ID: 950579372

View in Genome Browser
Species Human (GRCh38)
Location 3:13852548-13852570
Sequence GTGGAAACTGAGGTCGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 1, 2: 6, 3: 71, 4: 598}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579369_950579372 -9 Left 950579369 3:13852534-13852556 CCCAATCGACAGATGTGGAAACT 0: 1
1: 2
2: 19
3: 368
4: 2470
Right 950579372 3:13852548-13852570 GTGGAAACTGAGGTCGCAAGAGG 0: 1
1: 1
2: 6
3: 71
4: 598
950579370_950579372 -10 Left 950579370 3:13852535-13852557 CCAATCGACAGATGTGGAAACTG 0: 1
1: 2
2: 43
3: 503
4: 3204
Right 950579372 3:13852548-13852570 GTGGAAACTGAGGTCGCAAGAGG 0: 1
1: 1
2: 6
3: 71
4: 598
950579367_950579372 19 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579372 3:13852548-13852570 GTGGAAACTGAGGTCGCAAGAGG 0: 1
1: 1
2: 6
3: 71
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579372 Original CRISPR GTGGAAACTGAGGTCGCAAG AGG Intronic
900082561 1:869708-869730 GAGGAAACTGAGGTCGCAGGAGG + Intergenic
900393079 1:2442242-2442264 GGGGAAACTGAGGTCTGGAGGGG + Intronic
900710995 1:4113874-4113896 GAGGAAACTGAGGTCAAAAGTGG - Intergenic
901141685 1:7038020-7038042 GAGGAAACTGAGGCCTCGAGAGG - Intronic
902123701 1:14190394-14190416 GAGGAAACTGAGGCCCAAAGAGG + Intergenic
902362145 1:15947757-15947779 GTGGAAACTGAGACCCAAAGAGG - Intronic
902398454 1:16144829-16144851 GAGGAAACTGAGGTCCGGAGAGG - Intronic
902712623 1:18250666-18250688 GAGGAAACTGAGGTCCAGAGAGG - Intronic
902763825 1:18601688-18601710 GTGGAAACTGAGGCCCAGAGGGG - Intergenic
902781697 1:18709147-18709169 GTGGAAACTGAGGCCCAGAGAGG + Intronic
902785324 1:18729380-18729402 GGGGAAACTGAGGCTGAAAGAGG - Intronic
902924735 1:19688695-19688717 GTGAAAACTGAGGCTGCAGGCGG - Intronic
903131062 1:21279855-21279877 GAGGAAACTGAGGTCCAGAGAGG + Intronic
903137854 1:21321094-21321116 GAGGAAACCGAGGTTCCAAGAGG + Intronic
903174255 1:21571214-21571236 GAGGAAACTGAGGCAGAAAGAGG - Intronic
903184903 1:21623284-21623306 GGGGAAACTGAGGTCCAGAGAGG - Intronic
903281236 1:22251098-22251120 GTGGAGACTGAGGCCGCTGGAGG + Intergenic
903365378 1:22802561-22802583 GTGGAAACTGAGGCTCCGAGAGG + Intronic
903378457 1:22880937-22880959 GTGGAAACTGAGGTCAAGAGAGG - Intronic
903657511 1:24958415-24958437 GACGAAACTGAGGTCTAAAGAGG - Intronic
903810586 1:26033009-26033031 GGGGAAACTGAGATCCAAAGAGG + Intronic
904093013 1:27958247-27958269 GAGGAAACTGAGGCCTAAAGAGG - Intronic
904150423 1:28434246-28434268 GAGGAAACTGAGGTTCAAAGAGG - Intronic
904280167 1:29413416-29413438 GAGGAAACTGAGGCCCAAAGAGG + Intergenic
904625954 1:31802385-31802407 GAGGAAACTGAGGCTCCAAGAGG + Intronic
904825248 1:33270039-33270061 GAGGAAACTGAGGTCCAGAGAGG - Intronic
904868298 1:33600122-33600144 GAAGAAACTGAAGTCTCAAGTGG + Intronic
905444062 1:38013397-38013419 GAGGAAACTGAGGTCCAGAGTGG + Intronic
905631433 1:39521257-39521279 GTGGAGGCTGAGGACCCAAGGGG - Intronic
905666321 1:39764914-39764936 GTGGAGGCTGAGGACCCAAGGGG + Intronic
905674393 1:39815703-39815725 GGGGAAACTGAGGTGGGAATTGG - Intergenic
905798301 1:40827772-40827794 GAGGAAACTGAGGTGCAAAGGGG - Intronic
905821809 1:40998506-40998528 GTGGAAACTGAGGCACAAAGAGG - Intronic
905875039 1:41427097-41427119 GAGGAAACTGAGGCTCCAAGGGG - Intergenic
905954334 1:41979407-41979429 GAGGAAACTGAGGTTCAAAGAGG + Intronic
907341144 1:53737366-53737388 GGGGAAACTGAGGTCCCAAAAGG + Intergenic
907621739 1:55988260-55988282 GGGGAAACTGAGGTCTGGAGAGG + Intergenic
907626056 1:56030765-56030787 GAGGATACTCAGGTAGCAAGTGG - Intergenic
907743401 1:57189150-57189172 GTGGAAAATCAGATTGCAAGGGG - Intronic
907778383 1:57541456-57541478 GTGGAAACTGAGGCTCAAAGAGG + Intronic
907827776 1:58035520-58035542 GAGGAAACTGAGGCCCAAAGAGG + Intronic
907837101 1:58120461-58120483 GTGGAAACTGAGGTTCATAGGGG - Intronic
908742352 1:67341940-67341962 ATGGAAACTGAGGTTTCAAGAGG + Intronic
909611311 1:77554463-77554485 GAGGAAACTGAGGCCCCAAGAGG + Intronic
910654592 1:89606826-89606848 GAGGAAACTGAGGCCCCATGAGG - Intergenic
911310044 1:96281225-96281247 GTGAAGACTGAGGTCGAGAGGGG - Intergenic
912382454 1:109254824-109254846 GGGGAAACTGAAGTCTCAGGAGG - Intronic
912460479 1:109827724-109827746 GAAGAGACTGAGGTCCCAAGTGG + Intergenic
912541494 1:110419746-110419768 GTGGAAACTGAGGTGTATAGAGG + Intergenic
912658649 1:111509274-111509296 GTGGGACCTGAGCTCACAAGAGG - Intronic
912775374 1:112503303-112503325 GGGGAAACTGAGGCCTGAAGTGG + Intronic
913049490 1:115104631-115104653 GGGGAAACTGAGGCCCAAAGAGG + Intergenic
913054113 1:115141705-115141727 TTGGAAATTGAGGCCCCAAGAGG + Intergenic
915254372 1:154614792-154614814 GAGGAAACTGAGGAGGCAAAGGG + Intronic
915267900 1:154731867-154731889 GAGGAAACTGAGGCTGAAAGAGG - Intronic
915579323 1:156803972-156803994 GAGGAAACTGAGGTCTAGAGAGG - Intergenic
916189511 1:162165512-162165534 GAGGAAACTGAGGTACCAAGAGG + Intronic
916413298 1:164568971-164568993 GTGGAAATTGAGATTGCAATGGG + Intronic
916983248 1:170162691-170162713 GTGGAAACTGAGGCTTGAAGAGG + Intronic
917333909 1:173909378-173909400 GAGGAAACTGAGGTCTCAAAAGG + Intronic
917491770 1:175504344-175504366 GTGGACACTGAGGCTTCAAGAGG + Intronic
917788019 1:178480350-178480372 GGGGAAACTGAGGTCGAAATAGG - Intergenic
918188093 1:182145321-182145343 GAGGAAACTGAGGCTCCAAGAGG + Intergenic
