ID: 950579368

View in Genome Browser
Species Human (GRCh38)
Location 3:13852529-13852551
Sequence ATAGTCCCAATCGACAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579367_950579368 0 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579368 3:13852529-13852551 ATAGTCCCAATCGACAGATGTGG 0: 1
1: 0
2: 1
3: 29
4: 320
950579361_950579368 19 Left 950579361 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 950579368 3:13852529-13852551 ATAGTCCCAATCGACAGATGTGG 0: 1
1: 0
2: 1
3: 29
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579368 Original CRISPR ATAGTCCCAATCGACAGATG TGG Intronic
900693781 1:3997457-3997479 ACAGCCCCAATTCACAGATGAGG + Intergenic
900707930 1:4092015-4092037 ATCATCCCATTCTACAGATGAGG - Intergenic
902291664 1:15439472-15439494 ATAGCCCCATTTTACAGATGAGG + Intronic
902659142 1:17889372-17889394 ATAGCCCCATTTCACAGATGAGG + Intergenic
902787043 1:18739530-18739552 TTATTCCCATTGGACAGATGAGG + Intronic
902809013 1:18877793-18877815 ATTCTCCCACTCCACAGATGAGG + Intronic
902840905 1:19073314-19073336 ATATTCCCATTTGACAGGTGAGG + Intergenic
903343589 1:22670555-22670577 ATAGTCACATTCCACAGGTGAGG - Intergenic
903357243 1:22755684-22755706 TTAGTCCCATTTTACAGATGAGG - Intronic
903418616 1:23201934-23201956 ATTATCCCAATTTACAGATGAGG - Intergenic
903574109 1:24327420-24327442 ATAGACCCATTTAACAGATGAGG + Intronic
903631078 1:24771876-24771898 ATACACCCACTTGACAGATGAGG - Intronic
904612737 1:31734297-31734319 ATTATCCCAATTTACAGATGAGG + Intronic
905012351 1:34755890-34755912 TTATTCCCAATTTACAGATGAGG - Intronic
905314462 1:37072991-37073013 TTAGTCCCATTTAACAGATGAGG + Intergenic
907455182 1:54571138-54571160 TTATTCCCATTTGACAGATGTGG + Intronic
907714628 1:56915679-56915701 TGAGTCCCAATTTACAGATGAGG + Intronic
907992968 1:59600730-59600752 ATGATCCCCATCGACAGATAAGG + Intronic
908110493 1:60892742-60892764 TTACTTCCAATTGACAGATGAGG + Intronic
908317008 1:62942633-62942655 ATAGTCCCATTTTGCAGATGTGG + Intergenic
908388048 1:63661387-63661409 ATATTCCCATTTTACAGATGAGG + Intergenic
912337440 1:108876266-108876288 AGTGTCCCAAGCGGCAGATGCGG - Intronic
914322800 1:146581535-146581557 AGAATCCCATTCAACAGATGAGG + Intergenic
916420213 1:164630631-164630653 TTAGTCCCACTTGACAGATGTGG + Intronic
916449368 1:164905297-164905319 ATAGTTCCATTTTACAGATGAGG + Intergenic
917042516 1:170821897-170821919 ATTGTCCCAATTTATAGATGAGG + Intergenic
917769832 1:178265547-178265569 ATAGTCCCTATTCATAGATGAGG + Intronic
919820727 1:201470148-201470170 ATCCTCCTATTCGACAGATGAGG - Intergenic
923132885 1:231092560-231092582 CTAGTCCCATTTTACAGATGGGG - Intergenic
923504422 1:234593217-234593239 TTATTCCCATTCTACAGATGAGG + Intergenic
924330165 1:242933670-242933692 CTAGTCCCATTTTACAGATGAGG - Intergenic
1063145590 10:3292476-3292498 ATCGTCCCAATTCAGAGATGAGG + Intergenic
1063717540 10:8543372-8543394 TTAGTCCCAATTTACAGGTGCGG + Intergenic
1065452464 10:25873399-25873421 CTACTCCTAATCTACAGATGAGG - Intergenic
1067840041 10:49668375-49668397 ATATTCCCATTGTACAGATGAGG - Intergenic
1069693431 10:70369679-70369701 ATACTCCCATTTTACAGATGAGG - Intronic
1069983221 10:72266755-72266777 ATAGTGCCATTCTACAGATGTGG - Intergenic
