ID: 950575875

View in Genome Browser
Species Human (GRCh38)
Location 3:13831819-13831841
Sequence CCCTGGGCATCGAGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950575875_950575883 27 Left 950575875 3:13831819-13831841 CCAACTTCTCTCGATGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 950575883 3:13831869-13831891 ATCTCCCCAGAGTCCCGCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 182
950575875_950575879 1 Left 950575875 3:13831819-13831841 CCAACTTCTCTCGATGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 950575879 3:13831843-13831865 TGCCTTCCTCACTGCCTTATAGG 0: 1
1: 0
2: 1
3: 45
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950575875 Original CRISPR CCCTGGGCATCGAGAGAAGT TGG (reversed) Intronic
901162655 1:7191879-7191901 CGCTGGGCATCAAGAGATCTGGG + Intronic
903564970 1:24258385-24258407 CACAGGGCATTGCGAGAAGTAGG + Intergenic
903994846 1:27299370-27299392 CTGTGGGCATCAAGAAAAGTTGG + Intronic
905150569 1:35923685-35923707 CCCTGGGCAGGGAGAGAGGCTGG + Exonic
916011607 1:160711439-160711461 ACCTGGGGAGCAAGAGAAGTAGG - Intronic
916784864 1:168079255-168079277 TCTTGGGCATGGTGAGAAGTAGG + Intergenic
919854489 1:201696019-201696041 TCCTGGGCATCGGAAGAAGCGGG + Intronic
921017969 1:211209606-211209628 TCCTGGGCATCTAGATCAGTAGG + Intergenic
923215974 1:231848061-231848083 CCCTGGGCAAAGAGAGAAACAGG + Intronic
923251617 1:232183815-232183837 ACCTGGGCATGGTCAGAAGTAGG - Intergenic
1062907029 10:1186224-1186246 CCCTGGGCATGGGAAGAAGTGGG - Intronic
1063666338 10:8062822-8062844 CTCTGGGCACCCAGAGAACTGGG + Intronic
1065634762 10:27719871-27719893 CCTTGGGCCTCGAGAGTAGCTGG - Intronic
1066981178 10:42418100-42418122 CCCTGGGCCTTGAGTGAAATAGG - Intergenic
1069204625 10:65666489-65666511 CCCTGGGCTTAGAGGGAAGGTGG - Intergenic
1070758413 10:79007834-79007856 CCCTGGGCATGGAGTGGAATAGG + Intergenic
1072436867 10:95422004-95422026 CCCTTGGCAGCGAGTGAAGAGGG + Exonic
1074369530 10:112888586-112888608 ACCGGGGCATGAAGAGAAGTGGG + Intergenic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1077021267 11:418120-418142 CCCTGGGCACCCACAGAACTGGG - Intronic
1081204215 11:40256159-40256181 CTCTGGGCATCTAGAGAATGAGG + Intronic
1081301192 11:41454092-41454114 CCCTGTGCATGGAGAGAACAGGG - Intronic
1082921970 11:58505350-58505372 GGCTGGGCATAGAAAGAAGTTGG + Intergenic
1084123202 11:67081664-67081686 CCATGGGCCTCGCGAGGAGTGGG - Intergenic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1084977876 11:72813318-72813340 CCCTAGGGAACGAGAGAAGTTGG - Intergenic
1085127445 11:74011310-74011332 CCCTGGGCCCCAAGGGAAGTGGG + Intergenic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085388714 11:76171479-76171501 CCCTGGGCACTGGGAGGAGTCGG - Intergenic
1085883980 11:80500480-80500502 CCCTGGGCATCCAGGGCTGTGGG - Intergenic
1088917513 11:114238753-114238775 CCCTGGGGATGGAGACAAGCTGG - Intronic
1089129953 11:116203661-116203683 CACTGGTCCTCTAGAGAAGTGGG + Intergenic
1089181999 11:116589695-116589717 CCATGGGCATAAAGAGAAGCAGG + Intergenic
1089844394 11:121447074-121447096 CCCTGGGAATATAGAGGAGTAGG - Intergenic
1090639989 11:128721960-128721982 CCCTGGTCATCTTGAGTAGTGGG + Intronic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090732395 11:129583091-129583113 CTCTGGGCAGCAAGAGAGGTGGG - Intergenic
1091759551 12:3077688-3077710 GCCCGGGCACCGAGCGAAGTGGG + Intronic
1095672447 12:44876510-44876532 CCCGGGTCATCGAGAGAGGGAGG - Intronic
1097835089 12:64264969-64264991 CCCAGGGCAAAGAGAGGAGTGGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1108583166 13:51844980-51845002 CCCTGGGCAGCCTGTGAAGTTGG - Intergenic
1109048269 13:57441136-57441158 CGCTTGGCATCGAGAGAGGATGG + Intergenic
1110993070 13:82069028-82069050 ACCTGGGCATAGAGTAAAGTAGG + Intergenic