918319984 1:183355114-183355136 GTGGAAACTGAGGAAGAAAGGGG - Intronic
920187903 1:204173208-204173230 TTGGAAACTGAGGTCCAAAGAGG - Intergenic
920212446 1:204338048-204338070 GAGGAAACTGAGGTTCCAAGAGG + Intronic
921697420 1:218228106-218228128 GAAGAAACTGAGGTCCAAAGAGG - Intergenic
922064874 1:222126967-222126989 GTGGTGACTGAGGTAGCAAAGGG - Intergenic
922236291 1:223725110-223725132 GAGGAAACTGAGGTGTGAAGAGG - Intronic
922674657 1:227542900-227542922 GAGGAACCTGAGGTCCCAGGAGG - Intergenic
922802497 1:228370791-228370813 GGGGAAACTGAGGCCCCACGGGG + Intronic
1062760025 10:11245-11267 GAAGAACCTGAGGTCGCAGGAGG + Intergenic
1063367035 10:5497051-5497073 GTGGAAACTGAAGCCCCAGGTGG - Intergenic
1063598036 10:7454952-7454974 AAGGAAACTGAGGTAGCGAGAGG - Intergenic
1064133609 10:12731654-12731676 GTGGAATCTAAGGGAGCAAGAGG + Intronic
1064605063 10:17030518-17030540 CTGGAAACTGAGGTAGGTAGAGG + Intronic
1065269790 10:24016730-24016752 GAGGAAACTGAGGCAGAAAGAGG - Intronic
1065451747 10:25866349-25866371 CTGGAAGCTGAGGCAGCAAGAGG - Intergenic
1065452507 10:25873965-25873987 ATGGAAACTGAGGAGCCAAGAGG - Intergenic
1068060888 10:52065945-52065967 TTACAAACTGAGGTCGCAAGTGG + Intronic
1069788551 10:71005024-71005046 GGGGAAACTGAGGCCCCAGGAGG + Intergenic
1069903098 10:71717115-71717137 TGGGAAACTGAGGTCCGAAGAGG + Intronic
1070307522 10:75248444-75248466 AGGGAAACTGAGGTGGCAGGCGG + Intergenic
1070707629 10:78652370-78652392 GAAGAAACTGAGATCGGAAGAGG - Intergenic
1070799345 10:79235967-79235989 GAGGAAACTGAGGTTCAAAGAGG - Intronic
1070841785 10:79492451-79492473 GAGGAAACTGAGGTCTGGAGCGG - Intergenic
1070954879 10:80457121-80457143 GAGGAAACTGTGGTCCCGAGAGG + Intronic
1071434673 10:85635995-85636017 GAGGAAACTGAAGTTCCAAGAGG - Intronic
1072223728 10:93348949-93348971 GAGGAAACTGAGGCCTAAAGAGG - Intronic
1072255929 10:93620331-93620353 GTGGAAAGTGAGGTGCTAAGAGG - Intronic
1072432135 10:95382262-95382284 GAGGAAACTGAGATACCAAGAGG - Intronic
1072475665 10:95757650-95757672 GGAGAAACTGAGGTCAGAAGGGG + Intronic
1072938059 10:99732310-99732332 GTGGAAACTGCAGGCGCACGAGG + Exonic
1073206859 10:101774252-101774274 GTGGAAACTGGGCTTGGAAGGGG - Intronic
1073510920 10:104041871-104041893 GAGGAAACTGAGGCTGAAAGAGG - Intronic
1073811785 10:107160354-107160376 GAGGAAACTGAGGTTCCAAGAGG - Intronic
1074688051 10:115977780-115977802 GTGGAAACTGAGGCCCAGAGAGG - Intergenic
1074800464 10:116995734-116995756 TTGGGAACTGAGGTCCCTAGAGG + Intronic
1075417822 10:122278367-122278389 GAGGAAACTGAGGCCCAAAGAGG - Intronic
1075475250 10:122728619-122728641 GAGGAAAGTGAGGGCTCAAGTGG + Intergenic
1075552267 10:123401178-123401200 GTGGAAACTGAGGCTGGAAATGG - Intergenic
1075567868 10:123517951-123517973 GGGGAAACTGAGGTCCCATGGGG - Intergenic
1075701942 10:124475627-124475649 GAGGAAACTGAGGTTGCAGAGGG + Intronic
1076312340 10:129517418-129517440 GTGGCAACTGAGGACACAGGAGG - Intronic
1076535084 10:131172049-131172071 GAGGAAACTGAGGTCAAAGGAGG - Intronic
1076679621 10:132165017-132165039 GGGGAAACTGAGGCCACAAGAGG - Intronic
1077464335 11:2726464-2726486 GGGGAAACTGAGGCCCCAGGCGG + Intronic
1078263273 11:9732300-9732322 GTGGAAACTGATGCTGCAAGAGG + Intronic
1078659356 11:13274609-13274631 GAGGAAACTGAGGTACAAAGAGG + Intergenic
1078866577 11:15303233-15303255 GTGGAAACTGAGGTTTGTAGAGG + Intergenic
1079291566 11:19192677-19192699 GAAGAAACTGAGTTCCCAAGTGG - Intronic
1079362952 11:19784755-19784777 GAGGAAACTGAGGTACAAAGAGG - Intronic
1079505157 11:21144972-21144994 GAGGAAACTGAGGTGCAAAGAGG - Intronic
1079951647 11:26813024-26813046 GTGGAGACTGAGGTAGCATGAGG + Intergenic
1080607796 11:33878056-33878078 GAGAAAATTGAGGTCTCAAGAGG - Intronic
1080758826 11:35227914-35227936 ATGGAAACTGAGGCCAAAAGAGG - Intronic
1081792416 11:45797642-45797664 GAGGAAACTGAGGTCTGGAGAGG - Intergenic
1081866660 11:46363952-46363974 GGGGAAACTGAGGCTTCAAGAGG - Intronic
1082007185 11:47426020-47426042 GTGGAAACTGAGGCTGTGAGTGG - Intronic
1082124645 11:48417585-48417607 GAAGAAACTGAAGTCTCAAGAGG - Intergenic
1082558309 11:54588827-54588849 GAAGAAACTGAAGTCTCAAGAGG - Intergenic
1083275990 11:61597460-61597482 GTGCAAACTGAGGTCCAGAGAGG - Intergenic
1083328532 11:61885985-61886007 GAGGAAACTGAGGCCCCAAGAGG + Intronic
1083615324 11:64023350-64023372 GAGGAAACTGAGGCCCCAGGAGG - Intronic
1083960299 11:66011631-66011653 GAGGAAACTGAGGCAGCGAGTGG + Intergenic
1084082948 11:66841000-66841022 GAGGAAACTGAGGTACCAATGGG - Intronic
1084118056 11:67053331-67053353 GAGGAAACTGAGGCCCAAAGAGG - Intergenic
1084213715 11:67635541-67635563 GTGGAAACTGAGGCTCCAGGAGG - Intronic
1084225470 11:67712218-67712240 TGGGACACTGAGGTCGCCAGGGG - Intergenic
1084263293 11:67992068-67992090 TGGGACACTGAGGTCGCCAGGGG - Intronic
1084810109 11:71607059-71607081 TGGGACACTGAGGTCGCCAGGGG + Intergenic
1085196524 11:74675499-74675521 GAGGAAACTGAGGCAGAAAGGGG + Intergenic
1085257297 11:75182351-75182373 GAGGAAACTGAGGCCCCAAAAGG - Intronic
1085294419 11:75422972-75422994 GAGGAAACTGAGGTCCAGAGAGG - Intronic
1085481136 11:76823901-76823923 GAGGAAGCTGAGGTTCCAAGAGG - Intergenic
1085618252 11:78018216-78018238 GAGGAAACTGAGGCTGTAAGAGG - Intronic
1086044986 11:82522175-82522197 GTGGAAACTGAGGTTCAGAGAGG + Intergenic
1087641025 11:100753729-100753751 GTGGGAACTGATATAGCAAGCGG - Intronic