1069990403 10:72311783-72311805 CTAGTCCCATTTTACAGATGGGG - Intergenic
1070158946 10:73853978-73854000 TTATTCCCATTCTACAGATGAGG + Intronic
1072887810 10:99295791-99295813 ATATCCCCATTCTACAGATGAGG - Intergenic
1073442522 10:103560847-103560869 ATAGTCCCATTTCACAGATAAGG - Intronic
1074082049 10:110175859-110175881 GTAGTCCCACTTTACAGATGGGG + Intergenic
1075071718 10:119324309-119324331 ATATACCCAGTTGACAGATGAGG - Intronic
1075571702 10:123551051-123551073 GTAGTCCCATTCTACAGATGAGG - Intergenic
1076476616 10:130758129-130758151 ATATTCCCATTTTACAGATGAGG + Intergenic
1078402115 11:11037701-11037723 ATTATCCCCATGGACAGATGAGG + Intergenic
1079110794 11:17604026-17604048 ATTTTCCCAATCTACAGATGAGG + Intronic
1079997513 11:27310301-27310323 ATAATCCCATTTTACAGATGAGG + Intergenic
1080682920 11:34492683-34492705 ATTATCCCATTGGACAGATGAGG + Intronic
1080774645 11:35374032-35374054 ATAATCCCACTTCACAGATGAGG - Intronic
1083333496 11:61910065-61910087 ATTGTCCCATTCTACAGATGAGG + Intronic
1084419591 11:69053661-69053683 ATAGCCCCACTTGACAGAGGAGG + Intronic
1084518665 11:69649901-69649923 ACAGTCCCACTGTACAGATGGGG - Intronic
1085106830 11:73851253-73851275 ATATTCCCATTTAACAGATGTGG + Intronic
1085533684 11:77205922-77205944 ATCGTCCCATTTTACAGATGAGG + Intronic
1085717401 11:78884884-78884906 TTATTCGCAATTGACAGATGAGG - Intronic
1087176780 11:95103736-95103758 TTAGTCCCATGCCACAGATGGGG - Intronic
1088491432 11:110392187-110392209 ATAACCCCAGTCTACAGATGAGG + Intergenic
1088979841 11:114852263-114852285 ATACTCCCATTGAACAGATGGGG - Intergenic
1089138424 11:116267708-116267730 CTATTCCCATTTGACAGATGAGG + Intergenic
1089157998 11:116416739-116416761 ATGTTCCCATTTGACAGATGTGG - Intergenic
1089327326 11:117666240-117666262 ACACTCCCAATTTACAGATGTGG - Intronic
1089397115 11:118143591-118143613 ATATTCCCATTTTACAGATGAGG + Intronic
1090555743 11:127873250-127873272 TTATTCCCATTCTACAGATGAGG - Intergenic
1090723914 11:129504613-129504635 ATATTCCCATTTTACAGATGAGG + Intergenic
1093794579 12:23296226-23296248 TTAGTCCCATTTTACAGATGAGG - Intergenic
1094091599 12:26655978-26656000 ATAGCCCCATTTTACAGATGAGG - Intronic
1094273387 12:28642071-28642093 ATAGTCCCAATTGACAGCCGGGG - Intergenic
1095922582 12:47545494-47545516 ATAACCCCAATTTACAGATGAGG - Intergenic
1099228330 12:79994682-79994704 TTATCCCCAATCTACAGATGAGG - Intergenic
1100739588 12:97576861-97576883 ATAGACCCCATCCACAGATGGGG + Intergenic
1101548423 12:105738897-105738919 ATCATCCCATTCTACAGATGAGG + Intergenic
1101754578 12:107610960-107610982 AAAGTCACAAGGGACAGATGGGG + Intronic
1101851094 12:108402990-108403012 ATTGTCCCATTTTACAGATGAGG - Intergenic
1102009921 12:109611982-109612004 ATGGTCACAATGGCCAGATGGGG + Intergenic
1102169412 12:110830717-110830739 TTACTCCCATTCTACAGATGGGG + Intergenic
1102414002 12:112744669-112744691 TTAGCCCCATTCTACAGATGAGG + Intronic
1102562557 12:113772811-113772833 ATATCCCCAATTTACAGATGAGG + Intergenic
1102693747 12:114781956-114781978 AAATTCCCATTTGACAGATGAGG + Intergenic
1103242021 12:119421632-119421654 TTAGTCCCATTTCACAGATGGGG + Intronic
1103361517 12:120357255-120357277 CCAGTCCCATTTGACAGATGTGG + Intronic
