ID: 950575606

View in Genome Browser
Species Human (GRCh38)
Location 3:13830403-13830425
Sequence AAACATGAACAGATGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950575606_950575616 22 Left 950575606 3:13830403-13830425 CCATGCCCCATCTGTTCATGTTT 0: 1
1: 0
2: 2
3: 48
4: 346
Right 950575616 3:13830448-13830470 GCACCAACCAAGTGAAACACGGG 0: 1
1: 0
2: 1
3: 11
4: 99
950575606_950575615 21 Left 950575606 3:13830403-13830425 CCATGCCCCATCTGTTCATGTTT 0: 1
1: 0
2: 2
3: 48
4: 346
Right 950575615 3:13830447-13830469 TGCACCAACCAAGTGAAACACGG 0: 1
1: 0
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950575606 Original CRISPR AAACATGAACAGATGGGGCA TGG (reversed) Intronic
900107195 1:987948-987970 AAACATGAAAAGACTGGGCGCGG - Intergenic
900630979 1:3635086-3635108 AACCATGCACAGGTGAGGCAGGG + Intronic
901006791 1:6175629-6175651 AAGCATGGACAGATAGTGCATGG + Intronic
901471932 1:9463130-9463152 AAAAATGGACAGATTGGGCATGG - Intergenic
902299537 1:15492061-15492083 AGACATGAATAAATGGGGCTGGG + Intronic
902309512 1:15570499-15570521 AAAAATGAACAAATCTGGCATGG - Exonic
902457304 1:16544217-16544239 AAAAATTAGCAGATGGGGAATGG + Intergenic
902483916 1:16729050-16729072 AAAAATTAGCAGATGGGGAATGG - Intergenic
902494863 1:16863695-16863717 AAAAATTAGCAGATGGGGAATGG - Intronic
903077688 1:20784764-20784786 AAACATGAATAGGCCGGGCACGG - Intronic
903803457 1:25987434-25987456 AAATAAGAACACATGGGGCCGGG + Intronic
903999778 1:27332319-27332341 AAACCTGAAGAGCTGTGGCAAGG - Intronic
904099810 1:28015422-28015444 AAACATGAAAAGAAGGAGAATGG + Intronic
905073340 1:35247166-35247188 AAAAATGAGCAAATGGGGCCGGG - Intergenic
905094664 1:35459211-35459233 AAACTTGAACAGATTGAGAAGGG + Intronic
905178707 1:36153941-36153963 AAAAATGAACAGATAGGCCAGGG - Intronic
905735512 1:40323002-40323024 AAATATTAACAGATTGGGCTGGG + Intergenic
905816806 1:40957665-40957687 AAAAATGAAAAAATGGGGCCGGG + Intergenic
906606402 1:47175417-47175439 AAACATGAACAACACGGGCATGG + Intergenic
907225216 1:52939958-52939980 AAACATGTACAGGTTGGGCATGG - Intronic
907360049 1:53906942-53906964 AAACAAAAACAGACCGGGCACGG - Intronic
908883022 1:68754653-68754675 AAAGATTAAAAGATGGGGCCGGG + Intergenic
908946432 1:69503473-69503495 AATCAGGGACAGATGGGGCAAGG + Intergenic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG + Intronic
911492280 1:98585218-98585240 AACCATCAAGAGATGGGGAAAGG + Intergenic
913168705 1:116212699-116212721 AAAAAAAAAAAGATGGGGCAAGG + Intergenic
914344900 1:146790550-146790572 ACACATGGACACATGGGTCAGGG - Intergenic
914567394 1:148882163-148882185 AGACAAGAAGAGATGGGGCAGGG - Intronic
914605427 1:149248082-149248104 AGACAAGAAGAGATGGGGCAGGG + Intergenic
915102975 1:153513908-153513930 CAAGATGAACAGATGGTCCAAGG + Intergenic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917883582 1:179362870-179362892 AAAGTTGAACGGATGAGGCAGGG - Intergenic
919736756 1:200957433-200957455 AAACATGGTAAAATGGGGCAGGG + Intergenic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921350999 1:214234507-214234529 AAAATTGAAAAGATGAGGCAAGG + Intergenic
921777642 1:219120780-219120802 AATCAGAAACAGATGGTGCAAGG - Intergenic
922053978 1:222022661-222022683 TAACATGGAAAAATGGGGCAAGG + Intergenic
923372171 1:233325672-233325694 AAACTTGAACAGATGAGGAGCGG + Intergenic
923397395 1:233580576-233580598 AGACAAGAACAGATGGAGGAAGG - Intergenic
