ID: 950578710

View in Genome Browser
Species Human (GRCh38)
Location 3:13849105-13849127
Sequence GTGGCTATACAAGGGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950578710 Original CRISPR GTGGCTATACAAGGGCAACC TGG Intronic
901160971 1:7176604-7176626 ATGGCTAACCCAGGGCAACCAGG - Intronic
901281282 1:8037157-8037179 GTGGGTAGAGATGGGCAACCTGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907826458 1:58021792-58021814 GTGGGTCTGAAAGGGCAACCGGG + Intronic
913961165 1:143339010-143339032 GTGGCAGAACAAGGGCAACCAGG - Intergenic
914055519 1:144164583-144164605 GTGGCAGAACAAGGGCAACCAGG - Intergenic
914123627 1:144801779-144801801 GTGGCAGAACAAGGGCAACCAGG + Intergenic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
924466356 1:244302224-244302246 GTGGCTATTCTAGTGGAACCAGG + Intergenic
1067029612 10:42871409-42871431 GTGGCAGAACAAGGGCAACCAGG - Intergenic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1074896831 10:117784564-117784586 GTGGCTAGACAAGGCCAAAATGG - Intergenic
1075796421 10:125123206-125123228 ATGACTATAAAAGGGCAACGGGG + Intronic
1076723138 10:132401453-132401475 ATGGCTCTAAAAGGGCAGCCTGG + Intronic
1078396784 11:10988512-10988534 GTGGCATTACAAGGCCAACCAGG - Intergenic
1078469560 11:11576161-11576183 CTGGCTAGAGAAGGGCAGCCTGG - Intronic
1080561990 11:33472489-33472511 ATGGCTGTACAAGGGAGACCAGG + Intergenic
1081570455 11:44287401-44287423 GGGGCTATAAAATGGAAACCTGG - Intronic
1084449435 11:69227080-69227102 GTGGCAATAGAAGGGCACCCTGG + Intergenic
1086919659 11:92571875-92571897 GTGCCTATGCAAGGGCATTCAGG + Intronic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1097501498 12:60409681-60409703 GTGGCTCTACAAGGTCACCATGG + Intergenic
1100915487 12:99415981-99416003 GTAGCTATAAAAGGGCAATGGGG - Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1108091164 13:46851585-46851607 GTGGCTTTACAAGGGCAGGATGG + Intronic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1116552111 14:46254241-46254263 CTGGCTATACAAGGGAGTCCAGG + Intergenic
1117445700 14:55801837-55801859 TTGGTTTTACAAAGGCAACCTGG - Intergenic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1125134739 15:36328547-36328569 GTGTCTAGACAAGGGGAACGTGG + Intergenic
1130808812 15:87355116-87355138 GTGGATCTACAAGGGCAATCTGG + Intergenic
1132880382 16:2159485-2159507 GTGGCTTTGCTATGGCAACCAGG + Intronic
1146781054 17:35672856-35672878 GTGGCTATACATGGGAAATGGGG - Intronic
1147036427 17:37685018-37685040 CTGGCTATACAAGGGCCAAGGGG - Intergenic
1149370225 17:55986735-55986757 GAGGCTACACAAGGGCCACATGG - Intergenic
1149395955 17:56243963-56243985 GTGGCTAAACTAGGGCTAACTGG - Intronic
1152460368 17:80439142-80439164 GTGGCTGTGCACAGGCAACCAGG + Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1158882475 18:61794212-61794234 GTGTCTATATCAGGGTAACCGGG - Intergenic
1159793025 18:72807855-72807877 GTTTCTGTCCAAGGGCAACCAGG + Intronic
1160060914 18:75527991-75528013 GGGGCTCTGCAAGGGCCACCAGG - Intergenic
1164519169 19:28964646-28964668 GTGGCTATGAAAGGGCAGCAGGG + Intergenic
1202695002 1_KI270712v1_random:117260-117282 GTGGCAGAACAAGGGCAACCAGG - Intergenic
930428720 2:51246521-51246543 AGGGCTATACAAAGGCAAGCTGG - Intergenic
930828963 2:55723160-55723182 GTGTCTATAGAAGAGCATCCAGG - Intergenic
934276171 2:91574308-91574330 GTGGCAGAACAAGGGCAACCAGG - Intergenic
938595268 2:132782588-132782610 GTGGCTGTACTTGGGGAACCAGG - Exonic
940433791 2:153626826-153626848 TTGGCTATACAATGCCAGCCAGG - Intergenic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
946867863 2:224058766-224058788 GTGGATATTCAGGGGAAACCTGG + Intergenic
947750804 2:232530934-232530956 CTGGTTCTACAAGGACAACCTGG + Intronic
1170115863 20:12858864-12858886 GTGGCTATGTAAGGGCACACAGG + Intergenic
1174411157 20:50337292-50337314 TTGGTTATACAAGGGCAATGAGG + Intergenic
1181736697 22:24887221-24887243 CTGGCTATAAAAGGACAACGTGG - Intronic
1185235574 22:49710829-49710851 GTGGACATACAGGGGCACCCAGG - Intergenic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
953662220 3:44899539-44899561 GTGGCTATCCATGGGCCTCCTGG + Intronic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
967889348 3:194354074-194354096 GTGGCTAGGGAAGGGCAACAAGG + Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
979946897 4:126843620-126843642 GTGTCTGGACAAGGGGAACCGGG - Intergenic
984818869 4:183862519-183862541 GTGCCTCTACAAGGGTGACCAGG + Intronic
985998768 5:3613749-3613771 GTGGCAATACAGGAGTAACCAGG - Intergenic
986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG + Intronic
992488912 5:77222071-77222093 GTGGCTGCAAAAGGGTAACCTGG + Intronic
995614047 5:113941351-113941373 GTGCCTATAGAATGCCAACCAGG - Intergenic
996949775 5:129111507-129111529 TTGGCTATGCAAGGGCTTCCTGG + Intronic
999448854 5:151663706-151663728 GTGGCCATGCAAGGTCACCCAGG + Intronic
1000280754 5:159779994-159780016 GTGGGTCTTCCAGGGCAACCTGG - Intergenic
1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG + Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1012972067 6:105742049-105742071 AGGGCAAAACAAGGGCAACCTGG + Intergenic
1014869712 6:126578550-126578572 TTTGCTATAGAATGGCAACCAGG + Intergenic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1033302836 7:140201656-140201678 GTGGAATTACAAGGGAAACCAGG - Intergenic
1038602711 8:28962949-28962971 GTGTCTATGCCAGGGCAAGCAGG + Intronic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041768142 8:61442048-61442070 GTGCCTATAAAAGGGTAACATGG - Intronic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1044908662 8:97032718-97032740 GTTGCTAGACAAAGGCATCCTGG - Intronic
1045341707 8:101260766-101260788 GTGGCTTTACACTGGGAACCAGG + Intergenic
1050748507 9:8906951-8906973 GTGCATATGCAAGGGGAACCTGG + Intronic
1052726799 9:32238317-32238339 ATGGCTATAAAAGGACAACATGG + Intergenic
1056914660 9:90735619-90735641 GTGGCTATAAAAGGTTAACATGG + Intergenic
1056997311 9:91474953-91474975 GTGGCTCCACAAGGCCATCCAGG - Intergenic
1191175144 X:57491425-57491447 TTGGTGATACAAAGGCAACCAGG + Intergenic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1195010377 X:100727876-100727898 GTGGGAATACAAGGGCAATCGGG + Intronic
1199046731 X:143182967-143182989 GTCTCTATACAATGACAACCTGG + Intergenic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic