic
1160715132 19:572975-572997 CCTGCTTGGAGGCGGGAGCCAGG + Intronic
1160913016 19:1483498-1483520 CCTGCTGGGGGGTGGGTGGGCGG + Intronic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161166776 19:2791928-2791950 CCTGGCTGGGGGAGGGTGCCAGG - Intronic
1161207232 19:3047362-3047384 CCCGCTGGGGGGCGGGTGGCAGG - Intronic
1161348204 19:3778284-3778306 CCAGTTTGCGGAAGGGTGGCCGG + Exonic
1161420724 19:4174793-4174815 CCAGCTTGGGGGTGGGCGGGCGG + Exonic
1161439566 19:4282986-4283008 ACGGCTTGGGGGAAGGTGACAGG + Intronic
1161612402 19:5250625-5250647 CCCGCTTGGGCGAGGGGGTCGGG + Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1161967591 19:7556900-7556922 CGTCCTTGGGGGAGGGGAGCAGG + Intronic
1162145243 19:8609315-8609337 CCAGCGTGGGGGAGGGTGCCAGG + Intronic
1162287159 19:9747430-9747452 CCTGCTGGGGGGAGGGGGGAGGG - Intergenic
1162312216 19:9914086-9914108 CCGCCTAGGGGGAGGGGGGCCGG - Intronic
1162523427 19:11194748-11194770 CCTGCGGGGGGGAGGGGGTCGGG - Intronic
1162819207 19:13212522-13212544 CCTGCATGGGGGACAGAGGCCGG + Exonic
1163287194 19:16356111-16356133 TCTGCGTGGGGCGGGGTGGCTGG - Intronic
1163345177 19:16736695-16736717 TCTGCTTGGAGGAGGTTGACCGG + Exonic
1163476107 19:17527059-17527081 TCGTCTTGGAGGAGGGTGGCAGG - Intronic
1163611678 19:18304974-18304996 CCAGCTCGAGGGAGGGGGGCCGG + Intergenic
1164799603 19:31065300-31065322 CCTGCTTGGGCCAGGTGGGCAGG + Intergenic
1165152950 19:33771699-33771721 CTGGCCTGGGAGAGGGTGGCGGG - Intronic
1165419317 19:35715314-35715336 CCTGCTGGGGGAAGGGGGCCAGG - Exonic
1165613209 19:37175093-37175115 CCTGTTGGGGGTGGGGTGGCGGG + Intronic
1165942999 19:39424610-39424632 CCTGCTTGGGTGAAGTTGGGAGG - Exonic
1166749862 19:45159553-45159575 CCAGCTCGGGCCAGGGTGGCAGG + Intronic
1166877126 19:45904045-45904067 CCTGCTGTGTGGAGGGTGGGTGG + Intergenic
1166998514 19:46731328-46731350 CCTGCTTGCGCGAGGCTGGCTGG - Intronic
1167048952 19:47067291-47067313 CCTGCTTGGGGATGGGTAGGGGG + Exonic
1167125521 19:47545770-47545792 GCTGCTGGGGGGCGGCTGGCCGG + Exonic
1167132870 19:47599061-47599083 TATGCTTGGGGGAGGGTGACAGG - Intergenic
1167393340 19:49211102-49211124 CCTGGCTGGGGGACTGTGGCAGG + Intronic
1167528298 19:49999387-49999409 CCCCCTTGGGGGAGTGGGGCAGG - Intronic
1167640358 19:50678399-50678421 CCTGCATGGGGCACGGGGGCAGG + Intronic
1167655477 19:50760957-50760979 TCTGCTTCTGGGAGAGTGGCTGG + Intergenic
1168165671 19:54545799-54545821 CCTTCTTGGCGGGGGGTGGGTGG - Intergenic
1168349720 19:55669000-55669022 CCGGCTTGGGGGTAGGTGTCGGG + Intronic
925080138 2:1056738-1056760 CCTGCTGTGGGGAGGGAGGGAGG + Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925404082 2:3594894-3594916 CCGGCTTTGGGGTGGGGGGCAGG - Intronic
925809241 2:7682725-7682747 CCTGCATGTGGGTGGGTGGGTGG + Intergenic
925852899 2:8100171-8100193 CATGATTGGGTGAGGGTGACTGG + Intergenic
925863601 2:8203560-8203582 CCTGCGTGGGGGCTGGTGGGCGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926622048 2:15055495-15055517 CCAGCTGGGGGGCGGGGGGCTGG + Intergenic
926661282 2:15469830-15469852 CCTGCTGGGGGGTGGGGGGAGGG + Intronic
926996092 2:18737219-18737241 CCTGTTGGGGGGAGGGAGGCTGG + Intergenic
927387176 2:22548190-22548212 CCTGCTGGGGGGTGGGGGGAGGG + Intergenic
928493484 2:31807491-31807513 CCTGCCAGGGGGTGGGTGGAGGG + Intergenic
928652661 2:33419005-33419027 ACTGACTGGGGGAGGGTAGCGGG + Intergenic
929178177 2:39002951-39002973 CCTACTTGGGGGATTGAGGCGGG + Intronic
929582652 2:43092688-43092710 ACTGCTTGGGGCTGGATGGCTGG + Intergenic
929669115 2:43855048-43855070 CCTGCTTTCGGCAGGGTGCCTGG + Intronic
930456458 2:51613188-51613210 TCTTCTTGGGGAAGGGTGGGAGG + Intergenic
930701015 2:54457298-54457320 CCTGCTTTGGGTAGGTGGGCTGG + Intronic
930928251 2:56847995-56848017 CCTTCCTGTTGGAGGGTGGCTGG + Intergenic
931762800 2:65432084-65432106 CCTGATTTGGGGAGGGGGGGCGG + Exonic
932318270 2:70800980-70801002 GCTGCTTTGGGGAGTGAGGCAGG + Intergenic
932794494 2:74682702-74682724 CCTCTTTGGGGGAGGGAGGAAGG + Intronic
933803714 2:85982913-85982935 GCTGCTTGGTGGAGAGTGGATGG - Intergenic
934111348 2:88746643-88746665 CCTGCTTCGGTGGAGGTGGCAGG + Intronic
934685980 2:96321947-96321969 GCGGCTTGGGGGACGGAGGCGGG + Intergenic
934783251 2:96986334-96986356 CCGGGGTGAGGGAGGGTGGCGGG + Exonic