924054150 1:240108738-240108760 AAAAATGCACAGAAGGGGCCTGG + Intronic
924905722 1:248449907-248449929 AAAGATGACCTGATGGGGAATGG + Intergenic
924922169 1:248642131-248642153 AAAGATGAGCTGATGGGGAATGG - Intergenic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063863390 10:10337384-10337406 AAACCTGAACAGATGTATCAAGG - Intergenic
1064207345 10:13335373-13335395 AAAAATGCACAGGTCGGGCACGG + Intronic
1066674788 10:37876619-37876641 AAAATTGAAAAGATGGGGCCGGG - Intergenic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1068076257 10:52258918-52258940 TTAAATGAACAGATGGGGAAAGG + Intronic
1069091669 10:64206808-64206830 AAACATGAACAGAGTGAGAAAGG - Intergenic
1069916182 10:71788748-71788770 AAACATGAAAAAATGTGGCCGGG - Intronic
1070314476 10:75296741-75296763 AGATATGAAAACATGGGGCAGGG + Intergenic
1070435649 10:76390240-76390262 GCACATGAAAAGATGGGGAAAGG - Intronic
1071303092 10:84272518-84272540 ACAGGTGAACAGATGGGGCTGGG - Intergenic
1072795946 10:98354686-98354708 CAACCAGAACAGATGGGCCAAGG - Intergenic
1074168103 10:110904151-110904173 AACCAGGGACAGATGGGCCAAGG + Intronic
1075285042 10:121176485-121176507 AAACTAAAACAGATGGGGTAAGG + Intergenic
1078136580 11:8657097-8657119 AGACATGAACAGCAGGGCCAAGG + Intronic
1082801594 11:57418949-57418971 AAACATCAGCAGAAGAGGCAGGG + Intronic
1084069397 11:66724499-66724521 AAACCTCAACAGTTGGGGCCAGG - Intronic
1084335024 11:68452207-68452229 AAACCTGAACAGGCCGGGCACGG + Intergenic
1085023987 11:73226010-73226032 AAAGGTGGACAGACGGGGCAGGG + Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1086497488 11:87419572-87419594 AAAGTTGAAAAGATGGGTCAGGG + Intergenic
1086764099 11:90673572-90673594 GCACATGAGCAGATGTGGCAGGG - Intergenic
1087401338 11:97669999-97670021 AAACATAAGTAGATGGGGCATGG - Intergenic
1088267076 11:107998063-107998085 AAAAATGACCAGCTGGGGCCTGG + Intergenic
1088626731 11:111735089-111735111 AAACAAGAGTAGAAGGGGCATGG + Intronic
1089378706 11:118012720-118012742 AATCAAGTACAGAGGGGGCAGGG + Intergenic
1090448847 11:126788425-126788447 GAACATGGACAGAGGAGGCAAGG - Intronic
1093184010 12:15999153-15999175 AATCAAGAACAGAAGGGCCAGGG + Intronic
1093306707 12:17529043-17529065 AAGCAGGAACAGATGGGGTTGGG + Intergenic
1093461022 12:19407009-19407031 AAAAATGTAAAGATTGGGCATGG + Intronic
1093481694 12:19610757-19610779 AAACATTAACAAATGGGTAAAGG - Intronic
1093914859 12:24790113-24790135 AAACATGTACACATGAAGCATGG + Intergenic
1094721444 12:33068696-33068718 ACACATAAACACATGGGGCAGGG + Intergenic
1094811275 12:34140660-34140682 ATATATGAGCAGGTGGGGCATGG + Intergenic
1097681211 12:62650957-62650979 AGACATAAACACATGGGGAAAGG + Intronic
1098171039 12:67747507-67747529 GAACAGGAACAGATTGGGAAAGG + Intergenic
1098504453 12:71233073-71233095 GAACATGAATGGATGGGGGAAGG - Intronic
1099237187 12:80095626-80095648 GACCAGGAACAGATGGGGAAGGG + Intergenic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1101570979 12:105953539-105953561 AAAGATGAAGAGCTGGGGCCTGG + Intergenic
1102114859 12:110395036-110395058 AAACATGGAGAGAGGGAGCAGGG + Intronic
1102593010 12:113971433-113971455 AAACATATACAGACCGGGCATGG - Intergenic
1102621660 12:114200700-114200722 AAAATTGTACAGATGGGGGATGG - Intergenic
1103204425 12:119117357-119117379 CAACATGGAGAGATGGGGCAGGG - Intronic
1103885089 12:124194491-124194513 AAACAAGAAACGGTGGGGCAGGG - Intronic
1103932415 12:124457739-124457761 AAACAGGAACATGTGGCGCAGGG + Intronic
