ID: 950577223

View in Genome Browser
Species Human (GRCh38)
Location 3:13839381-13839403
Sequence CCTGAAGCCCAGCCCGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950577209_950577223 30 Left 950577209 3:13839328-13839350 CCTGAGGCTGGGGGTCTCAGAGG 0: 1
1: 1
2: 6
3: 60
4: 436
Right 950577223 3:13839381-13839403 CCTGAAGCCCAGCCCGTAACAGG 0: 1
1: 0
2: 1
3: 8
4: 109
950577219_950577223 3 Left 950577219 3:13839355-13839377 CCCAGATAGGGGGTGGGAGCACA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 950577223 3:13839381-13839403 CCTGAAGCCCAGCCCGTAACAGG 0: 1
1: 0
2: 1
3: 8
4: 109
950577220_950577223 2 Left 950577220 3:13839356-13839378 CCAGATAGGGGGTGGGAGCACAT 0: 1
1: 0
2: 1
3: 8
4: 88
Right 950577223 3:13839381-13839403 CCTGAAGCCCAGCCCGTAACAGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950577223 Original CRISPR CCTGAAGCCCAGCCCGTAAC AGG Intronic
900210175 1:1451741-1451763 CCTTAAGCCCAGCCTGAATCAGG + Intronic
900215725 1:1480562-1480584 CCTTAAGCCCAGCCTGAATCAGG + Intronic
901880663 1:12191920-12191942 CCTGAGCCCCACCCCGTACCTGG - Exonic
903219163 1:21859511-21859533 CCTGCAGCCCAGCCCAGGACAGG + Intronic
903438415 1:23369275-23369297 CCTGAAGGCCCGCCCGGATCAGG - Exonic
904565678 1:31426848-31426870 CCTGAAGCCCGGCCCCTTAGTGG + Intronic
905016037 1:34779624-34779646 CCTGAACACCAGACTGTAACCGG - Intronic
906652317 1:47521498-47521520 CCTCATGCCCAGCCCGTCCCCGG + Intergenic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
911664654 1:100539305-100539327 CCAGCAGCCCACCCCGTAGCAGG - Exonic
920260782 1:204686328-204686350 CCTGAAGCCAAACCCCTAACTGG - Intergenic
924464337 1:244286414-244286436 CCTGAAGACCAGGCTGTACCAGG + Intergenic
1064378849 10:14822080-14822102 CCTGATGCCCAGCCCCTACTGGG + Intronic
1065965258 10:30765699-30765721 GCTGCAGCCCAGGCCCTAACTGG + Intergenic
1070475422 10:76824654-76824676 CTTGAATCCCAGCCTGTGACTGG + Intergenic
1070790068 10:79183844-79183866 CCCAAAACCCAGCCCTTAACTGG - Intronic
1076535553 10:131174473-131174495 CCTGCAGCCCAGCCCCGACCAGG - Intronic
1086869686 11:92021990-92022012 CCTAAACCCCACCCCCTAACAGG + Intergenic
1090122949 11:124052629-124052651 CCTCACCCCCACCCCGTAACAGG - Intergenic
1091404821 12:202687-202709 ACCGCAGCCCAGCCCCTAACAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1096176936 12:49527909-49527931 TCTGAAGCCCAGACTGTAAGTGG + Intergenic
1096699235 12:53371413-53371435 CCTCAGGCCCAGCCCGGAGCTGG - Intergenic
1096789835 12:54037768-54037790 CCTGAAGGCAAGCCCGTGAGTGG + Intronic
1098501797 12:71201582-71201604 CCTGAAGCCCAGCTAATAAATGG - Intronic
1099077670 12:78131030-78131052 CCTGAAGCCCAGACACTAAGGGG + Intronic
1100679829 12:96907247-96907269 CCGGAAGCCCAGCGCGGAGCCGG + Intronic
1111034095 13:82647762-82647784 CCTGAAGCCCAGTTCCTAACAGG + Intergenic
1119483374 14:74973615-74973637 CCTCATGCCCAGTCAGTAACAGG - Intergenic
1124276282 15:28328098-28328120 CCTGAAGAACATCCCGTAAAGGG - Intergenic
1124306416 15:28583509-28583531 CCTGAAGAACATCCCGTAAAGGG + Intergenic
1126585989 15:50287989-50288011 CCTCAAGCCCTGCCCTTCACTGG + Intronic
