ID: 950579371

View in Genome Browser
Species Human (GRCh38)
Location 3:13852538-13852560
Sequence ATCGACAGATGTGGAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5267
Summary {0: 1, 1: 4, 2: 74, 3: 761, 4: 4427}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579361_950579371 28 Left 950579361 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 950579371 3:13852538-13852560 ATCGACAGATGTGGAAACTGAGG 0: 1
1: 4
2: 74
3: 761
4: 4427
950579367_950579371 9 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579371 3:13852538-13852560 ATCGACAGATGTGGAAACTGAGG 0: 1
1: 4
2: 74
3: 761
4: 4427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579371 Original CRISPR ATCGACAGATGTGGAAACTG AGG Intronic
Too many off-targets to display for this crispr