1104348460 12:128024169-128024191 AAAAATGAACAGACTGGGCATGG + Intergenic
1105073534 12:133253350-133253372 AAACATCATCTCATGGGGCAAGG + Intergenic
1106483422 13:30153869-30153891 ATAAATGAAAAGCTGGGGCAGGG + Intergenic
1107417038 13:40210378-40210400 TAACATGGACAAATGAGGCATGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108701869 13:52950612-52950634 AAACAGGAAAAGGAGGGGCATGG - Intergenic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1110766881 13:79290418-79290440 AGACATACACAGTTGGGGCAGGG - Intergenic
1112491870 13:99873078-99873100 AAACCTCCACAAATGGGGCAGGG - Intronic
1114638618 14:24203763-24203785 AAACAAAAACAGACGGGGCGCGG + Intronic
1115480050 14:33851710-33851732 ATACATGAACAGATGGGAGGAGG + Intergenic
1115625021 14:35182352-35182374 AAAGATGAACCGACTGGGCACGG + Intronic
1116020011 14:39448834-39448856 GAACAAGAACAGATGTAGCATGG - Intergenic
1118057705 14:62098971-62098993 GAACATGTACAGATGAGACAGGG + Intronic
1118119724 14:62826337-62826359 AAACATAAAGAGATGGGTAAAGG - Intronic
1119001446 14:70885709-70885731 AAAGATGAAGAGATGTGCCAGGG - Intergenic
1119080304 14:71686740-71686762 AATCCTGAAGAGATGGGGAAAGG - Intronic
1121016115 14:90550281-90550303 ATACATCAACAGATGAGGCAGGG - Intronic
1121288769 14:92757505-92757527 CAAAATCAACAGATTGGGCAGGG - Intergenic
1122345623 14:101057780-101057802 AAAAATGGACAGATGGGAAAAGG - Intergenic
1123972212 15:25517902-25517924 AAAAATGCACAGAGGGGGCCGGG - Intergenic
1125636695 15:41194717-41194739 AAACATGAACAGATATGCCAAGG + Intronic
1125741075 15:41965396-41965418 AAATGTGAACAGATGGGGTTTGG + Intronic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1126190261 15:45871504-45871526 AAAGACTAACAGGTGGGGCAGGG - Intergenic
1126491449 15:49241351-49241373 AAACATGAACATTTGAGGAATGG + Intronic
1130526302 15:84709736-84709758 AAAAATGAACAGAAGAGGCCAGG - Intronic
1131148708 15:90033531-90033553 AAAAAGGAACATATGGGACAAGG - Intronic
1132737703 16:1395148-1395170 AAAAATGAACAGACCGGGCACGG - Intronic
1132986761 16:2771311-2771333 AAACATGAAAAGTTGGGGGGAGG - Exonic
1133199377 16:4193321-4193343 AACAATGATCAGGTGGGGCATGG - Intronic
1134260973 16:12650603-12650625 AAAAATGTAGAGATGGGGTAGGG - Intergenic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1137663963 16:50237195-50237217 AAAAGTGAAGAGATGGGGCGGGG + Intergenic
1137680337 16:50337553-50337575 AAGAATGAACAGATGAGGCCAGG - Intronic
1138157865 16:54722530-54722552 ACACATGAAGAGGTGGGGCCAGG + Intergenic
1138237915 16:55401155-55401177 AGAACTGAACAGCTGGGGCATGG - Intronic
1139767171 16:69240670-69240692 AAAGATCACCAGTTGGGGCATGG + Intronic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1139989092 16:70924754-70924776 ACACATGGACACATGGGTCAGGG + Intronic
1140509578 16:75497173-75497195 AATCATGAACAGGCCGGGCACGG - Intergenic
1141330689 16:83108290-83108312 AAACATTTACAGGTGGGGCATGG - Intronic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1142680140 17:1542675-1542697 ACAGATGCACAGATGGGGAAGGG + Intronic
1143593527 17:7900272-7900294 AAAAACTAAAAGATGGGGCAAGG - Exonic
1144480689 17:15626752-15626774 AAACAAGAACACCTGGGGCGTGG + Intronic
1144640838 17:16935691-16935713 AAATATGATCAGAAAGGGCATGG - Intronic
1144917619 17:18736989-18737011 AAACAAGAACACCTGGGGCGTGG - Intergenic
1144947997 17:18979584-18979606 AAACATGAACTTCTGGGCCAGGG + Exonic
1146279323 17:31535127-31535149 AAACATGAACAGGCCAGGCATGG + Exonic