1103441593 12:120966969-120966991 ATATCCCCATTCTACAGATGCGG + Intergenic
1103827263 12:123749548-123749570 TTAGTCCCATTTTACAGATGAGG - Intronic
1106197202 13:27504061-27504083 ACAGTCACAATGGTCAGATGGGG + Intergenic
1106332452 13:28751771-28751793 ATTGTCCCCATTGCCAGATGAGG - Intergenic
1106335430 13:28778662-28778684 ATAGTCCCAATCGAGAGGAGCGG + Intergenic
1106407579 13:29487390-29487412 TTATGCCCAATTGACAGATGTGG - Intronic
1107424554 13:40280224-40280246 TTAATCCCATTCTACAGATGAGG - Intergenic
1107641041 13:42443596-42443618 ATAATCCCATTCTTCAGATGAGG - Intergenic
1110880357 13:80564663-80564685 TTATTCCCAATTTACAGATGAGG - Intergenic
1114619224 14:24085009-24085031 ATAGTCTCCAAAGACAGATGAGG - Intronic
1114636745 14:24191608-24191630 ATATTTCCATTCCACAGATGAGG - Intronic
1116860696 14:49993308-49993330 ATAGTCTCATTTTACAGATGTGG - Intronic
1118626870 14:67667454-67667476 ATAGTCCCTATTTGCAGATGAGG - Intronic
1119531790 14:75366753-75366775 ATATTCCCATCTGACAGATGTGG - Intergenic
1119967334 14:78931559-78931581 ATAGTCCCATTTTACAGATGAGG + Intronic
1120964649 14:90156700-90156722 ATCATCCCATTCCACAGATGAGG + Intronic
1120970851 14:90205714-90205736 ATATGCCCACTCTACAGATGGGG + Intergenic
1121210345 14:92203803-92203825 ATTGTCCCATTGTACAGATGAGG + Intergenic
1121423856 14:93834298-93834320 CTAGTCCCATTTAACAGATGGGG + Intergenic
1121444203 14:93968380-93968402 TTGGTCCCATTCTACAGATGAGG + Intronic
1121648824 14:95540418-95540440 ATATTCCCATTTTACAGATGAGG + Intronic
1125162882 15:36666953-36666975 ATTATCCCCATCTACAGATGAGG + Intronic
1125295142 15:38194416-38194438 ATATTCCCATTCTACAGATGAGG - Intergenic
1125746131 15:41998459-41998481 ATTCTCCCAATGTACAGATGAGG + Intronic
1127238323 15:57081405-57081427 TTATTCCCATTCCACAGATGAGG - Intronic
1127428405 15:58878397-58878419 ACAGTCCCACTCTACAAATGAGG + Intronic
1127709450 15:61581192-61581214 TTATTCCCATTCGACAGATGAGG + Intergenic
1128236443 15:66070733-66070755 TTATTCCCATTCCACAGATGAGG - Intronic
1128354267 15:66913595-66913617 ATAGTGCCATTGTACAGATGAGG - Intergenic
1129466269 15:75725903-75725925 AAAGTCCCATTTTACAGATGAGG + Intronic
1129755415 15:78095122-78095144 ATATTCCCATTTTACAGATGAGG - Intronic
1130523138 15:84679752-84679774 ATATTCCCATTCTACAGATGAGG - Intronic
1130954892 15:88620966-88620988 ATGTTCCCAATCTGCAGATGTGG + Intergenic
1133391775 16:5416195-5416217 ATGGTCCCATTTTACAGATGAGG + Intergenic
1133598890 16:7319845-7319867 ATAGCCCCATTCTACAAATGAGG - Intronic
1133772722 16:8877026-8877048 ATTGTCCCATTCTACAGATGGGG + Intergenic
1133774664 16:8887255-8887277 ATTGCCCCAACCTACAGATGCGG + Intergenic
1134679284 16:16112856-16112878 ATTGTCCCATTTTACAGATGAGG + Intronic
1134858679 16:17541522-17541544 TTAGTCCCATTTCACAGATGAGG - Intergenic
1135724939 16:24846733-24846755 ATATTCCCATTTGACAGATAAGG - Intronic
1135837010 16:25835596-25835618 GTAATCCCATTTGACAGATGAGG + Intronic
1137270049 16:46897430-46897452 TTAATCCCATTTGACAGATGAGG - Intronic
1138577425 16:57916910-57916932 CTAGCCCCATTCTACAGATGAGG + Intronic
1140010761 16:71129315-71129337 AGAATCCCATTCAACAGATGAGG - Intronic