934975338 2:98798231-98798253 CCTACTTGGGAGACTGTGGCAGG + Intronic
934979287 2:98826882-98826904 CCTGTGTGGGGGAGTGAGGCAGG + Intronic
935141110 2:100353865-100353887 CCAGCTGGCTGGAGGGTGGCTGG + Intergenic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
936057194 2:109270112-109270134 ACTGCTGGGAGGAGGGTGGTTGG - Intronic
936297489 2:111278043-111278065 CCTGGTGGGGGGAGGATGGGAGG + Intergenic
936482036 2:112893089-112893111 CGTGATTGGGGGAGGGTGGCAGG + Intergenic
936648826 2:114403040-114403062 CTTCCTTGAGGGTGGGTGGCTGG + Intergenic
936998283 2:118437794-118437816 CCTGTCTGGGGGAGGGCAGCAGG + Intergenic
937000911 2:118466772-118466794 CCGGCTTGGGGCAGGACGGCTGG - Intergenic
937181254 2:119997765-119997787 GCTGGCTGGGGGAGGGGGGCGGG - Intergenic
937241503 2:120465264-120465286 CCTGCCTAGAGGATGGTGGCTGG + Intergenic
937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG + Intergenic
938611172 2:132949080-132949102 CCTGGATGGGGCAGGGTGGGGGG - Intronic
938954184 2:136283097-136283119 CTTGGGTGGGGGAGGGTGGCTGG - Intergenic
939219398 2:139282025-139282047 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
939467203 2:142573344-142573366 CCTGCTTGGGGTATGGAGGTGGG - Intergenic
939870397 2:147520254-147520276 CCTGTTGGGGCCAGGGTGGCAGG + Intergenic
940260940 2:151779081-151779103 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
940989982 2:160086981-160087003 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
941818045 2:169817758-169817780 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
942445176 2:176072771-176072793 CCTGCTTGGGGGTCGGGGTCGGG + Intergenic
942460171 2:176163013-176163035 AGCGCTTGGGGGAGGGGGGCGGG + Intronic
942532174 2:176922915-176922937 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
942901797 2:181129067-181129089 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
942984112 2:182119052-182119074 CCTGCTGTGGGGTGGGTGGTGGG - Intronic
944504654 2:200398150-200398172 CCTCCTGGGGGGAGTGTGGCTGG + Intronic
944586997 2:201181226-201181248 CCTTCTTGGGAAAGGGGGGCCGG - Intergenic
946436819 2:219662551-219662573 CAGGCATGGGGGAGAGTGGCAGG - Intergenic
946977545 2:225169984-225170006 CCAGTTTGGGGCAGGGTAGCTGG + Intergenic
947220274 2:227785044-227785066 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
947228918 2:227866113-227866135 CCTGCTGTGGGGATGGAGGCAGG + Intergenic
947752547 2:232540438-232540460 CCTGATGGAAGGAGGGTGGCAGG - Intronic
947940426 2:234049692-234049714 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
948337798 2:237224161-237224183 CCTGCTGGTGGGTGGGTGGCGGG - Intergenic
948389194 2:237599928-237599950 GCTGCTCGGGGCAGGGAGGCTGG - Intronic
948675009 2:239591988-239592010 CCTGGTTGAGGAAGGATGGCTGG + Intergenic
948890401 2:240904635-240904657 CCTGCTGGGGGCAGGGCGGGTGG - Intergenic
948916566 2:241037384-241037406 CCTGCTGGGGGCAGGATAGCGGG + Intronic
948938833 2:241186170-241186192 CCTGCTGGACGGACGGTGGCTGG - Intergenic
948980944 2:241494460-241494482 CCTGCTCTGGGGAGAGAGGCAGG - Exonic
1168852929 20:989068-989090 CCAGCTTGGGAGATGGGGGCCGG - Intronic
1168882871 20:1223148-1223170 CCTGCTGGGGGGTGGGGGGAGGG + Intergenic
1169185559 20:3614124-3614146 CCTGTTTCTGGGAGGGTGGCGGG + Intronic
1170304232 20:14919976-14919998 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1170578293 20:17681054-17681076 CCTGATTAGGGGAGGCAGGCCGG - Intronic
1170917514 20:20642041-20642063 CCTGCTTGGGAGAGGAGGACAGG - Intronic
1172109801 20:32538284-32538306 CCTGATTGTGGGTGGGGGGCAGG - Intronic
1172167195 20:32906656-32906678 GCTGCTGGGGGGAGGGCTGCTGG + Intronic
1172248600 20:33463259-33463281 CCTGCGTGGGGCAGGGTAGGGGG - Intergenic
1173641778 20:44608092-44608114 CTTGCCTTGGGGAGGGTGTCTGG + Intronic
1173704603 20:45100790-45100812 CCTCCTTGGCGGGGGGTGGGGGG + Intronic
1173836413 20:46128878-46128900 CCTGCTTGGGGTGGGGGGCCTGG - Exonic
1174184726 20:48698413-48698435 ACTGCTTGGGGCAGAGCGGCGGG + Intronic
1174311604 20:49660035-49660057 CCTGAGTGGGAGAGGGTGTCTGG - Intronic
1174708576 20:52682065-52682087 GGTGCTTGGGGGAGGGTACCTGG + Intergenic
1175122347 20:56725441-56725463 GCTGCTTGGGGGACTGAGGCAGG - Intergenic
1175490033 20:59373945-59373967 CCTCCTTGGGGGTTGGGGGCAGG + Intergenic