1087710830 11:101548507-101548529 GAGGAAAGTGAGGTTGAAAGAGG + Intronic
1087782803 11:102319020-102319042 GTGGAAAGTGTGGTTGAAAGAGG + Intronic
1088317521 11:108522442-108522464 GAGAAAACTGAGGTTTCAAGAGG + Intronic
1089241321 11:117083219-117083241 GAGGAAAATGAGATCGGAAGAGG + Intronic
1089376988 11:118001316-118001338 GAGGAAACTGAGGCTCCAAGAGG - Exonic
1089419460 11:118320205-118320227 GTGGAAAATGAGGGTGCAGGAGG - Intergenic
1089529589 11:119117855-119117877 GAGGAAACTGAGGTCCCCAAAGG - Exonic
1089788687 11:120926508-120926530 GAGGAAACTGAGGTACAAAGAGG + Intronic
1090917776 11:131181172-131181194 GGGGAAACTGAGGTCCACAGAGG - Intergenic
1091312432 11:134584295-134584317 GTGGGATCTGAGGTGTCAAGAGG - Intergenic
1091437279 12:482414-482436 GAGGAAACTGAGGCTGAAAGAGG + Intronic
1092078667 12:5694566-5694588 GGGGAAACTGAGGCCGAGAGGGG - Intronic
1092302074 12:7260944-7260966 GAGGAAACTGAGGTTCAAAGAGG + Intergenic
1092338674 12:7656660-7656682 GGGGAAACTGAGGTCTAGAGAGG - Intronic
1092429694 12:8398363-8398385 GAGGAAACTGAGGTATAAAGAGG + Intergenic
1094139099 12:27162306-27162328 GAGGAAACTGAGGTCCAGAGAGG + Intergenic
1094819605 12:34214282-34214304 CTGAAAACTGAGGCCTCAAGGGG - Intergenic
1096417442 12:51425790-51425812 GGGGAAACTGAGGTTCAAAGAGG - Intronic
1097247203 12:57613103-57613125 GTGGAAACTGAGGCAGACAGTGG + Exonic
1097318249 12:58196374-58196396 GTGGACTCTGAGGTTGCATGGGG + Intergenic
1097941054 12:65306034-65306056 GAGGAAACTGAGGCCCCGAGAGG + Intronic
1098174309 12:67774926-67774948 GAGGAAACTGAGGCACCAAGTGG + Intergenic
1099040234 12:77644288-77644310 GTGGTATCTAAGGTGGCAAGAGG + Intergenic
1100278080 12:93090496-93090518 GTGGAAACTGGGGTTCCAAGAGG - Intergenic
1100472671 12:94907778-94907800 GAGGAAACTGAGGCTCCAAGAGG + Intronic
1100703958 12:97180091-97180113 GGGAAAACTGAGGTTGAAAGAGG + Intergenic
1101120917 12:101579296-101579318 GAGGAAACTGAGGTCCAAGGAGG - Intronic
1101542172 12:105675189-105675211 GTGGAATCTGGGGTCACAAGTGG + Intergenic
1101718319 12:107330573-107330595 GTGGAAACTGAGGCCCAGAGTGG + Intronic
1101807249 12:108075147-108075169 GAGGAAACTGAGGCTCCAAGAGG - Intergenic
1101828062 12:108236216-108236238 CAGGAAACTGAGGTCTCCAGGGG - Intronic
1101841700 12:108332184-108332206 GAGGAAACTGAGGCCTAAAGAGG + Intronic
1101874253 12:108588409-108588431 GTGGAAACTGAGGCCCAGAGAGG - Intergenic
1101882165 12:108633072-108633094 TGGGAAACTGAGGTCGGGAGAGG - Intronic
1102036748 12:109774970-109774992 GGGGAAACTGAGGTCCAGAGAGG - Intergenic
1102218133 12:111176449-111176471 GAGGAAACTGAGGCTTCAAGAGG - Intronic
1102218362 12:111177843-111177865 GAGGAAACTGAGGTCCACAGAGG - Intronic
1102224170 12:111216292-111216314 GGGGAAACTGAGGTCCCAAGAGG - Intronic
1102763388 12:115409177-115409199 AAGGAAACTGAGGTGCCAAGTGG + Intergenic
1102818582 12:115888595-115888617 GAGGAGACTGGGGTCTCAAGAGG - Intergenic
1103315135 12:120047701-120047723 GAGGAAACTGAGGTAGAGAGTGG + Intronic
1103618457 12:122170768-122170790 GGGGAAACTGAGGACCGAAGAGG - Intronic
1103795559 12:123500692-123500714 GTGGAAACTGAGGCATAAAGAGG - Intronic
1105406045 13:20133440-20133462 GGGGAAACTGAGGCCCAAAGAGG + Intergenic
1105492167 13:20899458-20899480 GGGGAAACTGAGGTTCAAAGAGG - Intronic
1105752014 13:23429706-23429728 GAGGAAGCTGAGGCTGCAAGAGG + Intronic
1106567049 13:30895339-30895361 GAGGAAACTGAGGCGGAAAGAGG + Intergenic
1107872855 13:44763052-44763074 GAGGAAACTGAGGTCCAAAGAGG - Intergenic
1109786266 13:67179198-67179220 GTGGAAACTGAGGTTTAGAGAGG + Intronic
1111962348 13:94825469-94825491 GAGGAAACTGAGGTCTAGAGAGG + Intergenic
1112250168 13:97772034-97772056 GTGGATCCTGAGGTGGCAAATGG - Intergenic
1113913565 13:113856386-113856408 GTGGAAACTGAGGCCCTGAGAGG - Intronic
1114031363 14:18583649-18583671 GAGGAACCTGAGGTCGCAGGAGG + Intergenic
1115284218 14:31700557-31700579 GTGGGAACCGAGGTTGCATGTGG + Intronic
1115305373 14:31928504-31928526 GAGGAAACTGAGGCAGAAAGAGG - Intergenic
1115356546 14:32454541-32454563 GTAGAAAATGAGGTCACATGAGG + Intronic
1117021810 14:51578736-51578758 GAGGAAACTGAGGCTGGAAGAGG + Intronic
1117093271 14:52271088-52271110 GAGGAAACTGAGGTCAGAAAGGG - Intronic
1117610305 14:57476202-57476224 GTGGAAACTGAGGTTCCTGGAGG + Intronic
1117845428 14:59906615-59906637 GAGAAAACTGAGGCCACAAGAGG + Intergenic
1117993334 14:61456200-61456222 GAGGAAACTGAGGTAGGGAGAGG + Intronic
1118192159 14:63590614-63590636 GTTGAAAGTGAGTTCACAAGAGG + Intergenic
1119593810 14:75915568-75915590 GAGGAAACTGAGGCTGAAAGAGG - Intronic
1119674618 14:76544511-76544533 GAGGAAACTGAGGTCCAAAGAGG - Intergenic
1120182018 14:81353622-81353644 GTAGAAAATGTGGTCCCAAGCGG - Intronic
1120826221 14:88958039-88958061 GTGGAAACTAAGGTGAAAAGAGG + Intergenic
1121214673 14:92238625-92238647 GTGGAAGCTGAGGTGGGAGGAGG - Intergenic
1121444387 14:93969485-93969507 GGGGAAACTGAGGTCCAAAGAGG - Intronic
1121630185 14:95416281-95416303 GGGGAAACTGAGGACCTAAGAGG - Intronic
1121665953 14:95672518-95672540 GAGGAAACTGAGGTGCAAAGGGG + Intergenic
1122013725 14:98775324-98775346 GTGGAAACAGAGGTTGACAGAGG - Intergenic
1122087370 14:99317082-99317104 GAGGAAACTGAGGCCCCAGGAGG - Intergenic
1122273039 14:100576905-100576927 TTGGAAACTGAGGTTGTGAGGGG - Intronic
1122348298 14:101073697-101073719 GAGGAAACTGAGGCCTAAAGAGG + Intergenic
1122517703 14:102320075-102320097 GGGGAAACTGAGGCCCGAAGGGG + Intronic
1122878428 14:104679279-104679301 GCAGAAACTGAGGCTGCAAGAGG - Intergenic
1122881089 14:104690708-104690730 GTGGAAACTGAGGCCGGAAGAGG - Intronic
1126358447 15:47821037-47821059 GGAGAAACTGAGGTCGAATGTGG + Intergenic
1127651632 15:61014196-61014218 GTGGAAGCTGAGGCCGAGAGAGG - Intronic
1128366522 15:67007504-67007526 GTGGAAACTAAGGCTGCAAGAGG - Intergenic
1128520543 15:68372023-68372045 GCAGAAACTGAGGCCCCAAGAGG + Intronic
1128535225 15:68485385-68485407 GGGGAAACTGAGGCCCAAAGAGG - Intergenic
1128755877 15:70183413-70183435 GAGGAAACTGAGGTCCAGAGAGG + Intergenic
1128770952 15:70282084-70282106 GTGGCAGCTGAGGTTGCAAGTGG - Intergenic
1129344405 15:74907395-74907417 GTGGAAACTGAGGCCTAGAGAGG - Intergenic
1129681438 15:77660587-77660609 AGGGAAACTGAGGGAGCAAGAGG - Intronic
1129683739 15:77672668-77672690 GAGAAAACTGAGGTTCCAAGAGG - Intronic
1129787931 15:78321600-78321622 GGAGAAACTGAGGCCCCAAGAGG - Intergenic
1129921312 15:79321599-79321621 GAGGAAACTGAGGCTCCAAGAGG - Intronic
1130011398 15:80155421-80155443 GAGGAAACTGAGGTCCAGAGAGG + Intronic
1130105310 15:80924372-80924394 TTGGAAACTGAGGTCTAGAGAGG - Intronic
1131854494 15:96579123-96579145 GAGGAAAGTGAGGTACCAAGAGG + Intergenic
1132040820 15:98523436-98523458 GAGGAAACTGAGGCCTCTAGAGG + Intergenic
1132234881 15:100212154-100212176 GGGGAAACTGAGGCACCAAGAGG + Intronic
1133222667 16:4325490-4325512 GGGGAAACTGAGGGCTGAAGGGG - Intronic
1133326346 16:4944640-4944662 GGGGAAACTGAGGTCTAGAGAGG - Intronic
1133828425 16:9299796-9299818 GAGGAAACTGAGGTTTAAAGAGG + Intergenic
1134016306 16:10890901-10890923 ATGGAAACTGAGGCTCCAAGTGG + Intronic
1134036758 16:11037068-11037090 GAGGAAACTGAGGTTCAAAGAGG + Intronic
1134442889 16:14309817-14309839 GGGGAAACTGAGGCAGCGAGCGG - Intergenic
1134887601 16:17807626-17807648 GGGGAAACTGAGGTCTTGAGAGG - Intergenic
1135177279 16:20241559-20241581 AAGGAAACTGAGGTCCCCAGAGG + Intergenic
1135613126 16:23886076-23886098 GTAGAAACTGAGGTCCTAAGAGG + Intronic
1136566326 16:31072957-31072979 GAGGAAACTGAGGTCCAGAGCGG - Intronic
1136735225 16:32461290-32461312 GAGGAACCTGAGGTCACAGGAGG - Intergenic
1137343289 16:47631314-47631336 GAGGAAACTGAGGTGACGAGCGG - Intronic
1137388780 16:48064362-48064384 ATGGAAACTGAAGCCTCAAGAGG - Intergenic
1137704128 16:50522259-50522281 GAGGAAACTGAGGCTCCAAGGGG + Intergenic
1137707833 16:50548015-50548037 GGGGAAACTGAGGTCGGGAGCGG - Intergenic
1137845116 16:51679774-51679796 GAGGAGACTGAGATCCCAAGAGG + Intergenic
1138063865 16:53920259-53920281 GAGGAAACTGAGGTCCAGAGAGG + Intronic
1138154261 16:54687935-54687957 GGGGAAACTGAGGTAGAAAGAGG + Intergenic
1138188662 16:54996683-54996705 GTGGAAACTGAGGTCCGGAGAGG + Intergenic
1138310452 16:56019174-56019196 ATGGAAACTGAGATCTGAAGTGG - Intergenic
1139634054 16:68247341-68247363 GGGGAGACTGAGGCTGCAAGAGG - Intronic
1140918853 16:79518586-79518608 GTGGAAACTGAGGCACCAAGGGG - Intergenic
1141201530 16:81902166-81902188 GTGGAATCTGAAGTCCCTAGCGG + Intronic
1142154371 16:88526527-88526549 GTGGAGACTGAGGCCCAAAGAGG - Intronic
1203017855 16_KI270728v1_random:368303-368325 GAGGAACCTGAGGTCACAGGAGG + Intergenic
1203036190 16_KI270728v1_random:641461-641483 GAGGAACCTGAGGTCACAGGAGG + Intergenic
1142742691 17:1940422-1940444 GGGGAAACTGAGGTAGGAGGGGG - Intronic
1143115963 17:4582053-4582075 GGGGAAACTGAGGCCCTAAGAGG - Intergenic
1144838891 17:18173597-18173619 GAGGAAACTGAGGTCCAGAGAGG + Intronic
1144854183 17:18258837-18258859 GGGGAAACTGAGGCCCTAAGAGG - Exonic
1144855161 17:18263449-18263471 GGGGAAACTGAGGTCCAGAGGGG + Intronic
1144948664 17:18982527-18982549 GAGGAAACTGAGGTCCCAGAGGG - Intronic
1144970829 17:19108493-19108515 GCGGAAACTGAGGCAGCATGTGG - Intergenic
1144991131 17:19234655-19234677 GCGGAAACTGAGGCAGCATGTGG - Intronic
1146260149 17:31415651-31415673 GGGGAAACTGAGGCCGAGAGAGG + Intronic
1146289476 17:31597435-31597457 GTCAAAACTGAGGTCGAGAGTGG + Intergenic
1146299922 17:31679825-31679847 GTGGAAACTGAGGTTTGGAGAGG + Intergenic
1146427007 17:32749941-32749963 ATGGAAACTGAGGTTCAAAGAGG + Intronic
1146510831 17:33446873-33446895 GTGAAAACTGAGGTACTAAGAGG - Intronic
1146511046 17:33448984-33449006 GTGAAAACTGAGGTCCTAAGAGG - Intronic
1146511404 17:33452281-33452303 TTGGAAACTGAGGTTCAAAGAGG - Intronic
1146673540 17:34757926-34757948 GAGGAAACTGAGGCCCCGAGAGG - Intergenic
1146902594 17:36598325-36598347 AAGGAAACTGAGGTCCAAAGAGG - Intronic
1146923493 17:36729034-36729056 GGGGAAACTGAGGTCTGGAGAGG + Intergenic
1147482822 17:40783115-40783137 GTGGAAACTGAGGCCCGAGGAGG - Intergenic
1148218556 17:45847180-45847202 GGGGAAACTGAGGCTCCAAGAGG + Intergenic
1148355797 17:46974817-46974839 GAGGAAACTGAGGCTCCAAGAGG - Intronic
1148564587 17:48625550-48625572 GGGGAGACTGAGGCCGCCAGAGG - Intronic
1148747891 17:49928463-49928485 TGGGAAACTGAGGTCCAAAGAGG + Intergenic
1148909281 17:50931810-50931832 GAGGAAGCTGAGGTTCCAAGAGG - Intergenic
1149095218 17:52831910-52831932 GTGGAAACTGAGGTAGCAAGTGG + Intergenic
1149338569 17:55663148-55663170 GAGGAAACTGAGGCCACATGAGG - Intergenic
1149523075 17:57333130-57333152 GTGGAAACTGAGGAACAAAGAGG - Intronic
1149871712 17:60188218-60188240 GAGGAATCTGAGGTCCCAACAGG + Intronic
1150224729 17:63518014-63518036 GAGGAAACTGAGGCCGAGAGAGG + Intronic