1141096429 16:81166190-81166212 CTAGCCCCATTGGACAGATGGGG + Intergenic
1141669864 16:85486014-85486036 ATGGCCCCATTCTACAGATGGGG + Intergenic
1141844188 16:86595964-86595986 GTAGGCCCATTCTACAGATGAGG + Intergenic
1142755222 17:2012415-2012437 TTAGTCCCAAGTTACAGATGAGG - Intronic
1143253492 17:5539224-5539246 ATACTCCCATTCCACAGATGAGG + Intronic
1144604205 17:16650015-16650037 ATATTCCCATTCCATAGATGAGG + Intronic
1144808668 17:17984642-17984664 ATAATCCCAATCTACAGAAGAGG + Intronic
1145269828 17:21398935-21398957 TTAGGCCCATTCCACAGATGTGG + Intronic
1146535249 17:33645124-33645146 ATATTCCCATTTGACAGAGGAGG + Intronic
1147314954 17:39615620-39615642 CTAGTCCCATTTTACAGATGAGG - Intergenic
1147500136 17:40955250-40955272 ATAGCCCCATTTCACAGATGAGG - Intergenic
1147537636 17:41331399-41331421 ATCGGCCCAATTTACAGATGAGG - Intergenic
1148488861 17:48010393-48010415 ATAGTCCCATTTTACTGATGAGG + Intergenic
1149519223 17:57305667-57305689 CTAGTCCCATTTTACAGATGAGG + Intronic
1149748627 17:59123828-59123850 ATATTCCCATTTTACAGATGAGG + Intronic
1152069933 17:78129375-78129397 ATATTCCCATTTCACAGATGAGG + Intronic
1155144815 18:23074564-23074586 GTAGTCCCATTTTACAGATGGGG - Intergenic
1155639624 18:27998143-27998165 TTAGTCCCATTTCACAGATGAGG - Intronic
1155733416 18:29190849-29190871 ATAATCCCAATAGATAGTTGGGG + Intergenic
1157439452 18:47699145-47699167 ATATTCCCCATCTGCAGATGAGG + Intergenic
1157443919 18:47730812-47730834 ATTATCCCAATGGACAGGTGAGG + Intergenic
1158854906 18:61533350-61533372 ATTATCCCAATCAACAGATAAGG - Intronic
1159561037 18:69995201-69995223 ATAGTCCCAAGCCCCAGATTTGG - Intergenic
1160610443 18:80080494-80080516 ATTGTCTCATTCTACAGATGAGG - Intronic
1162802097 19:13116889-13116911 CTAGTCCCATTTCACAGATGAGG + Exonic
1162852360 19:13440638-13440660 TTATTCCCATTCCACAGATGAGG + Intronic
1165918785 19:39278790-39278812 TTAGTCCCACTTTACAGATGAGG + Intergenic
1166800952 19:45456525-45456547 ATACCCCCACTCAACAGATGAGG - Intronic
1167458075 19:49608943-49608965 ACAGTCCCAGTTGACAGACGGGG - Intronic
1167552476 19:50170431-50170453 ATTGTCCCCATCTACAGATGAGG + Intergenic
925383506 2:3445622-3445644 ATTATCCCAATTTACAGATGGGG + Intronic
925979220 2:9163811-9163833 TTAGTCCCATTTCACAGATGAGG + Intergenic
926743111 2:16128312-16128334 ATAGTCACTATCCAGAGATGTGG - Intergenic
926780343 2:16465445-16465467 ATAATCCCATTTTACAGATGAGG + Intergenic
928670766 2:33600770-33600792 TTAGTCACATTCTACAGATGAGG + Intergenic
929349171 2:40927659-40927681 GTGGTCCCAATCAAGAGATGAGG - Intergenic
929588010 2:43128083-43128105 ATCCTCCCATTTGACAGATGAGG + Intergenic
930247659 2:49001892-49001914 TTTTTCCCAATCTACAGATGAGG - Intronic
931621183 2:64211263-64211285 AGAGTCACCATCGACGGATGGGG - Intergenic
932074779 2:68652755-68652777 ATATTCCCATTTTACAGATGAGG + Intronic
934056454 2:88255182-88255204 ATAGTCCCATTTTTCAGATGAGG + Intergenic
935623791 2:105151832-105151854 TTAGTCCCATTTTACAGATGGGG + Intergenic
937082768 2:119152073-119152095 TTAGTCCCATTTTACAGATGAGG - Intergenic
938771297 2:134503445-134503467 ATATTCCCATTTGAAAGATGAGG - Intronic
940221800 2:151360366-151360388 TTAGTCCCATTTGACAAATGAGG + Intronic
940613728 2:156024225-156024247 ATAATCTCAAACTACAGATGCGG - Intergenic