1147024441 17:37567780-37567802 AAACAGGAACAGAGGAGACATGG + Intronic
1149295322 17:55256860-55256882 ATGCATTAACAGATGGGGAATGG + Intergenic
1149879712 17:60276797-60276819 AAAAATGATCAGATTGGTCATGG + Intronic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1152175764 17:78786163-78786185 AAAGATGAAGAGATGGGGAAGGG - Intergenic
1152590982 17:81212017-81212039 AAATATGAAAAGATGTGGCCGGG + Intronic
1153828766 18:8901052-8901074 AAATACCATCAGATGGGGCAGGG - Intergenic
1154259665 18:12819513-12819535 ACACAAGAACATCTGGGGCAGGG + Intronic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1155416523 18:25605127-25605149 CACCATGAACAGAAGGGGCTGGG + Intergenic
1157121818 18:44918259-44918281 CAACATGCACTTATGGGGCAAGG + Intronic
1157766709 18:50302897-50302919 AAAGATGAACCCATGGGCCAAGG + Intergenic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158490484 18:57905797-57905819 AGACATGGACAGCTGGGCCATGG + Intergenic
1158803302 18:60939586-60939608 ATACATGTACAAATGGGGCCGGG + Intergenic
1159249019 18:65849705-65849727 AAACATGAAAAAATGGGCCGGGG - Intronic
1159872102 18:73769990-73770012 AAACATGACCAGATGTCTCAGGG + Intergenic
1161204083 19:3031476-3031498 AAACATAAAGAGATGGTGAAGGG - Intronic
1161215967 19:3095152-3095174 CAACATGAACAGTTAAGGCAGGG - Intronic
1161421086 19:4176207-4176229 AAACAGGAACAATTGGAGCATGG + Intronic
1161472620 19:4466911-4466933 ATATATAAACAGACGGGGCATGG - Intergenic
1161503255 19:4629411-4629433 AAAAAAGAAAAGATGGGGCCCGG - Intergenic
1162465256 19:10835857-10835879 AGAGATGGACAGATGGGGCGGGG - Intronic
1162526842 19:11211152-11211174 AGAAATGAAAAGGTGGGGCAGGG - Intronic
1163241067 19:16064285-16064307 CAGCCTGAACAGCTGGGGCAGGG + Intergenic
1164210692 19:23094967-23094989 AAATATAACCAGATGAGGCACGG - Intronic
1164311390 19:24049360-24049382 AAATATGACCAGATTGTGCATGG - Intronic
1165287333 19:34852950-34852972 AAGCAGGAACAGAGAGGGCAGGG + Intergenic
1166738594 19:45100758-45100780 AAACAGAAACAGGTGGGGTAAGG + Intronic
1166811524 19:45517359-45517381 ACAGATGAACAGATGGGGGAGGG - Intronic
1166848796 19:45747403-45747425 CTACATGATCAGACGGGGCAGGG - Intronic
1167209006 19:48121504-48121526 AAATAAGAACAAATGGGGCCGGG + Intronic
1168033534 19:53700717-53700739 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168038087 19:53736355-53736377 ACACAAGTACAGGTGGGGCACGG - Intergenic
925010082 2:477868-477890 AAACATGAACAGATATTTCATGG + Intergenic
926967132 2:18427311-18427333 ATAGATGAACAGATGAGGAAAGG + Intergenic
927371408 2:22359355-22359377 AGATCTGAACAGATGGGGAATGG + Intergenic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
930605970 2:53493353-53493375 AGACAAGAACAGATGGAGCAGGG + Intergenic
930722640 2:54652779-54652801 AAACATGAAAAGATGCTTCATGG - Intronic
931984835 2:67731307-67731329 AGACAGGAACAGATGTGGGAGGG - Intergenic
932230493 2:70080219-70080241 AAAAAAAAACAGAAGGGGCAGGG - Intergenic
932544540 2:72694149-72694171 AAGAATGAACTGGTGGGGCATGG + Intronic
932873830 2:75430408-75430430 AAACAAGAGCAGAAGGGACAGGG - Intergenic
933481504 2:82862777-82862799 AAAAATGACCTGATGGGGCGTGG - Intergenic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
934705203 2:96472572-96472594 AAATATTAACAGGTCGGGCACGG + Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
937629053 2:124078827-124078849 AAACGTCAATATATGGGGCATGG + Intronic
937959817 2:127448753-127448775 AGTCATGAATAGATGGGACATGG - Intronic