1175823928 20:61926406-61926428 GCTGGCTGGGGGAGGCTGGCAGG - Intronic
1176023826 20:62975923-62975945 CCTGCTGGGGGAAGGTTGGGGGG - Intergenic
1176382655 21:6120915-6120937 CCTGGGTGGGTGAGGGTGGCGGG + Intronic
1176413383 21:6461031-6461053 TCTCCCTGGGGGAGGATGGCAGG - Intergenic
1176551895 21:8226769-8226791 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176552273 21:8231207-8231229 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176570804 21:8409768-8409790 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176571178 21:8413783-8413805 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176579092 21:8458345-8458367 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176819620 21:13644051-13644073 GCTGGTTTGGGGTGGGTGGCTGG - Intergenic
1179594236 21:42431286-42431308 CATGCTTGGGGCAGCGAGGCTGG - Intronic
1179688880 21:43069354-43069376 TCTCCCTGGGGGAGGATGGCAGG - Intronic
1179727679 21:43349410-43349432 GCTCCTGGGGGGAGGGTAGCCGG + Intergenic
1179740814 21:43417324-43417346 CCTGGGTGGGTGAGGGTGGCGGG - Intronic
1179922846 21:44516498-44516520 GCTGCTTGGGGGAGGGGAGAAGG - Intronic
1181326315 22:22051111-22051133 CTTGTTTGGGGGTGGGGGGCTGG - Intergenic
1181580990 22:23827923-23827945 CCTGCCTGGGGAAAGGAGGCTGG + Intronic
1181860790 22:25816491-25816513 CCTGTCTGGGGGTGGGGGGCTGG - Intronic
1182071088 22:27464125-27464147 CCTGCCTGGGGGACTGTGGAGGG + Intergenic
1182072278 22:27472130-27472152 CCTGCTTGGGGGAGTTTTCCAGG - Intergenic
1182552267 22:31106827-31106849 CCTGGTTGGGGGAGGATGGGAGG + Intronic
1182592678 22:31394192-31394214 CTGGCTTGGGGGAGGGAGGGGGG - Intergenic
1183228287 22:36564886-36564908 CCTGCGGGGCGCAGGGTGGCGGG + Exonic
1183365178 22:37403181-37403203 CCTGCCTGGGGGTGGGGGGAGGG - Intronic
1183463826 22:37968926-37968948 CAGGCTTGGAGGAGGGTGGATGG - Exonic
1183639386 22:39083894-39083916 CCTGCCTGGATGCGGGTGGCTGG - Intronic
1183708670 22:39489911-39489933 CTTCCTTGGGGCAGGCTGGCTGG + Exonic
1184078698 22:42202024-42202046 GCTGCGGGGGGAAGGGTGGCAGG - Intronic
1184259774 22:43307997-43308019 CCTGCTTGGGATTGGGTGGGGGG - Intronic
1184423370 22:44394900-44394922 CCTGAGTGGGGAAGGGTGGAGGG + Intergenic
1203256915 22_KI270733v1_random:143688-143710 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203257279 22_KI270733v1_random:147981-148003 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
949773720 3:7607881-7607903 CCTACTTGGGGGAGGGTGAGAGG - Intronic
949864094 3:8532994-8533016 AGTCCTTGGGGGAGTGTGGCGGG + Intronic
949885641 3:8691422-8691444 GCTGCTTGGGAGATGGAGGCAGG - Intronic
949932244 3:9088206-9088228 CCTGCAGGGGTCAGGGTGGCAGG + Intronic
949999296 3:9644209-9644231 CCTGTTGTGGGGTGGGTGGCTGG + Intergenic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950195449 3:11006199-11006221 TTTGCTTGGGAGAAGGTGGCAGG - Intronic
950459871 3:13114959-13114981 CCTGCGTGGGTGAGTGAGGCAGG + Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
951177334 3:19617310-19617332 CAGGCTTGGGGGAGGGTAGCGGG - Intergenic
952881245 3:37987340-37987362 CCTGCTAGGGGGAGGAGGGAGGG + Intergenic
952943039 3:38457797-38457819 CTTCCTTGGGGGAGGGCGGAGGG + Intronic
952960668 3:38587361-38587383 ACTGCATGGGGGATGGTGGGGGG - Intronic
953754287 3:45633194-45633216 CCTGTGGAGGGGAGGGTGGCGGG - Intronic
953788877 3:45931227-45931249 CCAGCTTCGGGGAGGGTAGCAGG - Exonic
954274731 3:49534845-49534867 CCTGATTGAGGGTGGGTGGGTGG + Exonic
954295788 3:49674024-49674046 CCGGCTTCGGGGAGGGTAGAAGG - Exonic
954337465 3:49928103-49928125 CCTGCATGGGGAAGGGTTGGCGG + Intronic
954458307 3:50611796-50611818 CCTGCGAGGGCGAGGGGGGCGGG + Intronic
954478657 3:50775741-50775763 CTTGCTGGAGGGAGGGTGGAAGG - Intronic
954574227 3:51666401-51666423 CCTGAGGGGGGCAGGGTGGCTGG + Exonic
954698993 3:52441959-52441981 CCTGCTTGGGTGTGGGCTGCTGG - Intronic
954873759 3:53787235-53787257 CCTGCTTGGAGGATGCTGCCTGG - Intronic
955408802 3:58642735-58642757 CCAGCTTGGAGTAGGGGGGCTGG - Intronic
955950653 3:64239235-64239257 CCTGCTGGGGGGCGGGGGGCTGG + Intronic
955971815 3:64444754-64444776 CCTGCTTGGGGAAGGGTGCGCGG + Intronic
956113729 3:65897461-65897483 CCTGCTGTGGGGTGGGGGGCAGG + Intronic
956290912 3:67658733-67658755 CCTATTTGGGGGAGGTTGGAGGG - Intergenic
