ID: 950579367

View in Genome Browser
Species Human (GRCh38)
Location 3:13852506-13852528
Sequence GACCCACTCCTTGTTCCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579367_950579372 19 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579372 3:13852548-13852570 GTGGAAACTGAGGTCGCAAGAGG 0: 1
1: 1
2: 6
3: 71
4: 598
950579367_950579371 9 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579371 3:13852538-13852560 ATCGACAGATGTGGAAACTGAGG 0: 1
1: 4
2: 74
3: 761
4: 4427
950579367_950579368 0 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579368 3:13852529-13852551 ATAGTCCCAATCGACAGATGTGG 0: 1
1: 0
2: 1
3: 29
4: 320
950579367_950579373 20 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579373 3:13852549-13852571 TGGAAACTGAGGTCGCAAGAGGG 0: 1
1: 0
2: 8
3: 42
4: 421
950579367_950579375 25 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579375 3:13852554-13852576 ACTGAGGTCGCAAGAGGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 201
950579367_950579374 21 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579374 3:13852550-13852572 GGAAACTGAGGTCGCAAGAGGGG 0: 1
1: 1
2: 10
3: 96
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579367 Original CRISPR GACCCACTCCTTGTTCCGAC CGG (reversed) Intronic
901445482 1:9305500-9305522 TACCTACTCCTTCATCCGACAGG - Intronic
903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG + Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
1067237097 10:44460185-44460207 ACCCCACTCCTTGGTCCTACTGG - Intergenic
1070770699 10:79080766-79080788 GACCCACTCCTTCTGCCTAAAGG - Intronic
1071907927 10:90195639-90195661 GCCCCACGCTTTGTTCTGACTGG + Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1075571744 10:123551406-123551428 GAGCCACGCCATGTTCCGAGGGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1093176462 12:15918372-15918394 GATCCCCTCCTTGTTCTGATTGG + Intronic
1096542350 12:52314818-52314840 GACCCTGCCCTTGTTCCCACAGG - Exonic
1107169417 13:37322115-37322137 AACCCACTCCTTGGTACAACTGG - Intergenic
1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG + Intergenic
1115520774 14:34231088-34231110 GGCCCACTCCATGTTCCCAGTGG - Intronic
1120561581 14:86000703-86000725 GACTCACTCTTTGTCCAGACTGG + Intergenic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1132641468 16:980446-980468 GACCAGCTCCTTCTGCCGACCGG + Intronic
1139434371 16:66927478-66927500 GAACCACTCCTAGGTCCGCCCGG + Intergenic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1146386778 17:32383869-32383891 GTCCCACTCCTTGTCCAGGCTGG - Intergenic
1151443224 17:74147231-74147253 GACCCACTCCGTGTTATTACAGG - Intergenic
1151774452 17:76189913-76189935 GACCCACTGCTTCTTGCGCCTGG - Intronic
1152724886 17:81940274-81940296 GAACCACTCCTGGTTCAGAGAGG - Exonic
1157887168 18:51379909-51379931 GACCCAGTCAATGTTCCCACGGG - Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
932304473 2:70692115-70692137 GCCCCACGCCTTGGTCCAACAGG + Intronic
940777811 2:157902940-157902962 CACCCACTCCTTGGTGCAACTGG - Intronic
941772738 2:169362041-169362063 GACCCTGTCTTTGTTCCCACGGG - Intronic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1181235539 22:21445893-21445915 GCCCCACTCCTTCTTCCGAGTGG - Exonic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950036701 3:9890998-9891020 GCTCCACCCCTTGTTCCGCCCGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
954357855 3:50097645-50097667 GACCAACTCCTTTTTCCAAAAGG - Intronic
955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG + Intronic
957744484 3:84321237-84321259 AACCCACTCCTTTTTCCTATTGG - Intergenic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
975040955 4:69743855-69743877 GGCCCCCACCTTGTTCCCACAGG - Intronic
995158199 5:108941281-108941303 TACCCACTCCTTTTTTTGACAGG - Intronic
998397719 5:141829766-141829788 GACCCACACCCTGTGCAGACTGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG + Intronic
1021165415 7:17333672-17333694 GAACCACTCCTTGTTCCTAATGG - Intronic
1026850534 7:73720508-73720530 GACCCACCCCTTTTTCCTGCAGG + Intergenic
1043337421 8:79193614-79193636 AACCCACTCCTTGTTCCTTGTGG - Intergenic
1044662076 8:94601130-94601152 TACCCTCTCCTTCTTCCGAGCGG - Intergenic
1045294042 8:100858759-100858781 GATCCAAGCCTTGTTCTGACAGG - Intergenic
1047703416 8:127473197-127473219 AACCCACTCCTTATTCCCAGAGG + Intergenic
1061830841 9:133293317-133293339 GACCCCTTCCTTCTCCCGACTGG - Intergenic