939085522 2:137714410-137714432 CAACAGGAAGGGATGGGGCAAGG + Intergenic
939090370 2:137773345-137773367 AAACATGAAGATAATGGGCAGGG + Intergenic
940372955 2:152922935-152922957 AAAGAAGAAGAGAAGGGGCAGGG - Intergenic
940761419 2:157742953-157742975 AAACATGCAGAGGAGGGGCACGG - Intronic
940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG + Intronic
942122687 2:172793843-172793865 AAATATGAACAGACTGGGCATGG + Intronic
942605237 2:177683567-177683589 ACACAGGAACAGAAGGGGCCAGG - Intronic
942747893 2:179256515-179256537 AAACTTTAACAGATGGGGCCGGG + Intronic
944713396 2:202355933-202355955 AAAAATGGACAAATGGGGCCAGG - Intergenic
944863164 2:203834713-203834735 ACACATGGACACAGGGGGCATGG + Intergenic
945341759 2:208664431-208664453 ATAGATGAACAGATGGGTGAGGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
947476049 2:230448678-230448700 AAGCATGAACAGATGTGGAGAGG + Intronic
947489616 2:230582216-230582238 AAGCATGAACAGATGTGGAGAGG - Intergenic
947927396 2:233933709-233933731 TAGCAAGAACAGATGGGGCGGGG + Intronic
1170562812 20:17570889-17570911 ATACACGGACAGATCGGGCAGGG - Intronic
1170882372 20:20308418-20308440 AAAGGTGTACAGATGGGGAAGGG + Intronic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1171239140 20:23551081-23551103 AAACAAAACCAGATGGGTCAAGG + Intergenic
1171369777 20:24654266-24654288 AAACCTGAACAAATGGGTGAGGG + Intronic
1171814717 20:29775461-29775483 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1172262362 20:33579190-33579212 AAACATGAATAGACCAGGCATGG - Intronic
1172404532 20:34677753-34677775 AAACATAAACATTTTGGGCAGGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1178525689 21:33326489-33326511 AAACATAAATAGATCGGGCGTGG - Intronic
1178683319 21:34691610-34691632 AAACATGAGGATATAGGGCAAGG + Intronic
1180245367 21:46543742-46543764 GCACATGCAGAGATGGGGCAAGG - Intronic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1182552321 22:31107032-31107054 AAACATGAAGTGATGGGGGATGG + Intronic
1184245607 22:43234465-43234487 AGACAGGCCCAGATGGGGCAGGG - Intronic
1184535071 22:45081250-45081272 AAAAAAGTAGAGATGGGGCAGGG - Intergenic
949219460 3:1613168-1613190 AAACATAAATAAATGGAGCATGG - Intergenic
949388546 3:3533343-3533365 AAAGATGAACAGTTTGAGCACGG - Intergenic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
950962467 3:17120309-17120331 CAACATGCAAAGATTGGGCATGG - Intergenic
951897031 3:27619408-27619430 AAACATGAGCAAATGAGGCCAGG + Intergenic
952974108 3:38679542-38679564 AAACATAATCAGAAGAGGCAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953882045 3:46695620-46695642 GAACAGGGACAGGTGGGGCAAGG + Intergenic
954126161 3:48531074-48531096 AAATATGGACAGGTTGGGCATGG + Intronic
954504833 3:51059848-51059870 AGACATGAACAGATGGATCCTGG - Intronic
954792694 3:53144759-53144781 AGTCCTGGACAGATGGGGCAGGG - Intergenic
957007126 3:74962757-74962779 AAGCATGAAGACATAGGGCAGGG + Intergenic
957907930 3:86581653-86581675 ACACATGAACATATGGGGTTGGG + Intergenic
959330289 3:104996548-104996570 AACCATGAACAGATGTGGTGAGG + Intergenic
959856358 3:111163132-111163154 AAACACAAACAGATGGGGGCTGG + Intronic
960056207 3:113278340-113278362 CAAGGTGAACAGCTGGGGCAAGG - Intronic
961533483 3:127554823-127554845 GCAGATGAGCAGATGGGGCAGGG - Intergenic
962993469 3:140601700-140601722 AAATAATGACAGATGGGGCAGGG - Intergenic
963439576 3:145321007-145321029 AAACCTGAACATTTGTGGCAGGG - Intergenic