956396036 3:68827033-68827055 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
957899857 3:86475099-86475121 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
958063769 3:88516971-88516993 CCTGCTTGAGGGTGGAGGGCAGG - Intergenic
958259686 3:91366264-91366286 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
958692722 3:97488490-97488512 CCTGCTGGGTTGAGGGTGGCAGG - Intronic
959071017 3:101702049-101702071 CCAGCTTGGGGGAAGGAGGAGGG + Intergenic
959215835 3:103448903-103448925 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
959253735 3:103982630-103982652 CCAGCTTGGGAGAAGGTAGCTGG + Intergenic
959399018 3:105876409-105876431 CCTACTTGGGGGACTGAGGCTGG + Intergenic
961387383 3:126530172-126530194 GCTCCTCGGGGCAGGGTGGCAGG + Intronic
961554796 3:127690460-127690482 GCTGCTGGAGGGAGGGTGGAGGG + Exonic
961674410 3:128555880-128555902 GGTGCCCGGGGGAGGGTGGCGGG - Intergenic
961738280 3:129015775-129015797 ACAGCTTGGGGTAGGGGGGCGGG - Intronic
962889519 3:139658931-139658953 GCTGCTTGAGGGAGGGGTGCAGG - Intronic
964217945 3:154309074-154309096 CCTACTTGGGGGGCGGAGGCAGG + Intronic
965592046 3:170370440-170370462 CCTGCTCGGGGGGGGGGGGGGGG - Intronic
965982564 3:174711340-174711362 CCTGCATGGAGGTGGGTGGAGGG - Intronic
966374116 3:179278038-179278060 CATCCCTGTGGGAGGGTGGCCGG - Intergenic
966875509 3:184319670-184319692 CCAGCTTGGGGGAGGGGGGACGG - Exonic
968024362 3:195426929-195426951 CCTTGGTGGGGGCGGGTGGCGGG - Intronic
968039805 3:195579458-195579480 CCATCTTGGGGCTGGGTGGCTGG + Exonic
968040469 3:195584701-195584723 ACTGCTTGGGGGTGGGGGCCGGG + Intergenic
968231548 3:197007615-197007637 CCTCCCTGGGGGAGGGTTTCAGG + Intronic
968375203 4:34380-34402 CTTGATGGGGGGAGGGTGGGAGG - Intergenic
968449059 4:666639-666661 GCTGACTGGGGCAGGGTGGCTGG + Intronic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968701560 4:2060165-2060187 CCTGGGTGGGGGCGGGTGCCAGG + Intronic
968707449 4:2086757-2086779 CCTTCCTGGGGGAGCATGGCCGG + Intronic
969046455 4:4340117-4340139 CCTGCTGGAGGGAGGGGTGCAGG - Intergenic
969189807 4:5508310-5508332 ACTGCTTGGGTGAGGGTAGAGGG - Intergenic
969200999 4:5605806-5605828 ACTGCACTGGGGAGGGTGGCGGG + Intronic
969495787 4:7525498-7525520 GCTGCTTGGGGGAAGGTGGAGGG - Intronic
969538432 4:7770796-7770818 CCTGCGTGGAGGGTGGTGGCAGG - Intronic
970398730 4:15697630-15697652 GCTGAGTGGGGGAAGGTGGCTGG - Intronic
970514823 4:16818060-16818082 CCTGATGGGAGGAGGGTGGCTGG + Intronic
970945301 4:21683968-21683990 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
971468867 4:26997495-26997517 CCTGAGTGGGTGAGGGTGTCAGG - Intronic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
973067888 4:45820199-45820221 CCTGTTTGGGGGTGGGGGACTGG + Intergenic
973808054 4:54544604-54544626 CCTCCATGAGGGTGGGTGGCCGG - Intergenic
974854386 4:67441893-67441915 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
974979779 4:68940540-68940562 CCTGTTGGGGGTTGGGTGGCTGG + Intronic
975087172 4:70355908-70355930 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
975443319 4:74436854-74436876 GCTGCTTGGAGGTGGGGGGCAGG + Intergenic
975484477 4:74919408-74919430 CCAGCTTGGAGGAGAGGGGCAGG + Intergenic
975950201 4:79761410-79761432 CCTGCTGGGGGGTGGGGGGAGGG - Intergenic
976807436 4:89063613-89063635 CCTGCTAGGGCCAGGGAGGCTGG - Intronic
977454827 4:97246035-97246057 ACTGGTTTGGGGAGGGTGGCAGG - Intronic
977979510 4:103306150-103306172 CCTGATTGGCGAAGAGTGGCGGG + Intergenic
978759091 4:112335536-112335558 CCTGTTTGAGGGAATGTGGCAGG + Intronic
979670648 4:123357210-123357232 CCAGCTGGGGCGAGGGCGGCGGG - Intergenic
980009734 4:127581616-127581638 CCTGCTTGAGGGAGGGTGCATGG + Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981200216 4:141971688-141971710 CCTGTTTGGGGGTCGGGGGCTGG + Intergenic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
983029551 4:162782786-162782808 CCTCCTTGGGTGAGGGGGGCGGG + Intergenic
983753895 4:171310135-171310157 CCTGTCAGGGGGTGGGTGGCTGG - Intergenic
984666156 4:182431673-182431695 CCTGCAGGGGTCAGGGTGGCAGG + Intronic
985459840 4:190094664-190094686 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
985654095 5:1121092-1121114 GCAGCTTGGGGAACGGTGGCGGG - Intergenic
986024603 5:3838744-3838766 TCTGCTGGGGGAGGGGTGGCGGG + Intergenic