1112429751 13:99341129-99341151 CCATGGGCAGTGAGAGAAGGAGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112557133 13:100478911-100478933 CCCTGTGCAGAGAGAAAAGTTGG - Intronic
1113290221 13:108897409-108897431 CACAGGGCAGCGAGAGAAGGCGG + Intronic
1115788198 14:36849956-36849978 CCCTGGGGATCAAGTGAAGGAGG + Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1119263552 14:73251823-73251845 CCCTGGTCATCGAGGTAAATGGG + Exonic
1121102497 14:91259739-91259761 CCATGGGCATCGGGGGAAGAAGG - Intergenic
1122843758 14:104479435-104479457 CGCTGGGCACCGAGGGAGGTGGG - Intronic
1126208986 15:46078290-46078312 GCCTGGGAATCTAGAGGAGTAGG + Intergenic
1126812471 15:52421603-52421625 CCCTGGAAATCAAGAGATGTGGG - Intronic
1128078190 15:64841456-64841478 CCCTGGGCGGCCAGAGATGTGGG - Intergenic
1128976393 15:72156746-72156768 CCCTGGGAATAGTGAGGAGTGGG + Intergenic
1129787742 15:78320652-78320674 CCCTGGGCACAGAGAGGAGCAGG + Intergenic
1130763963 15:86851451-86851473 CCCTGGGCATTGAGAACAGGAGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1132658527 16:1051465-1051487 CCCTGGGCATACGGAGGAGTGGG - Intergenic
1132833074 16:1939014-1939036 CCCTGGGCGTCGAGACAGGAAGG - Exonic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136409366 16:30067166-30067188 CCCTGGTCATCGGGAGATGATGG + Intronic
1137531223 16:49280270-49280292 CCTTGGGCGCCGAGAGAGGTGGG - Intronic
1137669240 16:50269734-50269756 CCCTGGGCAGTGGGAGAGGTAGG - Intronic
1140893994 16:79309060-79309082 CCCTGGGCGCAGAGAGAGGTGGG + Intergenic
1141174999 16:81712952-81712974 ACCAGGGCATAGAGAGAGGTGGG - Intergenic
1142607369 17:1089577-1089599 CACTGGGCCTCGGGAGAACTCGG - Intronic
1142701004 17:1660826-1660848 CCCTGGGGAGCAAGAGAAGCAGG + Exonic
1142758297 17:2028616-2028638 CCCTGGGGATCCAGAGAAGCTGG + Intergenic
1143620958 17:8080018-8080040 CTATGGGCACCGAGAGGAGTCGG + Exonic
1144967292 17:19085628-19085650 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1144980628 17:19166438-19166460 CCCTGGGGATGGAAAGAAATGGG - Intergenic
1144987594 17:19211795-19211817 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1148218600 17:45847375-45847397 ACCTGAGCATGGAGAGAAGATGG - Intergenic
1149149075 17:53537271-53537293 CCCTGGGTATGGAGAGTAATGGG + Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1153591056 18:6674530-6674552 CCCTGGGGATGGAGAGTGGTGGG + Intergenic
1153777220 18:8464946-8464968 CCCTAGGCATTGGGACAAGTCGG - Intergenic
1156125799 18:33903886-33903908 CCCTGGGCATAGAGGGAGGGTGG - Intronic
1157691123 18:49682709-49682731 CCCTGGGCACTGGGGGAAGTAGG + Intergenic
1161326068 19:3664866-3664888 CCCTGGCCATGGGAAGAAGTTGG - Exonic
1163387390 19:17008249-17008271 TCCTGGGCATAGAGAAACGTGGG + Intronic
1167429656 19:49447224-49447246 CCCTGGGCACTGAGAGAGGGAGG - Intronic
928372064 2:30747436-30747458 CCCTTGGCCTCCAGAGAAGTCGG - Intronic
928373457 2:30757479-30757501 TCATGGGCATCCAGAGCAGTAGG + Intronic
929335495 2:40739232-40739254 CCCTGGGCAGTGAGAAAAGATGG + Intergenic
930553692 2:52869029-52869051 TCCTGGGAATCCAGAGAATTAGG + Intergenic
931355756 2:61537220-61537242 CCCTGGGGCTGGGGAGAAGTTGG - Intronic
932047541 2:68364858-68364880 GGCTTGGCATAGAGAGAAGTAGG + Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932336236 2:70932898-70932920 CCCTGGGCACAGAGAGCAGCCGG - Exonic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
935160357 2:100524343-100524365 CCTTGGGAGTCTAGAGAAGTTGG + Intergenic
935424204 2:102902915-102902937 CCCAGGGCATTGTGGGAAGTCGG + Intergenic
938115872 2:128602679-128602701 GCCTGGGAACCGGGAGAAGTGGG + Intergenic
939431374 2:142113184-142113206 CACTGGGAACCAAGAGAAGTGGG - Intronic
941409921 2:165142131-165142153 CCCTGGGTGTGAAGAGAAGTAGG - Intronic
943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG + Intronic
1172237190 20:33385695-33385717 CCCGGGGCAGGGAGAGGAGTCGG - Exonic