1151458723 17:74242113-74242135 ATGGAAACCAAGGTCTCAAGGGG + Intronic
1151785966 17:76275247-76275269 GAGGAAACTGAGGTCTGGAGAGG + Intronic
1151801539 17:76382521-76382543 CTGCAAACTGAGTTGGCAAGGGG - Intronic
1152033136 17:77855966-77855988 GAGAAAATTGAGGTCCCAAGAGG - Intergenic
1152167733 17:78721680-78721702 GAGGAAACTGAGGCTGGAAGAGG - Intronic
1152246002 17:79184872-79184894 GTGGAAACCAAGGCCCCAAGGGG - Intronic
1152952933 18:11598-11620 GAAGAACCTGAGGTCGCAGGAGG + Intergenic
1153836339 18:8967734-8967756 GTGGAAACTGAGAGCTCAAGTGG + Intergenic
1155517341 18:26636929-26636951 GAGGAAACTGAGGTTCCCAGAGG + Intronic
1155630936 18:27891379-27891401 GTGAAAATGGAGGTGGCAAGGGG - Intergenic
1156443063 18:37211302-37211324 GAGGAAACTGAGGTCCAGAGAGG - Intronic
1156480251 18:37431864-37431886 AAGGAAACTGAGGTCCCAGGAGG + Intronic
1157283722 18:46362877-46362899 ATGGAAACTGAGTTCTAAAGGGG + Intronic
1157621744 18:49020966-49020988 GGGGAAACTGAGGCCTCAGGAGG - Intergenic
1158307041 18:56117284-56117306 GAGGAAACTGAGGTCCAAGGAGG + Intergenic
1158620967 18:59032201-59032223 GTGGAAACTGAGGTTCATAGAGG - Intergenic
1158652890 18:59303445-59303467 GAGGAAAGTGAGGTCTCGAGAGG + Intronic
1158845180 18:61434537-61434559 AGGGAAACTGAGGCCTCAAGAGG + Intronic
1160879509 19:1313094-1313116 GGGGAAACTGAGGCAGCCAGCGG - Intergenic
1161217270 19:3100769-3100791 GGGGAAACTGAGGCCGGGAGAGG - Intronic
1161265941 19:3364651-3364673 GAGGAAACCGAGGTTCCAAGAGG + Intronic
1161294399 19:3512411-3512433 GAAGAAACTGATGTCCCAAGAGG + Intronic
1161485626 19:4534182-4534204 GAAGAAACTGAGGCCCCAAGAGG - Intronic
1161658538 19:5531122-5531144 ATGGAGACTGAGGTCTCAAGGGG - Intergenic
1161700823 19:5794162-5794184 GGGGAAACTGAGGCCCAAAGAGG + Intergenic
1162392614 19:10398519-10398541 GAGGAAACTGAGGTTACAGGAGG - Intronic
1162731923 19:12723460-12723482 GGGGAAACTGAGGCTTCAAGTGG - Intronic
1163429002 19:17255657-17255679 AGGGAAACTGAGGCCCCAAGAGG + Intronic
1163558876 19:18007592-18007614 GTGGAAACTGAGGCTCCAAGAGG + Intronic
1163583919 19:18153869-18153891 GGGGAAACTGAGGCCCCGAGAGG - Intronic
1163584727 19:18157439-18157461 GAGGAAACTGAGGCCTCGAGGGG - Intronic
1163768821 19:19178529-19178551 GAGGAAACTGAGGCCCCGAGAGG - Intronic
1163828047 19:19534856-19534878 GGGGAAACTGAGGCCCCAAGAGG + Intronic
1164120643 19:22262071-22262093 GAGGAAACTGAGGTTGGAGGAGG - Intergenic
1164137386 19:22427416-22427438 GAGGAAACTGAGGTTGGAGGAGG + Intronic
1164179379 19:22806495-22806517 GAGGAAACTGAGGTTGGAGGAGG + Intergenic
1164794191 19:31013440-31013462 GAGGAAACTGAGGCCCCAGGAGG + Intergenic
1165071025 19:33254907-33254929 GGGGAAACTGAGGCCCTAAGAGG + Intergenic
1165114425 19:33520724-33520746 TTGGAAACTGAGGTCAGAATGGG - Intronic
1165475400 19:36027265-36027287 GTGAAAGCTGGGGTGGCAAGAGG + Exonic
1165724649 19:38104329-38104351 GAGGAAACTGAGGTCGAGAGAGG - Intronic
1165764978 19:38344558-38344580 GAGAAAACTGAGGTCCCAAAGGG + Intronic
1165794196 19:38509197-38509219 GAGGAAACTGAGGTCTAGAGAGG - Intronic
1165931632 19:39362861-39362883 GGGGAAACTGAGGTCAGGAGGGG + Intronic
1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG + Intronic
1166220506 19:41361324-41361346 GAGGAAACTGAGGCTCCAAGAGG + Intronic
1166565931 19:43765521-43765543 GTAGAAACCGAGGTTTCAAGAGG - Intergenic
1166704748 19:44902548-44902570 GTGGAAACTGAGGCTTCCAGAGG + Intronic
1166797918 19:45439326-45439348 GAGGAAACTGAGGTCCGGAGAGG - Intronic
1166799334 19:45446484-45446506 GTGCAAACTGAGGCCCAAAGAGG + Intronic
1167169929 19:47824257-47824279 GAGGAAACTGAGGCTGAAAGAGG - Intronic
1167340322 19:48911879-48911901 GTGGAAACTGAGGCACAAAGAGG + Intronic
1168287686 19:55342599-55342621 GAGGAAACTGAGGCCCCGAGAGG + Intronic
926064270 2:9824544-9824566 GGGGACACTGAAGTCACAAGTGG - Intergenic
926344058 2:11929654-11929676 GTAGAAACTGAGGTCCTAAGAGG - Intergenic
926808371 2:16734103-16734125 GAGGAAACTGAGGTCTCCAATGG - Intergenic
926848721 2:17171124-17171146 TAGTAAACTGAGGTCGAAAGAGG + Intergenic
926964927 2:18399444-18399466 GAGGAAACTGAGGCCTAAAGAGG - Intergenic
927645737 2:24875671-24875693 GAGGAAACTGAGGCCGGGAGGGG - Intronic
927871527 2:26627328-26627350 GGGGAAACTGAGGTCCCAAGAGG - Intronic
928210110 2:29317618-29317640 GAGGAAACTGAAGCCCCAAGAGG + Intronic
928309549 2:30198008-30198030 GTGGAAACTGGGGTCTAGAGAGG - Intergenic
931801417 2:65761808-65761830 GAGGAAACTGAGGCCCCAAATGG + Intergenic
932037053 2:68256097-68256119 GTGGACACTGAGGTTGCATAGGG + Intronic
933777465 2:85779645-85779667 GAGGAAACTGAGGTCTGTAGGGG + Intronic
933800317 2:85955190-85955212 AAGGAAACTGAGGTCTTAAGTGG + Intergenic
934310546 2:91858433-91858455 GAGGAACCTGAGGTCACAGGAGG + Intergenic
936676244 2:114718831-114718853 GTGGAAACTGAGGTGCAGAGAGG + Intronic
937127417 2:119483304-119483326 GAGGAAGCTGAGGTTCCAAGAGG + Intronic
937144380 2:119629738-119629760 GTGGCAACTGTGGTTGCAGGAGG + Intronic
937878915 2:126850549-126850571 GTGGAAACTGAGGCCGGGAGGGG - Intergenic
937884122 2:126888593-126888615 GAAGAAACTGAGGTCCCAGGGGG + Intergenic
938496839 2:131802146-131802168 GAGGAACCTGAGGTCGCAGGAGG - Intergenic
939621415 2:144423524-144423546 GTGGGAACTGAGTTCCAAAGAGG + Intronic
939902308 2:147865505-147865527 ATGAATACTGAGGTAGCAAGGGG - Intronic
940625159 2:156166239-156166261 GAGGAAACTGAGGCTGCAAGAGG + Intergenic