987013961 5:13798047-13798069 CCTGTCTGGGGGTGGGGGGCTGG + Intronic
987327276 5:16823765-16823787 CCTGGCTGGGGGCGGGGGGCGGG + Intronic
987427005 5:17785002-17785024 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
988055449 5:26088420-26088442 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
988724698 5:33914849-33914871 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
988796581 5:34657229-34657251 CCTGCCTGGTGGGGGGTGGGGGG + Intronic
989849729 5:46194112-46194134 CCTGCTTGGGGGCAGGGGTCAGG - Intergenic
990012833 5:51021069-51021091 CCTGGCTGAGGGAAGGTGGCAGG + Intergenic
990209264 5:53464782-53464804 AATGGTTGGGGGAGGGTGCCGGG - Intergenic
990611321 5:57459607-57459629 CCTGCTTGAGGGAGGATAGTAGG + Intergenic
991168571 5:63593401-63593423 CCTGCTTGGCTGGGCGTGGCTGG - Intergenic
991590807 5:68249756-68249778 CCTGCTTGTGGTGGGGTGGGGGG + Intronic
992054695 5:72976778-72976800 CCTGTTTGGGGGTTGGGGGCTGG - Intronic
992106242 5:73451305-73451327 CCAGCTTGGGGGCGGGGAGCCGG - Intergenic
992558823 5:77929934-77929956 CCTGGTGCGGGGAGGCTGGCAGG - Intergenic
993345038 5:86772466-86772488 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
993626858 5:90235970-90235992 CCTGCTTGATGGAGAGTGTCTGG - Intergenic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
994388838 5:99165384-99165406 CCTGCTGGGGGGTGGGGGGATGG - Intergenic
994830971 5:104783611-104783633 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
994889131 5:105606392-105606414 CCTGTTTGGGGGTGGGAAGCTGG + Intergenic
995566910 5:113440373-113440395 TCTGCCTGGGGGTGGGTGGAGGG - Intronic
995628984 5:114112321-114112343 CCTGTTTGGAGGTGGGGGGCTGG + Intergenic
996141281 5:119912894-119912916 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997425428 5:133799621-133799643 CCTGCTGGGGGCAGGGTAGGAGG - Intergenic
998057149 5:139087919-139087941 CCTGGCTGTGGGTGGGTGGCTGG - Intronic
998367913 5:141642989-141643011 CCTGCCTGGGGGTGAGTGGAAGG - Exonic
999056473 5:148583284-148583306 CCCACTTGGGGGAGGGGGGAGGG + Intronic
999126918 5:149252711-149252733 CCAGCTTGGGTGAGGGTGGTGGG - Intronic
999405384 5:151302565-151302587 GCTGGTTGGGGGTGGGGGGCAGG + Intronic
1000214843 5:159145530-159145552 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
1001152610 5:169245345-169245367 CCTGCTTGGAGGACTGAGGCGGG - Intronic
1001392310 5:171388587-171388609 CGTGGTTGGGGGAGGGAGGGGGG + Intronic
1001701200 5:173707681-173707703 AATGCCTGGGGCAGGGTGGCTGG + Intergenic
1001757438 5:174181315-174181337 CTTGCTGGGTGGAGGATGGCTGG - Intronic
1001839711 5:174864812-174864834 CCTGCTGGGGCAAGGGAGGCTGG - Intergenic
1002000863 5:176195675-176195697 CCTCATTGGGGGAGTGTGGGGGG + Intergenic
1002076524 5:176711895-176711917 CCTGGATGGGGGTGGGTGGGAGG - Intergenic
1002340354 5:178512748-178512770 CCTGCTTGGGGCTGCGTGGAAGG - Intronic
1002495614 5:179609435-179609457 CCGGCTTGGGGTAGGAGGGCAGG - Exonic
1002702785 5:181137845-181137867 CCTGAGTGTGAGAGGGTGGCTGG + Intergenic
1002934363 6:1659146-1659168 CCTGCTCTGTGGAGGGAGGCTGG + Intronic
1003340653 6:5217354-5217376 TCTGGTTGGGGGTGGGTGGTAGG - Intronic
1003764557 6:9220447-9220469 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1005291137 6:24380033-24380055 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1005513127 6:26530013-26530035 CCTGATTGGGCGAAGGTGGAAGG - Intergenic
1005972148 6:30769776-30769798 CCTGCATGGGGGAGGGCAGGAGG - Intergenic
1006401684 6:33821479-33821501 CTGGCCTGGGGGTGGGTGGCAGG - Intergenic
1006606331 6:35259980-35260002 CCTGGGTGGGGGAGGGGGCCCGG - Intronic
1006800012 6:36753699-36753721 TCTGCTTGGGGGAGGGGGCCTGG - Intronic
1007104743 6:39275848-39275870 CCAGCTTGGTGGGTGGTGGCAGG + Intergenic
1007185371 6:39966864-39966886 CCTGCTGGAGGGTGGGTGTCAGG + Intergenic
1007302227 6:40876034-40876056 CCTGCCTGGGGGAGGGCTGGGGG + Intergenic
1007615636 6:43178436-43178458 CCTGCATGGTGGATGGTGCCTGG - Exonic
1007690544 6:43698364-43698386 CGTGCTTAGGTGGGGGTGGCAGG + Intergenic
1007702684 6:43773797-43773819 CTTGGATGGGGGAGGGTGGTTGG + Intronic
1008775828 6:55036536-55036558 CCTGTTAGGGGGAGGGAGGCTGG - Intergenic
1009913988 6:69969804-69969826 CCAGGTTGGCTGAGGGTGGCTGG + Intronic