1129780195 15:78264799-78264821 CGTGAAGCCCAGCGCGTCCCCGG + Exonic
1130331345 15:82924711-82924733 CATGATGCCCAGCCCACAACAGG - Intronic
1131672827 15:94638435-94638457 CCTGCAGCCCAGGTCCTAACAGG + Intergenic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1141004212 16:80337057-80337079 CCTTGACCCCATCCCGTAACAGG - Intergenic
1145813655 17:27780653-27780675 CCTAAAGCCCAGCCAGCAGCAGG - Intronic
1146457353 17:33018098-33018120 CCTGAAGCCCATGCCGTGATTGG - Intronic
1154405762 18:14089860-14089882 CCTGAAACCCAGCCATCAACTGG - Intronic
1160015923 18:75140576-75140598 GCTGGAGCCCAGTCCATAACAGG + Intergenic
1160884459 19:1339098-1339120 CCTGACACGCAGCCCGTCACAGG + Intergenic
1161119385 19:2517010-2517032 CCTGGATCTCATCCCGTAACCGG + Intronic
1162061873 19:8101054-8101076 CCTGGAGCCCAGCCCTCACCTGG + Intronic
1165066230 19:33230330-33230352 TCTGAAGCGCAGCCCCTTACTGG + Intergenic
1168137625 19:54361749-54361771 GCAGATGCCCAGCCCGTGACAGG + Intronic
1168160444 19:54507329-54507351 GCAGATGCCCAGCCCGTGACAGG - Intronic
926116573 2:10217453-10217475 GCTGAACCCCAGCCTGGAACTGG - Intergenic
927321838 2:21756237-21756259 TGTGCAGCCCAGCCCCTAACAGG - Intergenic
927534455 2:23843494-23843516 CCTGTATCACAGCCCGTAATTGG - Intronic
927637630 2:24827656-24827678 CCTGATGCCCAGCCAGGCACCGG + Intronic
927985548 2:27408271-27408293 CCTGAAGCCCACCCGGTAGGTGG + Intronic
935786283 2:106551772-106551794 CCTGGAGCCCAGTCCTTAAGAGG + Intergenic
936511198 2:113149074-113149096 CCTGAAACCCAGCACGGCACTGG + Intergenic
937346593 2:121129936-121129958 CCTCAAGCCCAGCAGGTGACTGG + Intergenic
944522529 2:200586506-200586528 CCTCAATCCCAGCCGATAACGGG + Intronic
1170459498 20:16564115-16564137 CCTGGATCCCAGCCCTTACCTGG - Intronic
1172998505 20:39088900-39088922 CATGATGCCCAGCCCGTACTAGG - Intergenic
1175264663 20:57695382-57695404 CCTGAATCTGGGCCCGTAACGGG - Intronic
1175518187 20:59582374-59582396 CCTGCAGCACAGCCTGTGACAGG - Intronic
1175601074 20:60273583-60273605 CCTGAAGCCCAGCCAGCAGTGGG - Intergenic
1177255914 21:18662793-18662815 CCAGAAGCCCAGGCAGGAACAGG - Intergenic
1178226637 21:30726701-30726723 CCTGAAGCCCACTCCCTCACTGG - Intergenic
1179955556 21:44736340-44736362 CCTGAAGTCCAGCCTGTCAGTGG + Intergenic
1180018505 21:45103632-45103654 TCTGAAGCCCAGTTCCTAACAGG + Intronic
1181104603 22:20566383-20566405 CCTGAGGCCCAGACTGTCACAGG + Intronic
1182154063 22:28052427-28052449 CAGGAAGCCCAGCCAGTAACTGG + Intronic
1184682181 22:46078420-46078442 CCTGGACCCCAGCCCGTATCAGG - Intronic
949396076 3:3615892-3615914 CCTGAAGCCCAGTCTGTTCCTGG - Intergenic
950577223 3:13839381-13839403 CCTGAAGCCCAGCCCGTAACAGG + Intronic
956008078 3:64801770-64801792 CCTAAAGCACAGCTCATAACAGG + Intergenic
961390593 3:126550346-126550368 CCTGAGCCCCAGCCCATAAGTGG + Intronic
962613584 3:137102414-137102436 ACTGAAGCCCAGCCCGTGCATGG - Intergenic
968591184 4:1460341-1460363 CCCGCAGCCCAGCCAGTAATGGG + Intergenic
970437397 4:16048871-16048893 GGTACAGCCCAGCCCGTAACTGG + Intronic