942413399 2:175734390-175734412 TTACTCCCATTCTACAGATGAGG - Intergenic
944710296 2:202329411-202329433 ATAATCCCAATCTACATGTGAGG - Intergenic
944735768 2:202562956-202562978 ATATTCCCATTTTACAGATGAGG + Exonic
945147403 2:206752862-206752884 ACAGTCCCACCCGACAGATAGGG - Intronic
946024996 2:216666283-216666305 ACATCCCCAATAGACAGATGAGG - Intergenic
946847124 2:223869317-223869339 ATTGTCCCAATCTCCAAATGCGG - Intronic
948960453 2:241331356-241331378 ATAGTTCCAATCCACAAATGGGG - Intronic
1168961629 20:1874097-1874119 TTACTCCAAATTGACAGATGAGG - Intergenic
1169400176 20:5273081-5273103 TTAGTCCCATTTTACAGATGAGG - Intergenic
1169665677 20:8033129-8033151 ATAGTCCCATTTTACAGATGGGG - Intergenic
1169924968 20:10773575-10773597 ATCATCCCCATCAACAGATGAGG - Intergenic
1171201607 20:23246500-23246522 ATAGTCCCTTTCTACAGATTAGG + Intergenic
1172075097 20:32290035-32290057 ATATTCCCATTTTACAGATGAGG + Intronic
1173345325 20:42194028-42194050 TTATTCCCATTCTACAGATGAGG - Intronic
1173644454 20:44624912-44624934 TTAGTCCCATTTGACAGATGAGG - Intronic
1173666636 20:44767711-44767733 ATATTCCCATTTTACAGATGAGG - Intronic
1174029916 20:47615123-47615145 ATAGTCCCATTTTACAGATAAGG - Intronic
1174250337 20:49214664-49214686 CTATTCCCATTGGACAGATGAGG - Intergenic
1174539508 20:51277808-51277830 TTATTCCCATTCTACAGATGAGG - Intergenic
1175143072 20:56874818-56874840 ATTGTTCCATTCTACAGATGTGG + Intergenic
1175263399 20:57688677-57688699 ACATTCCCATTTGACAGATGAGG + Intronic
1175268085 20:57714669-57714691 TTATTCCCATTTGACAGATGGGG + Intergenic
1177641320 21:23847644-23847666 ATTATCCAAATCTACAGATGTGG - Intergenic
1179228407 21:39476926-39476948 AGAGTCCCAATAAACAGAAGGGG + Intronic
1179273364 21:39868704-39868726 TTATTCCCAATTGACAGATGAGG + Intronic
1181770960 22:25125224-25125246 ATTGTCCCATTTTACAGATGGGG + Intronic
1181917074 22:26290092-26290114 ATAGCCCCATTTGACAGCTGAGG + Intronic
1182041262 22:27240478-27240500 TTAGTCCCAGTTTACAGATGAGG + Intergenic
1182166018 22:28174207-28174229 ATATTCCCATTTCACAGATGAGG - Intronic
1182547950 22:31086371-31086393 TTATTCCCATTTGACAGATGAGG - Intronic
1182722627 22:32415588-32415610 TTAGTCCCATTTTACAGATGAGG - Intronic
1183307548 22:37090715-37090737 ATCGTCCCATTCTATAGATGAGG - Intronic
1183317988 22:37147534-37147556 ATTATCCCATTCTACAGATGAGG + Intronic
1183475844 22:38035352-38035374 ATAAGCCCATTTGACAGATGAGG + Intronic
1183723589 22:39576337-39576359 ATAGCCCCATTTTACAGATGAGG + Intronic
1183727994 22:39600107-39600129 GTAGTCCCATTTTACAGATGAGG - Intronic
1184894793 22:47400614-47400636 ACACTCCCAATTTACAGATGAGG + Intergenic
949388069 3:3527186-3527208 ATGGTCCCAATGGAGAGGTGTGG - Intergenic
950131897 3:10553037-10553059 ATATTCCCATTGCACAGATGGGG - Intronic
950579368 3:13852529-13852551 ATAGTCCCAATCGACAGATGTGG + Intronic
950659971 3:14461264-14461286 TTAGTCCCATTTTACAGATGGGG + Intronic
951447621 3:22801293-22801315 ATGTTCCCATTCTACAGATGAGG + Intergenic
952046994 3:29334038-29334060 ATAGTCCCGCTGTACAGATGTGG - Intronic
952262023 3:31749341-31749363 ATAGACACATTCCACAGATGTGG + Intronic
952477838 3:33729578-33729600 ATATTCCCAATGGACAGATGGGG + Intergenic