941675908 2:168343566-168343588 GGGGAAACTGAGGTGCAAAGGGG - Intergenic
941891970 2:170592061-170592083 GTGGAAAGTGAGGTATGAAGAGG + Intronic
942373113 2:175307747-175307769 GTGGAAACTGAGGCTTCAAGAGG + Intergenic
942420479 2:175801790-175801812 GAGGAAACTGAAGTCCAAAGAGG - Intergenic
942495956 2:176540325-176540347 GAGGAAACTAAGGTCTAAAGAGG + Intergenic
942666044 2:178319030-178319052 GAGGACACTGAGGTTGAAAGAGG + Intronic
942727219 2:179023310-179023332 GAGGAAACTGAGGCAGAAAGAGG + Intronic
944953722 2:204783688-204783710 GAGGAAACTGAAATCCCAAGAGG + Intronic
946046515 2:216825930-216825952 GGGGAAACTGAAGCCCCAAGAGG - Intergenic
946085701 2:217169039-217169061 GTAAAAACTGAGGCCTCAAGAGG + Intergenic
946187415 2:217988825-217988847 GAGGAAACTGAGGTTGGCAGTGG - Intronic
946304488 2:218847966-218847988 GGGGAAACTGAGACAGCAAGTGG + Intergenic
946444790 2:219728857-219728879 GAGGAAAATGAGGTCCAAAGAGG + Intergenic
946726178 2:222663737-222663759 GAAGAAACTGAGGCTGCAAGCGG - Intergenic
947592504 2:231393732-231393754 CAGGAAATTGAGGTCTCAAGGGG + Intergenic
947813786 2:233022624-233022646 GAGGAAACTGAGATCCCAAAAGG + Intergenic
948923859 2:241081654-241081676 CTGGAAACAGAGGTCACGAGAGG - Intronic
1169691947 20:8341874-8341896 GTGTAAACTGAGGTTCAAAGAGG + Intronic
1171306678 20:24112770-24112792 GAGGAAACTGAGGCCCAAAGAGG + Intergenic
1172030648 20:31979896-31979918 GGGGAAACTGAGGTCCAGAGAGG + Intronic
1172062950 20:32199404-32199426 GAGGAAACTGAGGCCCAAAGAGG + Intronic
1172176557 20:32976077-32976099 GTGGAAACTGAGGCTCTAAGAGG - Intergenic
1172252637 20:33490400-33490422 GTGGAAACTGAGGCCCGAAGCGG + Intronic
1172296145 20:33812244-33812266 GGGGAAACTGAGGCCTCAAAGGG - Intronic
1172303575 20:33865997-33866019 GGGGAAACTGAGGTCCAGAGAGG - Intergenic
1172484796 20:35291732-35291754 GAGGAAACTGAGGTCCAGAGAGG - Intronic
1172772106 20:37387924-37387946 GAGGAAACTGAGGCCCAAAGAGG + Intronic
1172874850 20:38157968-38157990 TTGGAAACTGAGGTTGAGAGGGG + Intronic
1172916375 20:38446880-38446902 GGGGAAACTGAGGCCCCGAGGGG + Intergenic
1173648641 20:44649513-44649535 GTGGACACTGAGGTCCCAATAGG + Intronic
1173703979 20:45096701-45096723 GTGGAAACTGAGGCTCCCAGAGG - Intronic
1173792282 20:45835237-45835259 GGGGAAACTGAGGTCAGAAAGGG + Intronic
1173907358 20:46638668-46638690 GAGGAAACTGAGGCCTAAAGAGG - Intronic
1174336660 20:49866726-49866748 GAGTAAACTGAAGTCTCAAGGGG - Intronic
1174385534 20:50186697-50186719 GGGGAAACTGAGGCCCGAAGAGG - Intergenic
1174411185 20:50337645-50337667 GTGGAAACTGAGGCCCAAGGAGG - Intergenic
1174457036 20:50656315-50656337 GAGGAAACAGAGGTTCCAAGTGG - Intronic
1174744471 20:53047947-53047969 GTGGAAACGGAGGTCAGAAGGGG + Intronic
1175156287 20:56973681-56973703 ATGGAAACTGAGGCCACAAAAGG - Intergenic
1175496604 20:59418819-59418841 GAGGAAACTGAAGACTCAAGAGG + Intergenic
1175539658 20:59740686-59740708 GTGGAAACCGAGGCTCCAAGGGG + Intronic
1175750636 20:61494967-61494989 GGGGAAACTGAGGCTGGAAGAGG + Intronic
1175913306 20:62414656-62414678 GAGGAAACTGAGGTCCAGAGAGG + Intronic
1175963059 20:62646741-62646763 GTGGAAACTGAGGCAGAGAGAGG + Intronic
1178300469 21:31448899-31448921 GGGGAAACTGAGGTTGGGAGAGG - Intronic
1178996661 21:37407575-37407597 GTGGAAAGTGAGGTCTAGAGAGG - Intronic
1179608898 21:42536234-42536256 GGGGAAACTGAGGCCCAAAGAGG - Intronic
1179627383 21:42656353-42656375 GGGGAAACTGAGATGGCCAGGGG - Intronic
1180215789 21:46323314-46323336 GGGGAAACTGACGTCGCATGAGG - Exonic
1180455476 22:15510706-15510728 GAGGAACCTGAGGTCGCAGGAGG + Intergenic
1180911844 22:19456135-19456157 GTGGGCACTGAGGTGGCAGGAGG - Intronic
1181068608 22:20319063-20319085 GTGGAAACTGATGGTGCAGGGGG + Intronic
1181853221 22:25764872-25764894 GTGGAGACTGAGGCCAAAAGAGG + Intronic
1182035000 22:27191192-27191214 GAGGAAACTGAGGTCTGGAGAGG - Intergenic
1182054457 22:27338974-27338996 GGGGAAACTGAGGCTCCAAGAGG - Intergenic
1182080681 22:27526728-27526750 GAGGAAACTGAGGTCCAACGAGG + Intergenic
1182115361 22:27753369-27753391 GGGGAAACTGAGGTCCAGAGAGG - Intronic
1182118581 22:27772693-27772715 GAGGAAACTGAGGCCCAAAGGGG - Intronic
1182181148 22:28349621-28349643 GAGGAAACTGAGGTCCAGAGAGG - Intronic
1182753763 22:32661819-32661841 GAGGAAACTGAGGCCTCAAGAGG + Intronic
1182773718 22:32815348-32815370 GGGGAAACTGAGGTCCAAAGAGG + Intronic
1182869858 22:33636487-33636509 GAGGAATCTGAGGTCCCAAGAGG - Intronic
1183156469 22:36079386-36079408 GAGGAAACTGAGGTTTAAAGAGG + Intergenic
1183310839 22:37108737-37108759 GGGGAAACTGAGGTAGAGAGAGG + Intronic
1183314544 22:37129619-37129641 GTGGAAACTGAGGCCCAGAGAGG - Intronic
1183333915 22:37235996-37236018 GAGGAAACTGAGGCCTGAAGAGG + Intronic
1183335374 22:37243321-37243343 GAGGAAACTGAGGCCCCCAGGGG + Intronic
1183452537 22:37905060-37905082 GTGGAAACTGAGGTCCAGGGAGG + Intergenic
1183545199 22:38451734-38451756 GTGGAAACTGAGGCCTGAGGGGG - Intronic
1183545219 22:38451830-38451852 GTGGAAACTGAGGCCTGAGGGGG - Intronic
1183689854 22:39382459-39382481 GAGGAAACTGAGGTCTAGAGAGG + Exonic
1184222554 22:43110344-43110366 GTGGAAACCGAGGCTCCAAGAGG - Intergenic
1184274215 22:43400870-43400892 GTGGAAACTGAGGCCCAGAGAGG - Intergenic
1184564583 22:45284667-45284689 ATGGAAACTGAGGCTCCAAGTGG + Intergenic
1184580283 22:45412713-45412735 GGGGAAACTGAGGTCTGGAGAGG - Intronic