970637211 4:18022079-18022101 CCCGGAGCCCAGCCAGGAACCGG + Intergenic
975520140 4:75291808-75291830 CCTGCACCCCAGCCCATGACAGG + Intergenic
975825695 4:78317292-78317314 CGTGAAGCCCAGCCAGGAAGTGG + Intronic
984692242 4:182740186-182740208 CCTGATGTCCAGGACGTAACTGG - Intronic
984939891 4:184921852-184921874 CCTGAAGCCAAGCGCGTAACTGG - Intergenic
988846333 5:35131608-35131630 TCTGAACCCCAGCCCGTCCCAGG - Intronic
989106908 5:37871502-37871524 CCCCAAACCCAGCCTGTAACAGG - Intergenic
991562324 5:67966777-67966799 CCAGAAGCCCAGGCCCTACCTGG + Intergenic
998797420 5:145835051-145835073 CCTGAAGCAAAGCCCGCAGCTGG + Intronic
1001245074 5:170100086-170100108 CCTGAACACCAGCCCAGAACTGG + Intergenic
1001915851 5:175559431-175559453 CCTGAGTCCCAGCCTGTAGCTGG + Intergenic
1002519622 5:179784397-179784419 CCTGAAGCCCAGCTTGCAGCAGG + Intronic
1007392588 6:41558683-41558705 CCTGAAGCCCTCCCCTTACCTGG + Intronic
1008417180 6:51255464-51255486 TCTGAAGCCCAACCCCTAACTGG + Intergenic
1010815135 6:80349338-80349360 CCCGGTGCCCGGCCCGTAACAGG - Intergenic
1011515078 6:88144923-88144945 CCTGAACCCCAGCCAGCAGCTGG - Exonic
1018872787 6:167796125-167796147 CCGGGAGCCCAGCCAGTCACTGG + Intronic
1018913390 6:168117330-168117352 CGTGAAGCCCAGCCCTAAACAGG - Intergenic
1019135151 6:169903245-169903267 CCTGAGGCCCGGCACGTAGCGGG + Intergenic
1019379788 7:714848-714870 CCTGAGGCCCTTCCCGTATCTGG + Intronic
1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG + Intergenic
1020844145 7:13261517-13261539 CCTGTATCCCAGCCTGTAGCTGG + Intergenic
1029711504 7:102302466-102302488 CCTGATGGCCAGCCCCTAAGAGG - Intronic
1030658264 7:112191722-112191744 CCTGAATCTCAGCCCTTCACAGG + Intronic
1031695874 7:124853013-124853035 CCTGATTCCCCGACCGTAACTGG + Exonic
1033199767 7:139359133-139359155 TCTGAAGCCCGGCCCGTGACTGG - Intronic
1034445806 7:151113711-151113733 TCTGAAGCCCAGCCAGTTTCCGG - Intronic
1035608781 8:947273-947295 CCTGGCGCCCAGCCCCTGACAGG - Intergenic
1037674366 8:21041286-21041308 CCGGCAGCCCAGCCAGTGACAGG + Intergenic
1039546148 8:38413014-38413036 CCTGGGGCCCAGCCCCAAACTGG - Exonic
1039884865 8:41649111-41649133 CCTGAAGCCAAGCCTAAAACAGG + Intronic
1047495057 8:125403381-125403403 CCTGGAGCCCAGCCTCTATCCGG - Intergenic
1048052579 8:130832218-130832240 CATGATGCCCAGCCCAAAACAGG - Intronic
1049331739 8:142058184-142058206 TCTTAGGCCCAGCCCGCAACTGG - Intergenic
1061003842 9:127917203-127917225 CCTGAGGCCCCGCCCCTAGCTGG - Intergenic
1061756120 9:132813654-132813676 CCAGAAGCCCAGCCGCCAACTGG + Intronic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1062590595 9:137272844-137272866 CCGGAAGCCCAGCCCGGCACAGG + Exonic
1062656743 9:137607504-137607526 CCTGAACCCCAGCCCTGGACTGG - Intronic
1185449919 X:276463-276485 CCTGATTCCCAGCCCACAACAGG - Intronic
1192539647 X:71957236-71957258 CCCCAACCCCAGCCCATAACAGG - Intergenic
1193278501 X:79620448-79620470 TCTGCAGCCCAGTCCCTAACAGG - Intergenic
1198646511 X:138812846-138812868 CCTCAACCCCACCCTGTAACAGG + Intronic
1199042181 X:143127132-143127154 ACTGAAGCCCCTCCCATAACAGG + Intergenic