1010349295 6:74852932-74852954 CATGCTTGGGGGTGGGCGGGGGG + Intergenic
1010718980 6:79261721-79261743 CCTGCTGGAGGCAGGGAGGCTGG - Intergenic
1010838437 6:80618040-80618062 CCTGTTGGGGGGTGGGCGGCTGG + Intergenic
1012978450 6:105805019-105805041 CCAACTTGGGGGATGGTGGGAGG + Intergenic
1013813833 6:114074137-114074159 CCTGTTTGGGGGTAGGAGGCTGG + Intronic
1013876473 6:114836686-114836708 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1015068315 6:129058139-129058161 CATGCATGGGTGAGGATGGCAGG - Intronic
1015541056 6:134314339-134314361 CTTGGTTGGGGGAGGGGGGTAGG + Intronic
1015579244 6:134705421-134705443 GCTGCTTGGGGGACCGAGGCAGG - Intergenic
1015706987 6:136098923-136098945 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1016289964 6:142518321-142518343 CCTGCTCTGGGGAAAGTGGCAGG + Intergenic
1016660976 6:146579746-146579768 CCTGTTTGGGGGTGGGGGGTTGG - Intergenic
1016838707 6:148504983-148505005 GATACTTTGGGGAGGGTGGCGGG - Intronic
1017636367 6:156447497-156447519 CCTGCATGGGAGAGGTGGGCAGG - Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1017768570 6:157626885-157626907 CCAGCTGGGGGGGGGGCGGCGGG + Intronic
1017889093 6:158624732-158624754 CCTGCATGTGGGAAGGTGGCAGG - Intronic
1018240307 6:161767754-161767776 CCTGGCTGGGGGTGGGGGGCTGG + Intronic
1018320847 6:162607049-162607071 CCAGCTTGGGAGTGGGTGGGTGG + Intronic
1018442118 6:163822935-163822957 CCTGCCTGGAGAAGAGTGGCAGG + Intergenic
1019348992 7:544411-544433 CCTGCCTGGGGGAGGCCGCCCGG - Intergenic
1019505268 7:1387339-1387361 CCAGCGTGGGGGAGGGGTGCTGG + Intergenic
1019597214 7:1863698-1863720 GCTCCTGGGTGGAGGGTGGCCGG + Intronic
1019608726 7:1924259-1924281 CCTTCTCGCGGCAGGGTGGCAGG + Intronic
1020130683 7:5556912-5556934 CCTGCAGGGAGGAGGGTGGGTGG + Intronic
1020633798 7:10672236-10672258 CCTGCTGGGGCCAGGGAGGCTGG - Intergenic
1022516478 7:30977976-30977998 CCTGCTCTGGGGAGAGAGGCGGG + Intronic
1023290812 7:38667205-38667227 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1023348398 7:39294777-39294799 CCTGATGGGTGTAGGGTGGCTGG + Intronic
1023503772 7:40878743-40878765 CATGTGTGGTGGAGGGTGGCAGG - Intergenic
1023970585 7:44987859-44987881 TCTGCCTGGGGGTGGGTGGGGGG - Intergenic
1024511402 7:50207491-50207513 CATGCTCCTGGGAGGGTGGCAGG + Intergenic
1024578891 7:50785683-50785705 CCAGCCTGGTGGAGGGAGGCTGG - Intronic
1025843525 7:65174561-65174583 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025879520 7:65521406-65521428 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1025893918 7:65681182-65681204 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025916987 7:65873570-65873592 CCGGCTTGGGGGAGTGGGCCAGG + Intronic
1026800693 7:73397985-73398007 CCTTGTTGGGGGTGGGGGGCGGG + Intergenic
1026888338 7:73967529-73967551 ACTGCTTGGGGGAGGCTGCTGGG + Intergenic
1026933118 7:74236184-74236206 CCTGGGTGGGGCAGGGTGGGTGG - Intronic
1027138179 7:75639153-75639175 CATGCTGCGGGGAGGGCGGCCGG + Intronic
1027225915 7:76243662-76243684 GCTGCTTGTGGGGGGCTGGCAGG - Intronic
1027876355 7:83774256-83774278 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1027986516 7:85298524-85298546 CCTTGCTGGGGAAGGGTGGCTGG - Intergenic
1028505875 7:91569511-91569533 CCTAATTGGGGTAGGGTGGGAGG + Intergenic
1028992328 7:97062462-97062484 CCTGTCTGGGGGTGGGCGGCTGG + Intergenic
1029403331 7:100358519-100358541 CAGGCATGGGGGAGGGTGGAGGG - Intronic
1029484273 7:100829594-100829616 CCTGCATCGGGGAGGGAGGAGGG - Intronic
1029493450 7:100884586-100884608 GCAGCCTGGGGGAGGGGGGCGGG + Intronic
1030634038 7:111927849-111927871 CCTGCTCAGGGGAGAATGGCAGG - Intronic
1031366531 7:120906690-120906712 CCTGTCTTGGGGTGGGTGGCTGG + Intergenic
1031524374 7:122807107-122807129 ACTGCTTGTAGCAGGGTGGCAGG - Intronic
1031678830 7:124645565-124645587 CCTGCTTGGGGGAGAGGCTCAGG + Intergenic
1031754392 7:125619242-125619264 CCTGCTTGGGTGGGATTGGCTGG - Intergenic
1031940997 7:127789139-127789161 ACTGCTGGGGGCAGGGTGGAGGG - Intronic
1032097634 7:128947466-128947488 CCTGCAGGGGGCAGGCTGGCAGG - Exonic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1032438689 7:131924155-131924177 GCTACTCGGGGGAGGGGGGCGGG - Intergenic
1033025703 7:137770309-137770331 CCTGTCTGGGGGTGGGAGGCAGG + Intronic
1034461204 7:151198985-151199007 CCTGGTTGGGTGAGGGGAGCTGG + Exonic
1034533809 7:151714340-151714362 CGTGCGTGTGGGAGGATGGCAGG - Intronic
1034680334 7:152923662-152923684 CCTGATTGTGGGAGGAGGGCAGG + Intergenic
1035320399 7:158025610-158025632 CCACCTTGGGGGATGATGGCTGG + Intronic
1035356896 7:158281175-158281197 GCTGCTTGGGAGAGTGAGGCAGG + Intronic
1035602644 8:905800-905822 CGTGCTTGGGGGCGGGAGGGTGG - Intergenic
1035605320 8:926577-926599 CCTGCTGGGAGGAGAGCGGCAGG + Intergenic
1036072497 8:5456794-5456816 CCTGCTTCTGGCAGGGTGGCAGG - Intergenic
1036808874 8:11853632-11853654 CGTGCTTCGGGCAGGGGGGCGGG - Intronic
1037880928 8:22573060-22573082 CCTGCTTGGGGCAGGGCAGGGGG - Intronic
1038750901 8:30294891-30294913 CCTGTCGGGGGGTGGGTGGCTGG - Intergenic
1038992130 8:32879165-32879187 GCTGCCCAGGGGAGGGTGGCAGG - Intergenic
1042613793 8:70626821-70626843 CCTGTTGTGGGGTGGGTGGCTGG - Intronic
1043463750 8:80486135-80486157 CCGGGCTGGGGGAGGGGGGCTGG - Intronic
1043949553 8:86292377-86292399 CCTTTTTGGGGGAGGGGGGATGG - Intronic
1044053388 8:87538392-87538414 CCTGCTGGGGGGTGGGGGGAGGG - Intronic
1044356159 8:91225019-91225041 CCTGCTGGGGCCAGGGAGGCTGG - Intronic
1045062778 8:98423590-98423612 GCTGCTGTGGGGAGGATGGCTGG + Intronic
1045202282 8:99996104-99996126 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1047219875 8:122910730-122910752 CCTGCTGGGGGGTGGGGGGTGGG + Intronic
1047317119 8:123745032-123745054 GCTGGTTGGTGGAGGGCGGCGGG + Intergenic
1047641329 8:126824686-126824708 ATTGCTTGGGGGTGGGTGGAGGG + Intergenic
1048015266 8:130491312-130491334 CCTGCCTTGTGGGGGGTGGCGGG + Intergenic
1048846631 8:138608779-138608801 CCTGAGTGGGGGAGTGTGGTGGG - Intronic
1049149806 8:141027253-141027275 CTTGCCTGGGGGAGAGGGGCTGG - Intergenic
1049288303 8:141788444-141788466 CATGCTGGGGAGGGGGTGGCTGG - Intergenic
1049608142 8:143539190-143539212 CCGGCTTGGACGAGGGTAGCGGG + Exonic
1049811222 8:144573449-144573471 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1049850524 8:144827784-144827806 CCGCCGCGGGGGAGGGTGGCTGG - Intronic
1049941092 9:546661-546683 ACTGCTTGGGGGAGTGGGGGTGG - Intronic
1050907041 9:11017117-11017139 CCTGTTTGGGGGAAGATTGCTGG + Intergenic
1051409260 9:16771925-16771947 CATGGTGGGGGGAGGATGGCAGG + Intronic
1051481827 9:17569977-17569999 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1051695225 9:19760913-19760935 CCGGGTGGGGGGAGGGTGGAGGG + Intronic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1052261104 9:26517157-26517179 CCTGCTTGGGAAGGGTTGGCAGG - Intergenic
1052993093 9:34533568-34533590 CCAGCATGGGGCAGGGTGGGAGG + Intergenic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1055350178 9:75378551-75378573 CCAGGATGGGGGAGGGTGGCAGG + Intergenic
1055544064 9:77348457-77348479 CCTGTTGGGGGCATGGTGGCAGG + Intronic
1055971956 9:81920368-81920390 GCTGGTTGGGGTAGGGTGTCAGG + Intergenic
1055973709 9:81935440-81935462 GCTGGTTGGGGTAGGGTGTCAGG + Intergenic
1055975463 9:81950535-81950557 GCTGGTTGGGGTAGGGTGTCAGG + Intergenic
1056416827 9:86385371-86385393 CCTGCTTGGGGGAGGGTAACTGG + Intergenic
1056852252 9:90094563-90094585 CCTGCTTGGGGTGGGGTTGTGGG + Intergenic
1056888641 9:90468610-90468632 ACTGCTTGGGGAAGGGTGATGGG - Intergenic
1057217747 9:93238824-93238846 CCTGCTTGGAGGTGGGGAGCCGG - Intronic
1057232937 9:93335842-93335864 CCTGCGTTGGGTCGGGTGGCGGG - Intronic
1057252575 9:93515779-93515801 CCTGCGTTGGGTCGGGTGGCGGG + Intronic
1057768546 9:97945493-97945515 CCTGTCTGGGGGTGGGGGGCAGG - Intergenic
1058455988 9:105138718-105138740 CCAGCTGTGGGGAGGGAGGCGGG - Intergenic
1060586938 9:124792540-124792562 CTGGCCTGGAGGAGGGTGGCAGG + Intronic
1060662735 9:125413986-125414008 GCTGTTGAGGGGAGGGTGGCTGG + Intergenic
1060690459 9:125653526-125653548 CCTGCTTAGGGGAGAAGGGCAGG + Intronic
1060747601 9:126148008-126148030 ACTCCTTGGTGGGGGGTGGCAGG + Intergenic
1060821119 9:126662047-126662069 GCTGCGTGGGGGAGGGGTGCAGG - Intronic
1060822964 9:126672010-126672032 CCTGCCTGGGGCAGGGCTGCTGG + Intronic
1060984174 9:127810115-127810137 CCAACTTGGGGGTGGGCGGCAGG + Intronic
1061003872 9:127917308-127917330 CCTGCCTGGGCGAGGCTGTCGGG + Intergenic
1061364984 9:130168002-130168024 ACTGCTTGGGGAAGGGTGGGGGG - Intergenic