964861181 3:161203295-161203317 AAACATGAACAGCTAGGGGATGG + Intronic
964968717 3:162532023-162532045 AAACAAGTACAGATGGGGGCAGG - Intergenic
965225007 3:165977106-165977128 ATACATGAACAGTTGGCACATGG + Intergenic
965584759 3:170307728-170307750 AAAGAAGTAGAGATGGGGCATGG - Intergenic
966621203 3:181966121-181966143 AAACAGTAAGAGGTGGGGCAGGG + Intergenic
966899711 3:184471852-184471874 GAACAGAAACATATGGGGCAGGG - Intronic
969452937 4:7285326-7285348 CAACATGAGGAGATGGGGCCGGG - Intronic
969915390 4:10485754-10485776 AAAAATGAATAAATGGGCCAGGG - Intergenic
970149964 4:13079226-13079248 AAAGATGAAGAGATGGCTCAGGG - Intergenic
970638696 4:18039093-18039115 AAACATGAACATAGGGGATAAGG - Intergenic
972194093 4:36631791-36631813 AAAGATGAACAAATAGGCCAGGG - Intergenic
973335326 4:48950064-48950086 AAACATGATTAAATGAGGCAAGG + Intergenic
973566357 4:52192626-52192648 AAACATGAATAGATTGGGGAAGG - Intergenic
974387175 4:61216787-61216809 ACACATGAAGAAATGAGGCACGG - Intronic
976386513 4:84465591-84465613 AAACATCAACCCAAGGGGCAAGG + Intergenic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
977737672 4:100436816-100436838 ACACATGGACACATGGGGCGGGG + Intronic
978228040 4:106362597-106362619 AACCACAAACAAATGGGGCAGGG - Intergenic
979196027 4:117921274-117921296 AATCCTCAACAGATGAGGCACGG + Intergenic
979752252 4:124293616-124293638 AAACATGAATAGATGGTGTAAGG - Intergenic
982585130 4:157226836-157226858 AACCATGAACACATGTGCCAGGG + Intronic
983155977 4:164349167-164349189 AAACATGAACTTATGAGTCAGGG - Intronic
983216248 4:165005540-165005562 TAACATGAACAGGCTGGGCATGG + Intergenic
983872499 4:172838248-172838270 AATCTTGAAAGGATGGGGCATGG + Intronic
984738415 4:183133783-183133805 AAACATGAGAAGGCGGGGCATGG - Intronic
985088945 4:186343834-186343856 AAACATAAACAGAAGGGGCCGGG - Intergenic
985206535 4:187543768-187543790 ACACATGGACACATGGGGGAAGG + Intergenic
985326471 4:188776353-188776375 AAAGATGATCAGGTGGGGCAGGG + Intergenic
986185046 5:5427797-5427819 AATGATGAACAGAAGAGGCATGG + Intronic
988330294 5:29829134-29829156 AAACTTGAACAGATGAGGTGTGG - Intergenic
988434461 5:31157471-31157493 AAACATGGAAAGAAGGGTCAGGG + Intergenic
989642213 5:43593813-43593835 AAACAGGAACAGGCTGGGCACGG + Intergenic
989949247 5:50277850-50277872 ATACATTAACAGAAGGGTCAAGG + Intergenic
990149255 5:52798687-52798709 TAACATAGACAAATGGGGCAGGG + Intronic
990237240 5:53781392-53781414 GAACAGAAACAGGTGGGGCAAGG - Intergenic
991669885 5:69037309-69037331 AAAAATGATGGGATGGGGCAAGG + Intergenic
994851759 5:105063969-105063991 AAACATTAACAGAGGGTCCAAGG + Intergenic
995208579 5:109510889-109510911 AAACATCAAGAAAAGGGGCAAGG - Intergenic
995235528 5:109825698-109825720 AAACAGGAAGAGAGGGGGAAAGG - Intronic
995956473 5:117782878-117782900 AAACAGGGATAGATGGGGGAGGG - Intergenic
996347375 5:122501718-122501740 ACACATGGACACATGGGGGATGG + Intergenic
997143693 5:131409885-131409907 AAAAATGGACAAATGGGGCCGGG + Intergenic
997486598 5:134236140-134236162 AAACATGCACAGAAGAGGGATGG + Intergenic
998509175 5:142697135-142697157 AATCAGGAAGAGATGGGGAAGGG + Intronic
998731135 5:145078523-145078545 AACCATGAAGAGATGGGGCAGGG + Intergenic
999451801 5:151684173-151684195 AAACAAGAAAAGATGGGCTAGGG - Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1001273850 5:170336168-170336190 AAACATCAACAGGTGGGAGAAGG - Intergenic
1001328307 5:170745206-170745228 AAAAATGAAAAGGTGGGGCCGGG - Intergenic