955676816 3:61457458-61457480 CTAGTCCCATTTTACAGATGAGG + Intergenic
955999219 3:64710928-64710950 ATTGTCCCATTTTACAGATGAGG - Intergenic
956014079 3:64862775-64862797 ATAGTTGCAATTGACAGATGAGG + Intergenic
956339807 3:68209876-68209898 ATAGTTCAAATCTATAGATGTGG + Intronic
956751658 3:72348320-72348342 CTATTCCCATTTGACAGATGCGG + Intergenic
958850742 3:99322329-99322351 TTAATCCCTATCAACAGATGAGG + Intergenic
959904958 3:111701267-111701289 ATTGGCCCATTTGACAGATGAGG + Intronic
960033706 3:113081991-113082013 ATAGACCTAATGGACATATGTGG + Intergenic
960957156 3:123041043-123041065 TTATTCCCACTTGACAGATGAGG - Intergenic
961754133 3:129117288-129117310 TTAGTCCCATTTCACAGATGAGG + Intronic
964423683 3:156530806-156530828 AGAGTTCCAAGCAACAGATGTGG + Intronic
964506743 3:157407882-157407904 ATATTCCCATTTTACAGATGAGG + Intronic
965720233 3:171653132-171653154 TTACTCCCATTCTACAGATGAGG - Intronic
967292193 3:187932132-187932154 TTATTCCCATTCTACAGATGAGG - Intergenic
969348020 4:6581339-6581361 ACAGCCCCATTTGACAGATGAGG + Intronic
969379624 4:6785443-6785465 ATCTTCCCATTCTACAGATGAGG - Intronic
970337536 4:15065535-15065557 TTATTCCCACTTGACAGATGTGG + Intronic
970708431 4:18833015-18833037 ATAGTCACATTTCACAGATGAGG - Intergenic
971365695 4:25975421-25975443 ATATCCCCATTCTACAGATGAGG + Intergenic
973048845 4:45569620-45569642 TTAGGCCCATTTGACAGATGAGG - Intergenic
974120904 4:57637895-57637917 ATTATCCCAGTTGACAGATGAGG - Intergenic
974389746 4:61250833-61250855 ATATTCCCATTTTACAGATGAGG - Intronic
977250387 4:94682499-94682521 ACACTCCCAATATACAGATGAGG - Intergenic
977768858 4:100832762-100832784 TTATTCCCATTCTACAGATGAGG + Intronic
977962010 4:103097133-103097155 ATACTCCCATTTTACAGATGAGG + Intronic
983560721 4:169098813-169098835 ACAGTCCTATTCTACAGATGAGG - Intronic
991269824 5:64766796-64766818 ATATTCCCATTTTACAGATGAGG - Intronic
991360954 5:65819387-65819409 ATATTCCCATTTGACAGATGAGG + Intronic
992484982 5:77185960-77185982 CTATTCCCATTTGACAGATGAGG - Intergenic
992968518 5:82029923-82029945 ATAGTACCAATTTATAGATGAGG + Intronic
997718570 5:136060202-136060224 ATTGTCCCATTCCACAGAAGAGG - Intronic
998560963 5:143171225-143171247 ATATTCCCATTTTACAGATGGGG + Intronic
998671867 5:144362577-144362599 CTATTCCCAGTCCACAGATGAGG - Intronic
999730168 5:154471230-154471252 ATGCTCCCCATGGACAGATGTGG - Intergenic
1001094682 5:168767063-168767085 AAAGTCCCACTTTACAGATGAGG - Intronic
1001171979 5:169428071-169428093 ATAGCCCCATGCTACAGATGAGG - Intergenic
1002421812 5:179152922-179152944 GTAGTCCCATTTTACAGATGAGG - Intronic
1003766217 6:9240100-9240122 TTATTCCCAATGTACAGATGAGG - Intergenic
1003929375 6:10908899-10908921 TTAGTCCCATTTTACAGATGAGG - Intronic
1004099084 6:12590458-12590480 ATAGACCAAAACGACAGAAGGGG + Intergenic
1004871731 6:19912020-19912042 ATATTCCCATTTTACAGATGAGG + Intergenic
1007730665 6:43943546-43943568 TTAGTCCCATTTTACAGATGAGG - Intergenic
1007965850 6:46003098-46003120 CTATTCCCAATTTACAGATGAGG - Intronic
1008283696 6:49624627-49624649 TTAGTCCCATTTTACAGATGAGG - Intronic
1009324610 6:62335312-62335334 AAAGACCCAATCAACAGATCAGG - Intergenic
1011071549 6:83391198-83391220 TTACTCCCAATTTACAGATGAGG + Intronic
1011347342 6:86386165-86386187 ATAGTCCTAATCAACATATTTGG - Intergenic
1014249659 6:119102195-119102217 ATACTCCCAATCTTCTGATGAGG - Intronic
1016397597 6:143642102-143642124 ATAGTCCCAAACCCTAGATGAGG + Intronic
1018249602 6:161855549-161855571 AAAGACCCAATCAACAGATGAGG - Intronic
1018301382 6:162406208-162406230 TTATTCCAAATGGACAGATGTGG + Intronic
1018959673 6:168439454-168439476 TTATTCCCATTCTACAGATGAGG - Intergenic
1019500257 7:1361007-1361029 ATTATCCCATTTGACAGATGGGG - Intergenic
1020469782 7:8523018-8523040 ATATTCCCATTTTACAGATGAGG - Intronic
1023252062 7:38275121-38275143 TTAGTCCCATTTCACAGATGAGG - Intergenic
1023922494 7:44640325-44640347 ATATTCCCACTGGAGAGATGTGG - Intronic
1024242898 7:47448951-47448973 ATTGTCCCGCTCCACAGATGGGG - Intronic
1025061013 7:55808152-55808174 ATAGACCTAATGGACATATGTGG + Intronic
1025161775 7:56667535-56667557 ATCAATCCAATCGACAGATGAGG + Intergenic
1026788369 7:73316318-73316340 ATAGCCCCACTTTACAGATGAGG + Intronic
1027244287 7:76356290-76356312 ATTGTCCCATTTTACAGATGAGG + Intronic
1027516082 7:79144068-79144090 ATTGTCCCACTTTACAGATGAGG - Intronic
1027646786 7:80811882-80811904 ATAGTCGCAATCAACAGAGGTGG + Intronic
1027651725 7:80876506-80876528 TTAGTTCCAATTGATAGATGGGG - Intronic
1028908131 7:96177561-96177583 TTATTCCCATTCTACAGATGTGG - Intronic
1029606044 7:101599977-101599999 ATATTCCCATTCTGCAGATGAGG - Intergenic
1029885326 7:103863726-103863748 TTAGCCCCATTCTACAGATGAGG + Intronic
1030017514 7:105239156-105239178 ATAGTCCCATTCATCAGAAGAGG + Intronic
1033017668 7:137688431-137688453 ATTATCCCCATCTACAGATGAGG + Intronic
1033020865 7:137723008-137723030 TTAGTCCCATTTTACAGATGGGG - Intronic
1034437046 7:151067658-151067680 TTATTCCCATTTGACAGATGAGG + Intronic
1034587282 7:152105736-152105758 ATAGTTCCAATCGACAGTTTGGG - Intronic
1035467427 7:159088898-159088920 CTATTCCCATTCCACAGATGAGG - Intronic
1035467435 7:159088936-159088958 CTATTCCCATTCCACAGATGAGG - Intronic
1035467443 7:159088974-159088996 CTATTCCCATTCCACAGATGAGG - Intronic
1035467451 7:159089012-159089034 CTATTCCCATTCCACAGATGAGG - Intronic
1035467459 7:159089050-159089072 CTATTCCCATTCCACAGATGAGG - Intronic
1035467467 7:159089088-159089110 CTATTCCCATTCCACAGATGAGG - Intronic
1035467475 7:159089126-159089148 CTATTCCCATTCCACAGATGAGG - Intronic
1035467483 7:159089164-159089186 CTATTCCCATTCCACAGATGAGG - Intronic
1035467491 7:159089202-159089224 CTATTCCCATTCCACAGATGAGG - Intronic
1035467499 7:159089240-159089262 CTATTCCCATTCCACAGATGAGG - Intronic
1035467507 7:159089278-159089300 CTATTCCCATTCCACAGATGAGG - Intronic
1035467515 7:159089316-159089338 CTATTCCCATTCCACAGATGAGG - Intronic
1035467523 7:159089354-159089376 CTATTCCCATTCCACAGATGAGG - Intronic
1035467531 7:159089392-159089414 CTATTCCCATTCCACAGATGAGG - Intronic
1035467539 7:159089430-159089452 CTATTCCCATTCCACAGATGAGG - Intronic
1035467547 7:159089468-159089490 CTATTCCCATTCCACAGATGAGG - Intronic
1036690740 8:10943294-10943316 GCAGTCCCATTTGACAGATGAGG + Intronic
1037547271 8:19936684-19936706 ATATTCCCCTTCTACAGATGAGG - Intronic