1184602358 22:45551190-45551212 GTGGGAACCGTGGTCTCAAGTGG - Intronic
1184649547 22:45913298-45913320 GGGGAAACTGAGGTAGCACGAGG + Intergenic
1184915632 22:47567081-47567103 GAGGAAACTGAGGCCCAAAGAGG + Intergenic
949542103 3:5040780-5040802 GGGGAAACTGAGGCCCAAAGAGG - Intergenic
949872609 3:8602112-8602134 GTGGAAACTGAGGCTGAGAGAGG - Intergenic
949872952 3:8605155-8605177 GTGGAAACTGAGGTTATAAGAGG - Intergenic
949887305 3:8706494-8706516 GAGAAAACTGAGGTCCGAAGCGG + Intronic
950219895 3:11186471-11186493 GTGAAAACTGAGGCCCCAAGAGG + Intronic
950298035 3:11848797-11848819 GAGGAAACAGAGGTCCTAAGAGG + Intergenic
950425271 3:12921851-12921873 GAGGAAACTGAAGTTGAAAGAGG - Intronic
950442733 3:13019401-13019423 GGGGAATCTGAAGACGCAAGTGG + Intronic
950529150 3:13543148-13543170 GGGGAAACTGAGGTTGAGAGTGG + Intergenic
950579372 3:13852548-13852570 GTGGAAACTGAGGTCGCAAGAGG + Intronic
950642104 3:14354985-14355007 GGGGAAACTGAGGTAGGGAGTGG - Intergenic
950642435 3:14357029-14357051 GGGGAAACTGAGGGTTCAAGAGG + Intergenic
950680900 3:14584467-14584489 GAGGAAACTGAGGCTCCAAGAGG - Intergenic
950830753 3:15873336-15873358 GTGGAAACTGAGGCCTAATGAGG - Intergenic
951195295 3:19816854-19816876 GGGGAAACTGAAGCCCCAAGAGG - Intergenic
951897352 3:27622918-27622940 GTGGAAACTGAGGCTCAAAGAGG + Intergenic
952002718 3:28805342-28805364 GAGGAAACTGAGGTCTAGAGAGG - Intergenic
952332187 3:32374237-32374259 GAGGAAACTGAGGTACAAAGAGG + Intergenic
953373493 3:42409192-42409214 GAGGAAACTGAGGAATCAAGAGG - Intronic
953635824 3:44663303-44663325 GTGGAAACTGAGATCTGAAGAGG - Intergenic
953705472 3:45226653-45226675 GGGGAAACTGAGGTCGAGAGAGG + Intergenic
953750960 3:45607976-45607998 ATGCAAACTGAGGTAGCAGGAGG - Intronic
953906691 3:46872021-46872043 GTGAACACTGAGGTCTCCAGAGG - Intronic
954078654 3:48199491-48199513 GAGGAAACTGAGGTAGAGAGGGG + Intergenic
954747497 3:52795393-52795415 GGGGAAACTGAGGTCCAGAGAGG - Intronic
954837913 3:53486857-53486879 GAGGAAACTGAGGCCCTAAGAGG + Intergenic
954843333 3:53532434-53532456 GTGTAAACAGAGGCCCCAAGAGG + Intronic
954956180 3:54520044-54520066 GTGGAAACTAAAGTGGCCAGTGG + Intronic
956011384 3:64835135-64835157 GAGGAAACTGAGGTTGTCAGAGG + Intergenic
957078731 3:75620010-75620032 TGGGACACTGAGGTCGCCAGGGG - Intergenic
959168022 3:102805147-102805169 GAGGAAACTGAGGGAGAAAGGGG + Intergenic
959401392 3:105906338-105906360 TTGGAAACTGAGGTTTAAAGAGG + Intergenic
960622351 3:119648909-119648931 GTGGAAACTGAGGCTTCAGGAGG - Intronic
961659375 3:128460392-128460414 GAGGAAACTGAGGTCTGGAGAGG - Intergenic
961823179 3:129585671-129585693 GGGGAAACTGAGGCACCAAGTGG - Intronic
962172385 3:133115459-133115481 GAGGAAACTGAGGTTCAAAGAGG + Intronic
962174919 3:133142899-133142921 GAGGAAACTGAGGTGTGAAGAGG + Intronic
965559245 3:170045895-170045917 GGGGAAACTGAGGTACAAAGAGG - Intronic
965622182 3:170652996-170653018 GTGGACACTGAGGTGTTAAGAGG - Intronic
966558657 3:181293353-181293375 GTGGAGACTGAGTTCCAAAGAGG - Intergenic
967535289 3:190594919-190594941 GTGGAAACTGAGGTTCAAAATGG + Intronic
967705890 3:192650260-192650282 GTAGAAACTGAGGTTGAAAAAGG - Intronic
968759529 4:2434921-2434943 GTGGAAACTGAGGCCCCACAAGG + Intronic
968873817 4:3254884-3254906 GGGGAAACTGAGGTCCCAGAAGG - Intronic
969021808 4:4143978-4144000 TGGGACACTGAGGTCGCCAGGGG - Intergenic
969151102 4:5169154-5169176 GAGAAGACTGAGGTCGCGAGGGG - Intronic
969295783 4:6270095-6270117 GGGGAAACTGAGGCCCGAAGAGG - Intronic
969349400 4:6589641-6589663 GTGGAAACTGAGGTTCAGAGAGG + Intronic
969732060 4:8963437-8963459 TGGGACACTGAGGTCGCCAGGGG + Intergenic
969791653 4:9497522-9497544 TGGGACACTGAGGTCGCCAGGGG + Intergenic
970211271 4:13712240-13712262 GATGAAACTGAGGTTGAAAGAGG - Intergenic
970233085 4:13931015-13931037 GTGGAAACTGAGGTCTAGATAGG - Intergenic
970509815 4:16770550-16770572 GGGGAAACTGAGGCCCCAAGCGG + Intronic
970579286 4:17460134-17460156 GTGGAAACTGAGGTTGAGAATGG + Intergenic
971008992 4:22409515-22409537 GTGGAAACTGAGGCAGAGAGAGG - Intronic
973147761 4:46849201-46849223 GGAGAAACTGATGGCGCAAGGGG - Intronic
973241941 4:47966282-47966304 GTGTAAACTGAGGTTCCATGAGG - Intronic
973265101 4:48202743-48202765 GAGGAAACTGAGGAAGAAAGTGG + Intronic
974555482 4:63441578-63441600 CTGGAAGCTGAGGTGGCAGGAGG - Intergenic
976152777 4:82108738-82108760 GGAGAAACTGAGGTACCAAGTGG - Intergenic
976323629 4:83746388-83746410 GTGGAAACTGAAGTATAAAGAGG - Intergenic
978279113 4:106988188-106988210 GAGGAAACTGAGGTGTAAAGAGG + Intronic
978740585 4:112133244-112133266 GTGAAAACTGAGATGGAAAGGGG + Intergenic
982317610 4:154047380-154047402 GTGGGAACCGAGATGGCAAGAGG + Intergenic
982732253 4:158968664-158968686 GAGGAAACTGAGGTATCAACAGG - Intronic
984855963 4:184196514-184196536 GTGGAAAAGGAGTTAGCAAGTGG + Intronic
986065368 5:4229546-4229568 GTGGAAACAGACCTCCCAAGTGG - Intergenic
986200998 5:5578251-5578273 GGGGAAACTGAGGCACCAAGTGG - Intergenic
986697496 5:10371238-10371260 TGGGAAACTGAGGTTGAAAGGGG - Intronic
987116333 5:14729513-14729535 GAGGAAATTGAGGACGCGAGAGG + Intronic
987322815 5:16786030-16786052 GAGGACACTTAGGTGGCAAGCGG - Intronic
988504314 5:31808562-31808584 GTGGAAACTGAGGCTTCAGGAGG + Intronic
988888556 5:35587795-35587817 GGGGAAACTGAAGTCTAAAGAGG + Intergenic
989209829 5:38847376-38847398 GAGGAAACTGAGGCCCAAAGAGG + Intronic