1061695801 9:132372482-132372504 TCTGCTTGGTGGAGGGAGGAGGG + Intergenic
1061958691 9:133977101-133977123 CAGGCTTGGGGCAGGGCGGCTGG - Intronic
1062024319 9:134333290-134333312 CCTGCTGGGGTGAGGGATGCCGG + Intronic
1062614084 9:137388210-137388232 CACGTTTTGGGGAGGGTGGCTGG - Intronic
1062686603 9:137816943-137816965 CAGGCCTGGGGGAGGGTGGCCGG - Intronic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1062729854 9:138102820-138102842 CCTCCTGGGGGGCGGGTTGCAGG - Intronic
1203527740 Un_GL000213v1:105519-105541 GCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1203473453 Un_GL000220v1:129803-129825 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203574021 Un_KI270744v1:159770-159792 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
1185675843 X:1848970-1848992 GCTACTTGGGAGATGGTGGCAGG - Intergenic
1185952472 X:4451946-4451968 CCTGCTTCAGTGAGGGAGGCTGG + Intergenic
1186219679 X:7336242-7336264 CCTCCTTTGGGGCGGGTGGGGGG - Intronic
1186334505 X:8572282-8572304 CCTGCTTGGGGGAGGTGGGGAGG - Intronic
1186559102 X:10591607-10591629 GGTGCTTGGAGGAGGGTAGCTGG - Intronic
1186586039 X:10874035-10874057 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1187028987 X:15466441-15466463 CCTGCAGGGGGCAGAGTGGCGGG - Intronic
1187388734 X:18872081-18872103 CCAGCTGGGGGCAGGGGGGCGGG - Intergenic
1187940484 X:24376008-24376030 CCTGCCTGGGTGAGGGAAGCTGG + Intergenic
1188463891 X:30456419-30456441 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1188950712 X:36370248-36370270 CCTGCTGGGGGGTGGGGGGCTGG - Intronic
1189893070 X:45625786-45625808 CCTGTTGTGGGGAGGGGGGCTGG - Intergenic
1190221641 X:48515825-48515847 GCTGGGTGGGGGCGGGTGGCAGG + Intronic
1190894036 X:54597910-54597932 ACTGCTGGGGGGATGGTGGAGGG + Intergenic
1191065943 X:56348024-56348046 CCTGTTGGGGGGAGGGGGTCTGG - Intergenic
1192174852 X:68879264-68879286 CCAGCTCCTGGGAGGGTGGCAGG - Intergenic
1192361242 X:70441324-70441346 CCTGCTTGGGAGACTGAGGCAGG + Intergenic
1192589590 X:72348927-72348949 CTTCCTTGGGGGAGGGTGATTGG - Intronic
1192678082 X:73221371-73221393 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1192788634 X:74358009-74358031 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1193507074 X:82357782-82357804 CCTGCTGTGGGGTGGGGGGCGGG + Intergenic
1193575188 X:83186684-83186706 GCTGCTTCGGGGAGGGTAGGGGG - Intergenic
1193825158 X:86216356-86216378 CCTGTTTGGGGGTGGTGGGCTGG - Intronic
1194237252 X:91399535-91399557 CCTGCTTGGGTGGAGGTGGCAGG - Intergenic
1194294639 X:92113211-92113233 CCTGGCTGGGGCTGGGTGGCAGG + Intronic
1194486237 X:94490610-94490632 CCTGTTGGGGGGTGGGTGGAAGG - Intergenic
1194989760 X:100534513-100534535 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1194990013 X:100537275-100537297 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1195013065 X:100752310-100752332 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
1196166949 X:112545954-112545976 CCTGTTTGGGGGTTGGGGGCTGG - Intergenic
1196893354 X:120310726-120310748 GCTGATTGGGGGGGGGGGGCGGG - Intronic
1197079790 X:122398358-122398380 CCTGCTGTGGTGGGGGTGGCAGG - Intergenic
1197573236 X:128176140-128176162 CCTGCTTGGGGGTGGAAGGTGGG + Intergenic
1197657374 X:129131794-129131816 CCTGCTTGCTGGAGGATGCCAGG - Intergenic
1198457924 X:136835658-136835680 GCTGCTTGAGGGAGGGAGGGAGG + Intergenic
1198882292 X:141294754-141294776 GCTGCTAGGGGGTGGGTGGAGGG - Intergenic
1199174216 X:144765757-144765779 CCTGCTTAGGAGAGGATTGCAGG - Intergenic
1199282882 X:146022569-146022591 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1199612972 X:149633345-149633367 CCTGCTTGGGGCACGGTCACTGG - Intergenic
1199866018 X:151850959-151850981 ACCGCTTGCGGGAGGGGGGCAGG - Intergenic
1199976857 X:152899257-152899279 CCTGGCTGGGGGCGGGAGGCAGG + Intergenic
1200081722 X:153580157-153580179 TCTGGTTGGGGGACGGGGGCGGG - Exonic
1200233901 X:154459172-154459194 CCAGCTTGAGGGCGGGAGGCGGG - Intronic
1200243197 X:154508347-154508369 CCTAGTTGGGGGGGGGTGGGGGG + Exonic
1201063637 Y:10069542-10069564 GCTGCTGAGGCGAGGGTGGCGGG + Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1202370991 Y:24195295-24195317 CATGCTTGGTGGGGGGTGGGAGG + Intergenic
1202499793 Y:25474822-25474844 CATGCTTGGTGGGGGGTGGGAGG - Intergenic