1038648721 8:29383025-29383047 ATATTGCCATTCCACAGATGGGG - Intergenic
1039561060 8:38512968-38512990 ATAATCCCATTTTACAGATGAGG + Intronic
1041463059 8:58132589-58132611 ATTCTCCCACTTGACAGATGGGG - Intronic
1042339650 8:67665841-67665863 ATAGGCCCATTTTACAGATGAGG - Intronic
1043322038 8:78999437-78999459 AAAGTCTCAATTTACAGATGAGG - Intergenic
1044672767 8:94700029-94700051 ATGGGCCCATTTGACAGATGAGG + Intronic
1045275059 8:100696656-100696678 ATATTCCCATTTTACAGATGAGG - Intronic
1047514286 8:125540060-125540082 AGAGTCCCAAGAGACAGATGGGG - Intergenic
1047672248 8:127160926-127160948 ATTCTTCCAATCCACAGATGAGG + Intergenic
1047754161 8:127905935-127905957 ATAGCCCCATTTTACAGATGGGG - Intergenic
1047793962 8:128235002-128235024 ATTGTCCTATTCTACAGATGAGG + Intergenic
1048089004 8:131218478-131218500 TTACTCCCAATTGACAGAAGAGG + Intergenic
1048291918 8:133187652-133187674 TTATCCCCATTCGACAGATGAGG - Intergenic
1048658202 8:136567024-136567046 ATAATCTCAATAGACAGAGGAGG + Intergenic
1049172067 8:141167580-141167602 ATAGTCCCGTTCTACAGATGCGG - Intronic
1050397235 9:5211895-5211917 ACAGTCCCAGTCAACAGCTGTGG - Intergenic
1050705987 9:8398282-8398304 ATAATCCCATTATACAGATGAGG + Intronic
1051550634 9:18325123-18325145 ATAGTCATCATCAACAGATGAGG - Intergenic
1052841056 9:33291065-33291087 CTACTCCCAACTGACAGATGAGG - Intronic
1056337320 9:85585866-85585888 ATAGTTCAAATCTACAGTTGTGG + Intronic
1056881643 9:90399792-90399814 ATTGTCCCATTTTACAGATGAGG + Intergenic
1057276281 9:93677454-93677476 ATAGGCCCATTTTACAGATGGGG + Intronic
1058964949 9:110028505-110028527 TTAATCCCATTCTACAGATGTGG + Intronic
1058985433 9:110205597-110205619 TTATTCCCAATTGACAGGTGAGG + Intronic
1059437978 9:114287873-114287895 ATTATCCCAATTCACAGATGAGG - Intronic
1060121644 9:120996596-120996618 TTACTCCCATTCGACAGATGAGG + Intronic
1060580501 9:124741832-124741854 GTACTCATAATCGACAGATGAGG - Intronic
1060723513 9:125993370-125993392 ATATTCCCGATTTACAGATGAGG + Intergenic
1061541685 9:131280901-131280923 ATCATCCCATTCTACAGATGAGG + Intergenic
1061871283 9:133522102-133522124 TTAGCTCCATTCGACAGATGGGG + Intronic
1062159671 9:135073456-135073478 TCATTCCCATTCGACAGATGTGG + Intergenic
1062446110 9:136595684-136595706 ATTGTCCCATTGCACAGATGAGG - Intergenic
1189758509 X:44297130-44297152 TTATTCCCACTTGACAGATGAGG + Intronic
1189815425 X:44820130-44820152 ATACTCCCATTTTACAGATGAGG + Intergenic
1190330963 X:49235194-49235216 ATAGTCCCATTTTACAGATGAGG + Intergenic
1190449746 X:50566963-50566985 TTAGACACAATAGACAGATGAGG + Intergenic
1195235333 X:102891264-102891286 ATAATCCCAGTCTACTGATGAGG + Intergenic
1195585482 X:106560505-106560527 ACACTCCCATTTGACAGATGAGG + Intergenic
1195994070 X:110713704-110713726 ATATCCCCATTCTACAGATGCGG - Intronic
1198032670 X:132768552-132768574 CTATTCCCATTTGACAGATGAGG + Intronic
1198788827 X:140319966-140319988 ATATCCCAAATCTACAGATGTGG - Intergenic
1200352162 X:155509291-155509313 CTAGTCCCATTTTACAGATGAGG + Intronic
1201227525 Y:11832790-11832812 CTAGTCCCATTTTACAGATGAGG - Intergenic
1201768946 Y:17599055-17599077 TTAGTCCCATTTTACAGATGAGG + Intergenic
1201832608 Y:18306930-18306952 TTAGTCCCATTTTACAGATGAGG - Intergenic