1172392202 20:34573585-34573607 CCCTGGGCCTCTAGGGAGGTTGG - Intronic
1174875238 20:54220801-54220823 CCCTGGTCAGGGAGTGAAGTGGG - Intronic
1175265331 20:57699723-57699745 TCCTCGGCAGCAAGAGAAGTAGG - Intronic
1176025189 20:62982076-62982098 CTCTGGGCATTGGGAGAAGGGGG + Intergenic
1177019067 21:15829553-15829575 CCCTTAGCTTCGAGTGAAGTTGG + Intronic
1178233347 21:30812882-30812904 CCCTGGGACTCGAGGTAAGTTGG + Exonic
1179288517 21:39998117-39998139 CCCTGGGCACCAAGACAAGTAGG - Intergenic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
950050857 3:9987911-9987933 CTCTGAGCTTCGGGAGAAGTTGG + Intronic
950097550 3:10338762-10338784 CTCTGGGCATGGTGAGAACTGGG + Intronic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
952752607 3:36837411-36837433 CCCTGGGCATTGAGAGGGGTAGG - Intronic
969254328 4:5992116-5992138 CCCTGGGCTTCAAGGGAAGGGGG + Intergenic
969598825 4:8163757-8163779 CCCTGGCCCTCTAGTGAAGTTGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
976025365 4:80681562-80681584 TCCTGGGCAACTAAAGAAGTGGG - Intronic
977589359 4:98809392-98809414 TCCTGGGAAACCAGAGAAGTAGG - Intergenic
982112176 4:152066792-152066814 GTCTGGGCATAGGGAGAAGTTGG + Intergenic
991006394 5:61832374-61832396 CCCTGGACTTCCAGAGAAGATGG - Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991538208 5:67696649-67696671 CCCTGGGAATCGGGAGCAGATGG + Intergenic
992089647 5:73305592-73305614 CTCGGGGCATTCAGAGAAGTAGG + Intergenic
997949552 5:138231277-138231299 CCCTGGGAATTGGGAGGAGTGGG - Intergenic
998069456 5:139185648-139185670 CCCTGGGTAACTAGAGAATTGGG - Intronic
998368542 5:141646593-141646615 CCATGGGCATCGGGTGAGGTGGG - Exonic
999008775 5:148011607-148011629 CCCTGTGCTTCCAGAGAAGCTGG + Intergenic
1001420702 5:171584844-171584866 CACTGGGCATCATAAGAAGTTGG + Intergenic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1004636261 6:17470862-17470884 CCCTGGACAGCTAGAGAAATGGG - Intronic
1007718503 6:43870849-43870871 ACCTGGGAATCTAAAGAAGTGGG + Intergenic
1009042813 6:58200739-58200761 CCCTGTGCATCTTGAGATGTAGG - Intergenic
1011611947 6:89160924-89160946 GCTAGGGCATCGAGAGTAGTGGG + Intronic
1013296852 6:108765353-108765375 ACCTGGGCATGAAGAGACGTGGG - Intergenic
1015576396 6:134676248-134676270 CCCTGGGCATCAGGAGACCTAGG - Intergenic
1016007992 6:139108719-139108741 CCCTGCACATGGAGAGAAGAAGG - Intergenic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1016684650 6:146867424-146867446 CACTGGGCATTGAGTGGAGTAGG - Intergenic
1017796550 6:157850046-157850068 GCCTGGGCAAGGAGAGAAGGTGG + Intronic
1018011771 6:159677189-159677211 CGCTGGGCATCGAGACTACTGGG + Exonic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1021580971 7:22153063-22153085 CCCAGGGCCTCGTGAGAAGCTGG - Intronic
1024346896 7:48322555-48322577 CCCTGGGCATTGAGAGGACAGGG - Intronic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1031043788 7:116864787-116864809 ACCTTGGCATCCAGAGTAGTTGG - Intronic
1039414929 8:37385752-37385774 CCCTGGGCATCCAGAGAGAGAGG + Intergenic
1040279884 8:46034770-46034792 CCCTGGGCAACAAGGGAAGGAGG + Intergenic
1048078021 8:131094508-131094530 CCCTGAGCTGCGAGAGATGTGGG + Intergenic
1051566429 9:18504611-18504633 CCCTGGGCAATGACTGAAGTGGG - Intronic
1057509553 9:95666150-95666172 CCCTAGGCATGGAGACAATTAGG - Intergenic
1061925186 9:133802775-133802797 CCCTGGGCATCTTGAGAGGTTGG - Intronic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1192200235 X:69061942-69061964 CCCTGGGCATCCAGAACAGGGGG + Intergenic
1192237297 X:69304057-69304079 CCATGGGCATTGGGAGAAGGGGG - Intergenic
1194897428 X:99461577-99461599 CAGAGGGCATCAAGAGAAGTAGG + Intergenic
1195481055 X:105345713-105345735 CCCTGGGCATGAAAAGAAGATGG - Intronic
1199589880 X:149457501-149457523 TTCAGGGCATCGAGAGAAGAGGG + Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic