ID: 950579361

View in Genome Browser
Species Human (GRCh38)
Location 3:13852487-13852509
Sequence CCGGTGCCAGTCAGTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579361_950579365 -7 Left 950579361 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 950579365 3:13852503-13852525 GCACCGGTCGGAACAAGGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 41
950579361_950579366 -6 Left 950579361 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 950579366 3:13852504-13852526 CACCGGTCGGAACAAGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 29
950579361_950579371 28 Left 950579361 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 950579371 3:13852538-13852560 ATCGACAGATGTGGAAACTGAGG 0: 1
1: 4
2: 74
3: 761
4: 4427
950579361_950579368 19 Left 950579361 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 950579368 3:13852529-13852551 ATAGTCCCAATCGACAGATGTGG 0: 1
1: 0
2: 1
3: 29
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579361 Original CRISPR CCGGTGCCAGTCAGTTCCCC AGG (reversed) Intronic
900218557 1:1495130-1495152 CCGTGGCCAGGCAGTGCCCCCGG - Intronic
900220900 1:1508850-1508872 CCGTGGCCAGGCAGTGCCCCCGG - Intergenic
900225907 1:1533571-1533593 CCGTGGCCAGGCAGTGCCCCCGG - Intronic
900501090 1:3004982-3005004 TTGGTGCCAGTCCCTTCCCCTGG - Intergenic
901816878 1:11799368-11799390 TCAGTTCCAGCCAGTTCCCCAGG - Intronic
902481744 1:16715684-16715706 CTGGTGTCTGTCAGTTCACCTGG - Intergenic
902919830 1:19658981-19659003 CAGGTGCTAGTAAGTTTCCCAGG + Intergenic
903362034 1:22782938-22782960 CCTGTGCCACTCAGATTCCCTGG - Intronic
904086733 1:27914577-27914599 GCGGAGCCAGTCAGCTCCCGGGG + Exonic
904721889 1:32516436-32516458 CTGGTACCAGTCTGTGCCCCAGG - Intronic
905515432 1:38558850-38558872 CCAGGGCCCGTCAGTTCCCCAGG - Intergenic
905536521 1:38726598-38726620 CCGGTTCCAGACAGCTCCCCTGG - Intergenic
906973074 1:50538729-50538751 CCTATGCAAATCAGTTCCCCTGG + Intronic
907159963 1:52362498-52362520 ACGGAGCCAGCCAGATCCCCTGG - Intronic
912706637 1:111919852-111919874 CAGGTGCCACTCATTTCTCCAGG + Intronic
915723160 1:157998787-157998809 CCAAGGCCAGGCAGTTCCCCAGG - Intronic
919516457 1:198531599-198531621 CTGGGGACAGTCAGTTCACCTGG - Intronic
923704662 1:236334331-236334353 CCTGTTCATGTCAGTTCCCCTGG + Intergenic
924523796 1:244828784-244828806 CCGGTGGCTGTCAGTCCCCTGGG - Intergenic
1068957098 10:62827996-62828018 CTGGTGCCAGTCTGTAGCCCTGG - Intronic
1070825706 10:79389166-79389188 CAGGTGCCAGTGAATTCCCAGGG - Intronic
1071526910 10:86364486-86364508 CAGGAGCCAGGAAGTTCCCCGGG + Intronic
1071826317 10:89329595-89329617 CACGTGCCAGTGAGTTCTCCAGG - Intronic
1072247109 10:93553587-93553609 ACTGTGTCAGTCAGTTCACCAGG + Intergenic
1075279885 10:121130209-121130231 CCCTTGCAAGTCAGTTCCCACGG - Intergenic
1076647292 10:131961951-131961973 CCTGTGCCAGTCAGAACCCGCGG + Intergenic
1083995846 11:66271898-66271920 CAGCTGCCAGTCAGGACCCCAGG - Intronic
1084582337 11:70031909-70031931 CCGGTGCCACACAGATTCCCTGG - Intergenic
1084582885 11:70035182-70035204 CCGCTGCCAGGCAGCTCCACGGG - Intergenic
1088594316 11:111428525-111428547 CCGCTGTCAGTCTGCTCCCCTGG - Intronic
1089367721 11:117931344-117931366 CCCGTGCCAGGCACTTCCTCTGG - Intergenic
1090330717 11:125930063-125930085 CCGGTACCAGTCAGTGACCCGGG - Intergenic
1090841831 11:130496776-130496798 CAGGTGCCCGTCAGTACCCCTGG + Intergenic
1096102980 12:48980544-48980566 CCAGTGCCAGTCGGGGCCCCCGG - Exonic
1097670669 12:62533653-62533675 CAGGTGTCAGTCATTTCTCCAGG + Intronic
1100756226 12:97753641-97753663 TCAGGGCCAGTCAGTTTCCCAGG + Intergenic
1101026458 12:100611797-100611819 CCGGTACCAGTCTGTGGCCCAGG + Intronic
1115760609 14:36577173-36577195 CCGGTGCTCTTCAGGTCCCCAGG - Intergenic
1115761082 14:36580053-36580075 CCGGTGCTCTTCAGGTCCCCAGG + Intergenic
1115779221 14:36750807-36750829 CCTTTGCCAGGCAGTTCCCCAGG + Intronic
1118797137 14:69153388-69153410 CCGGCGCCACCCAGGTCCCCAGG - Intergenic
1119264538 14:73256146-73256168 ATGGAGCCAGTCTGTTCCCCAGG + Intronic
1128733325 15:70035184-70035206 CCTGTGCCAGTTAGTGCCCTAGG + Intergenic
1131662796 15:94536697-94536719 GCGGGGCCAGTCAGTTCACCGGG + Intergenic
1132578887 16:676195-676217 CCCGTGCCTGTCTGTTCCCTGGG - Intronic
1132767817 16:1543437-1543459 CCTGGGCAAGTCACTTCCCCTGG + Intronic
1132947736 16:2541329-2541351 CCGGTGTCAATCAGCTGCCCTGG - Intronic
1132966703 16:2660014-2660036 CCGGTGTCAATCAGCTGCCCTGG + Intergenic
1133978761 16:10618661-10618683 CAGCTGTCAGTCAGTTTCCCAGG - Intergenic
1137729814 16:50681108-50681130 CAGGTGCCAGGCAGGGCCCCAGG + Intronic
1138245534 16:55464258-55464280 CTGGTGCCATCCAGTGCCCCCGG - Intronic
1138490338 16:57372749-57372771 CCGGTGGCAGCCGCTTCCCCAGG + Intronic
1138694204 16:58796424-58796446 CTGGTGCCAGTCCGTGGCCCAGG - Intergenic
1142798020 17:2324149-2324171 CCGGTGCCAGTCAGTACTCCAGG - Exonic
1143114687 17:4575927-4575949 CAGGTTCCAGGCTGTTCCCCGGG + Intergenic
1146258285 17:31404380-31404402 CAGCTCCCAGTCACTTCCCCAGG - Intronic
1147961596 17:44170906-44170928 CAGGTGCCCGTCAAGTCCCCGGG + Exonic
1148622985 17:49048657-49048679 CCGGTACCAGTCCGTGGCCCGGG - Intronic
1151823409 17:76509714-76509736 CTGGAGCCAGCCACTTCCCCAGG - Intergenic
1152776820 17:82207064-82207086 CCGGGGCCAGTCACTGCACCTGG - Intronic
1157728486 18:49983783-49983805 CCAGAGCCAGTCAGTTCTCTGGG - Intronic
1160874437 19:1290611-1290633 CCGGTGGCCGTGTGTTCCCCGGG + Intronic
1162749162 19:12817843-12817865 CCTCTGCCAGTCAGTTCCTCAGG - Intronic
1162967087 19:14161138-14161160 CAGGAGCCACTCAGTGCCCCTGG - Intronic
1163635741 19:18436562-18436584 CCTGGGCTACTCAGTTCCCCGGG + Intronic
1166743989 19:45131217-45131239 CAGGTGGCAGCCAGCTCCCCAGG - Intronic
1166945132 19:46391610-46391632 CCAGTGCCATTCATTTCTCCTGG + Intronic
1167391365 19:49197037-49197059 CAGGTGCCAGCCAATTACCCTGG - Intronic
1168518591 19:57030414-57030436 CAGGTGCGAGTCACTTCGCCTGG - Intergenic
1202715783 1_KI270714v1_random:41596-41618 CTGGTGTCTGTCAGTTCACCTGG - Intergenic
932573369 2:72949972-72949994 GGGGTGCCAGTGGGTTCCCCAGG + Intronic
937502142 2:122490713-122490735 CCGGTTCCAGTTAGATCCCTTGG + Intergenic
939177935 2:138771806-138771828 CAGGTGCCATTCACTTCCTCTGG - Intronic
941621978 2:167788690-167788712 CCGGTACCAGTCTGTGGCCCAGG + Intergenic
942840048 2:180349225-180349247 CCAGTACCAGTCAGTGGCCCAGG + Intergenic
948394940 2:237638478-237638500 CTGGTACCAGTCTGTGCCCCAGG + Intronic
949034330 2:241809699-241809721 CAGGTGCCACCCACTTCCCCTGG - Intronic
949058076 2:241940051-241940073 TCGGTGCCAGGAAGTTCACCTGG - Intergenic
1171240497 20:23563591-23563613 CCAGTGCCAGGCAGTCCCACAGG - Intergenic
1172972090 20:38881132-38881154 CCTCTGCCAGGCAGCTCCCCCGG - Intronic
1173165140 20:40682751-40682773 CCGGCACCAGTCGGTTCTCCGGG - Intergenic
1173477120 20:43367970-43367992 CCGGTACCAGTCTGTCACCCAGG - Intergenic
1173740238 20:45395086-45395108 CAGGTGCCACTGCGTTCCCCTGG + Intronic
1175806624 20:61832793-61832815 GCAGTGCCAGGCAGTACCCCAGG - Intronic
1179288377 21:39997215-39997237 CAGGTTCCAGTCTGTTCTCCTGG + Intergenic
1180050996 21:45330942-45330964 CCCGTGCGAGTCCTTTCCCCTGG - Intergenic
1180146523 21:45923069-45923091 TCGGTGCCACGCATTTCCCCTGG + Intronic
1180863161 22:19099136-19099158 TCTGTGCCAGGCAGTTCTCCAGG + Intronic
1184915785 22:47568012-47568034 GCGATGCCAGTCAGGCCCCCTGG + Intergenic
949936692 3:9121420-9121442 CCGAGGCCAGTCAGTGCCCTGGG + Intronic
950579361 3:13852487-13852509 CCGGTGCCAGTCAGTTCCCCAGG - Intronic
951817041 3:26765619-26765641 GCAGTGACATTCAGTTCCCCTGG - Intergenic
952883089 3:37997677-37997699 CCTGTACCAGTGAGTACCCCTGG + Exonic
955047825 3:55376555-55376577 CCAGTGTCAGTCTGTTGCCCAGG - Intergenic
955142967 3:56287897-56287919 CCTGTGCCAGTCACTTCCCAAGG - Intronic
957613985 3:82505481-82505503 CCGGAGCACGTCAGTTCCCCAGG - Intergenic
958462319 3:94414341-94414363 CTGGAGTCAGTCAGTCCCCCAGG + Intergenic
961553352 3:127681208-127681230 CCAGTGCCAGTCTTTTCCCCAGG + Intergenic
961653361 3:128428517-128428539 CCGGGGCCAGGCAGCTCCCCAGG - Intergenic
962704115 3:138026914-138026936 TCGGTGCCAGTCAGTCCCTGGGG + Intronic
976154488 4:82127889-82127911 CTGGTGCCAAACAGTTACCCAGG + Intergenic
980035492 4:127878630-127878652 CAGGTGCAAGTCACCTCCCCTGG + Intergenic
982345362 4:154351874-154351896 CCAGTACCAGTCAGTGGCCCAGG + Intronic
991320454 5:65367796-65367818 CAGTTGCCAGTTTGTTCCCCAGG - Intronic
991633482 5:68680196-68680218 CCGGTACCAGTCTGTGGCCCAGG + Intergenic
992492535 5:77259218-77259240 CCGGTGGCAGTCAGCCCTCCTGG + Intronic
997563415 5:134868545-134868567 CAGGTGCCAGTCACCACCCCTGG + Intergenic
999134945 5:149312268-149312290 CCCCAGCCAGTTAGTTCCCCTGG - Intronic
1002273193 5:178086408-178086430 CGGGCGCCCGTCATTTCCCCGGG + Intergenic
1020250810 7:6466964-6466986 CCAGTACCAGTCAGTGGCCCAGG + Intronic
1023742568 7:43293783-43293805 CTGGTACCAGTCTGTGCCCCAGG - Intronic
1026557411 7:71420496-71420518 GCGGTGGCAGTCAGTGCCCTGGG + Intronic
1034629104 7:152516710-152516732 CCTGTGCCAGTCACTGTCCCAGG - Intergenic
1035454911 7:159001900-159001922 CTGGTGCCTGTGAGCTCCCCAGG + Intergenic
1042981429 8:74533215-74533237 CCGGTACCAGTCTGTGGCCCCGG + Intergenic
1045086099 8:98687508-98687530 CCGGTACCAGTCTGTGGCCCAGG + Intronic
1045249177 8:100468835-100468857 CCTGTACCAGTCAGTGACCCAGG + Intergenic
1049501590 8:142970533-142970555 GGGGTCCCAGTCAATTCCCCAGG + Intergenic
1050423863 9:5494080-5494102 CCAGAGCCAGCCAGTTTCCCAGG - Intergenic
1056732813 9:89180415-89180437 CCGGTGCCAGGCAATCCCCTGGG + Intergenic
1057702824 9:97376145-97376167 CCAGTGCCTGTCAGACCCCCTGG + Intronic
1059437559 9:114285715-114285737 AAGGTGCCACTCAGTACCCCGGG + Intronic
1062043667 9:134415508-134415530 CTGGTGCCTGTGAGTACCCCAGG + Intronic
1062107737 9:134765021-134765043 CCTGTGGCAGGCAGTTCTCCCGG + Intronic
1186206629 X:7207162-7207184 AGGGTGCCACTCAGTTGCCCAGG - Intergenic
1195695118 X:107661254-107661276 CCTGAGGCAGTGAGTTCCCCGGG + Intergenic