1001434196 5:171686752-171686774 AAACATGGAAAGCTGGGACATGG + Intergenic
1002324900 5:178398059-178398081 AGACATCAACAAATGGGGCTGGG + Intronic
1004313157 6:14563737-14563759 ACAGAGGAATAGATGGGGCATGG - Intergenic
1004671094 6:17797603-17797625 AAACACAAACAGACAGGGCAAGG + Intronic
1004805316 6:19197949-19197971 AAAAAATAACAGATGTGGCAAGG - Intergenic
1006444159 6:34069550-34069572 ACGCAGGAGCAGATGGGGCAGGG - Intronic
1007317250 6:40999248-40999270 AAACAGGCAAAGATGGCGCACGG + Intergenic
1007687080 6:43673378-43673400 GTACATGAAGAGATGGGGTATGG + Intronic
1007940436 6:45775657-45775679 TAACAAGACCAGATGGGGAAAGG - Intergenic
1010009534 6:71034462-71034484 AAAAATGATCATATGGAGCAAGG - Intergenic
1010016754 6:71113507-71113529 AAACATGAACAGATGATGTTTGG - Intergenic
1011873375 6:91925471-91925493 AGACATGAGGGGATGGGGCATGG + Intergenic
1017250476 6:152274881-152274903 AAAAATAAACAAATGGGCCATGG - Intronic
1019274024 7:166531-166553 GAACAGGAACAGCTGGGGAAAGG + Intergenic
1019974951 7:4573709-4573731 AAACATGAACAGATGATAGATGG + Intergenic
1020173313 7:5862583-5862605 AAACATGAAAAGAGGGAGTAGGG - Intergenic
1020603942 7:10311242-10311264 AAGTATGAACAGACGGGGCAAGG + Intergenic
1021055996 7:16046938-16046960 AAAGATGAACAGGTGGAGTAGGG + Intergenic
1022214997 7:28250406-28250428 AAAAATGAAGAGATGGGGGTCGG - Intergenic
1022360412 7:29651175-29651197 AAACAAGAACTAATGGGGCTTGG - Intergenic
1022414392 7:30165447-30165469 AACCCTGAACAGAAGGGGCAAGG - Intergenic
1023043425 7:36192383-36192405 TAGCATGCCCAGATGGGGCAGGG + Intronic
1023956172 7:44888553-44888575 AGAAATGAACAGAGGGGGCTGGG - Intergenic
1026329534 7:69339674-69339696 ACACATGGACACACGGGGCAGGG + Intergenic
1028830172 7:95319012-95319034 AAAAATGAACAGATGTGAGAAGG + Intronic
1028883535 7:95907232-95907254 AAACATGAAAAAGCGGGGCAAGG - Intronic
1029085429 7:98007939-98007961 AAACATGAAAAGAGGGAGTAGGG + Intergenic
1029256028 7:99270179-99270201 AAACATCAACAGGCAGGGCATGG + Intergenic
1029691214 7:102183307-102183329 AAAAATTAAGAGATGGGGCCGGG - Intronic
1031124068 7:117753709-117753731 ACACATGAACACATGGTGGAGGG + Intronic
1032076190 7:128837258-128837280 GTACATGCGCAGATGGGGCAGGG + Intronic
1032567378 7:132960680-132960702 AAAAATTAACAAATGGGGCCAGG + Intronic
1033808550 7:144982544-144982566 CAATATGGAAAGATGGGGCAGGG - Intergenic
1034247738 7:149661615-149661637 AAATATGAACAGTCTGGGCATGG - Intergenic
1034842791 7:154415055-154415077 AAGCATGCAGAGATGGGCCAGGG - Intronic
1035554297 8:554697-554719 AGAGATGAACAGATGAGACAGGG + Intergenic
1036797065 8:11763964-11763986 AAAAATGAACAAGTCGGGCATGG + Intergenic
1037687236 8:21151842-21151864 AAAAATTAACAGATGCTGCAAGG + Intergenic
1037849284 8:22313178-22313200 AAAGATGAACAGACAGAGCAAGG - Intronic
1038241622 8:25814024-25814046 AATCATGAACAAATAGGGAAAGG + Intergenic
1038936685 8:32259614-32259636 TAACATGAACTGTTGGGGGAGGG - Intronic
1039216120 8:35273415-35273437 CAAAATGAAAAGTTGGGGCAAGG - Intronic
1039256294 8:35722526-35722548 ACACATGAACAGACCGGGCTGGG + Intronic
1039478682 8:37855741-37855763 AAAAATGAATAAATTGGGCATGG - Intergenic
1041361710 8:57061607-57061629 AAACAGAACCAGGTGGGGCACGG - Intergenic
1041487735 8:58397255-58397277 AAAAATGACCAGATAGAGCAGGG - Intergenic
1042041181 8:64591890-64591912 AAAAATGAAAAGATGGGGGCGGG + Intronic
1042540463 8:69902689-69902711 AAAAATAAACAAATGGGGCTGGG - Intergenic
1046862339 8:119107550-119107572 AATCATGAACAGATGGTTTAAGG - Intergenic
1046868230 8:119174706-119174728 AAATAAAAACAGGTGGGGCACGG - Intronic
1047145749 8:122197410-122197432 AAACATATACAGCTGGGACATGG + Intergenic
1047876848 8:129148120-129148142 AAACAGCAACTGATGGGGCAGGG - Intergenic
1048416629 8:134234304-134234326 AAAACAGAACAAATGGGGCATGG + Intergenic
1049256601 8:141617422-141617444 AAACACAACCAGATGGTGCAAGG + Intergenic
1050010216 9:1178467-1178489 ACACATGGACACATGGGGGAGGG + Intergenic
1050448451 9:5752960-5752982 AAACAGAAACATAAGGGGCAAGG + Intronic
1051237138 9:15013297-15013319 AAAAAGAAACAGCTGGGGCAGGG - Intergenic
1051798796 9:20907624-20907646 AAACATAAAAATATGGGGGAAGG - Intronic
1052875071 9:33553210-33553232 AAAATTAAACAGCTGGGGCATGG + Intronic
1053500948 9:38591114-38591136 AAAATTAAACAGCTGGGGCATGG - Intergenic
1055421463 9:76147851-76147873 AAAAAAGAACAGATGTGGCTGGG - Intronic
1056991011 9:91410999-91411021 ATACAAGCACAGATGAGGCATGG + Intronic
1057123768 9:92600437-92600459 AAACAAGAAAAGTTGGGTCAAGG + Intronic
1057394687 9:94669335-94669357 AAACTTGCACAGATGGGGAGGGG + Intergenic
1057451931 9:95171242-95171264 AAACATGAGAAGATGGGGGTTGG - Intronic
1058394174 9:104530740-104530762 ACACTTGAACAGATATGGCATGG + Intergenic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058876953 9:109252668-109252690 AATCATGTACAGAAGGGGCCAGG + Intronic
1060295447 9:122339998-122340020 AGACATGCATAAATGGGGCATGG + Intergenic
1060454032 9:123773121-123773143 AAATAAGAGCAGAGGGGGCAGGG + Intronic
1062000278 9:134212413-134212435 AACCATGAATACATAGGGCAAGG + Intergenic
1203366388 Un_KI270442v1:261774-261796 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1185759336 X:2677849-2677871 AAACCTGAACAGCTGAGCCACGG - Intergenic
1185957955 X:4513055-4513077 AAAAAATAACAGATTGGGCAGGG + Intergenic
1186101247 X:6158832-6158854 ACACATGGACACATGGGGGAGGG - Intronic
1186362102 X:8852940-8852962 AATGAGCAACAGATGGGGCAAGG - Intergenic
1187084661 X:16029482-16029504 AAACAAGAAGAGATGGGTCACGG - Intergenic
1188148919 X:26648816-26648838 CAACATGAACACATGTGGAATGG + Intergenic
1188982504 X:36739580-36739602 AAAAATGAACAGGTAGTGCATGG - Intergenic
1194532830 X:95072089-95072111 AAACATCATCAGGTGGGGGAAGG - Intergenic
1195331525 X:103806973-103806995 AAAAGTTAAAAGATGGGGCAGGG + Intergenic
1195388588 X:104337314-104337336 AGACATGAACAGGTCGGGCGCGG + Intergenic
1195398316 X:104435029-104435051 AAACGTGGGCAGAAGGGGCAGGG + Intergenic
1196260870 X:113579693-113579715 AAACAAGAACAGATTGAGAATGG + Intergenic
1196868533 X:120090952-120090974 AAGCATGAAGAGAATGGGCAAGG + Intergenic
1197177516 X:123501122-123501144 AAACATGAAAAGACATGGCAAGG - Intergenic
1197406154 X:126053717-126053739 AAACATGCAGGGATGAGGCAAGG + Intergenic
1197743381 X:129913464-129913486 AAAAATGATCAGATGGGGCACGG - Intronic
1198162803 X:134024237-134024259 AAACAGGAACAGGAGGAGCAGGG + Intergenic
1198532648 X:137561163-137561185 ACACCTGAAGAGATGGGGGAAGG - Intergenic
1198760611 X:140028704-140028726 AAAGGTGATCAGATGGGGCTTGG - Intergenic
1198878583 X:141254269-141254291 AACAATGAACAGATGGGTCCGGG - Intergenic
1201072301 Y:10158457-10158479 AAAAATGAACAGAGGTGGCTGGG + Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic
1201960352 Y:19674320-19674342 TTCCATGAACAGATGGTGCAAGG + Intergenic
1202071368 Y:20995062-20995084 AATTATGAACATATGAGGCATGG - Intergenic