992127035 5:73652802-73652824 GGGGAAACTGAGCTTTCAAGTGG + Intronic
992751471 5:79866741-79866763 GAGGAAACTGAGGTGCAAAGTGG - Intergenic
993011293 5:82486139-82486161 GAGGAAACTGAGGTTTCAAAAGG - Intergenic
997238854 5:132293060-132293082 TAGGAAACTGAGGTTCCAAGGGG + Intronic
997285636 5:132676212-132676234 GTGGAAACTGAGGTGCAGAGAGG - Intronic
997359583 5:133286204-133286226 GAGGAAACTGAGGTCCAGAGAGG - Intronic
997379751 5:133427165-133427187 GTGGAAACTGAGGCCCAGAGAGG - Intronic
997727510 5:136133542-136133564 GTGAAAACTGACATGGCAAGTGG - Intronic
997995235 5:138580205-138580227 GTGGAAACTGAGGCCTAGAGTGG + Intergenic
998136881 5:139678642-139678664 GGGGAAACTGAGGCCCCAAGCGG - Intronic
998416902 5:141952693-141952715 GAGGAAACTGAGGTCTGAGGAGG - Intronic
998431084 5:142070544-142070566 GCAGAAACTGAGGTCCAAAGAGG - Intergenic
998793518 5:145792278-145792300 AGGGAAACTGAGGTCCCAAGTGG - Intronic
999303886 5:150507701-150507723 GGGGAAACTGAGGTCTGGAGGGG + Intronic
999690772 5:154144126-154144148 GAGGAAACTGAGGCCCCAAGGGG - Intronic
1000021402 5:157322211-157322233 GGGGAAACTGAGGTCTAGAGAGG + Intronic
1000915605 5:167077394-167077416 CTGAAAACTGAGGTCCCAATAGG + Intergenic
1001280554 5:170383432-170383454 GTGGAAACTGAGGAGGTGAGAGG + Intronic
1001646478 5:173285641-173285663 GTGGAAACTGAGGCTCAAAGAGG - Intergenic
1001685683 5:173593211-173593233 GAGGAAAGTGAGGTGCCAAGAGG - Intergenic
1001707433 5:173751574-173751596 GAGGAAACTGAGGTCCAGAGAGG - Intergenic
1001857951 5:175029098-175029120 GAGGAAACTGAGGCAGAAAGAGG - Intergenic
1001929035 5:175659571-175659593 GAGGAAACTGAGGTTCCCAGAGG + Intronic
1001934742 5:175696028-175696050 GGGGAAACTGAGGTTCAAAGAGG - Intergenic
1002053542 5:176585506-176585528 GAGGAAACTGAGGCAGAAAGTGG + Intronic
1002309263 5:178304799-178304821 GAGGAAACTGAGGCTCCAAGGGG - Intronic
1005840420 6:29741648-29741670 GAGGAAACTGAGGCACCAAGTGG + Intergenic
1005913796 6:30334082-30334104 GTGGAAAGTGAAGCAGCAAGTGG + Intronic
1005923392 6:30419357-30419379 GAGGAAACTGAGGCATCAAGAGG - Intergenic
1006804482 6:36779220-36779242 GGGGAAACTGAGGCTCCAAGAGG - Intronic
1006810698 6:36818639-36818661 GTGGAAACTGAGGTGCAGAGAGG + Intronic
1006847773 6:37074802-37074824 GGGGAAACTGAGGCCCCAAGAGG + Intergenic
1006960787 6:37927925-37927947 GAGAAAACAGAGGTCCCAAGAGG - Intronic
1007250033 6:40489360-40489382 GGCGAAACTGAGGACCCAAGTGG + Intronic
1007276401 6:40677471-40677493 GTGGAAACTAAGGCTTCAAGAGG + Intergenic
1007281287 6:40714168-40714190 GAGGAAACTGAGGAGGCGAGAGG + Intergenic
1007814016 6:44507476-44507498 GAGGAAACTGAAGTGCCAAGAGG + Intergenic
1008628580 6:53342571-53342593 ATGGAACCTGTGCTCGCAAGAGG + Intronic
1008744979 6:54658733-54658755 GCTGAAGCTGAGGTCACAAGTGG - Intergenic
1009616562 6:66015762-66015784 GTGGAAATTGGGGTGGGAAGTGG - Intergenic
1009979154 6:70705827-70705849 GTGGAAACTGAGGTTTAGAGAGG + Intronic
1010135629 6:72549123-72549145 GAGGAAACTGAGGTGCAAAGTGG + Intergenic
1011651430 6:89509775-89509797 GAGGAAACTGAGGCCCAAAGAGG + Intronic
1013073459 6:106750216-106750238 GAGGAAACTGAGGTCAGAAAGGG + Intergenic
1013737378 6:113243371-113243393 GAGGAAACTGAGGTCTAAAAAGG + Intergenic
1019411156 7:907349-907371 GTGGAAACTGAGGCCAGAGGGGG + Intronic
1019789121 7:2999026-2999048 GAGGAAACCGAGGTCGGGAGAGG - Intronic
1019906381 7:4068323-4068345 GAGGAAACTGAGGCCCCGAGAGG + Intronic
1020131218 7:5559623-5559645 GAGGAAACTGAGGTCTAGAGGGG + Intronic
1020309229 7:6856008-6856030 TGGGACACTGAGGTCGCCAGGGG - Intergenic
1021119467 7:16782020-16782042 GAGGAAACTGAGGCAACAAGAGG - Intronic
1021631664 7:22653120-22653142 CTGGAAACTGAGGTCCAAAAAGG + Intergenic
1022530575 7:31064580-31064602 GTGGAAACTGAGACCCCAGGAGG + Intronic
1022653790 7:32299617-32299639 GAGGAAACTGAGGCTGCATGGGG + Intergenic
1023294386 7:38699751-38699773 GGAGAAACTGAGGTGTCAAGAGG + Intergenic
1023884753 7:44346015-44346037 GTGGAAACTGAGGCTTAAAGAGG + Intergenic
1024248595 7:47489382-47489404 GGGGAAACTGAGGCCCCTAGAGG - Intronic
1026652341 7:72226423-72226445 GAGGAAACTGAGGCCCAAAGAGG - Intronic
1027370351 7:77502807-77502829 GAGGAAACTGAGGCTTCAAGAGG - Intergenic
1027435159 7:78156610-78156632 GAGGAAACTGAGGCCCAAAGAGG + Intronic
1028070354 7:86442762-86442784 GTGGAAAGTGAAGTTCCAAGAGG - Intergenic
1028416040 7:90581532-90581554 GAAGAACCTGAGGTTGCAAGAGG - Intronic
1028631135 7:92935184-92935206 GTGGAAACTGAGGTCCAGAGAGG + Intergenic
1029075393 7:97930028-97930050 GAGGAAACTGAGGTATAAAGAGG + Intergenic
1030004272 7:105100138-105100160 GAGGAAACTGAGGTCCAAAGAGG - Intronic
1030197878 7:106869968-106869990 GAGGAAACTGAGGTACAAAGAGG + Intronic
1030654504 7:112151259-112151281 GAGGAAACTGAAGCCACAAGAGG - Intronic
1032541917 7:132710294-132710316 GAGGAAACTGAGGCTGAAAGAGG + Intronic
1033476611 7:141698993-141699015 GTGGAAACTGAGGACACAGGTGG + Intronic
1034132006 7:148727751-148727773 AAGGAGACTGAGGTGGCAAGGGG + Intronic
1034276764 7:149827245-149827267 GAGGAAACTGAGGTCTGGAGGGG + Intergenic
1034554163 7:151839405-151839427 GGGGAAACTGAGGCCTAAAGAGG - Intronic
1037527595 8:19742000-19742022 GAGGAAACTGAGGCCCAAAGGGG - Intronic
1037748959 8:21667600-21667622 GAGGAAACTGAGGTTGGCAGAGG + Intergenic
1038328546 8:26590310-26590332 GTGGAGACTGAGGGGACAAGGGG - Intronic
1038799352 8:30735124-30735146 GTGGACACTGAGGTTCAAAGAGG + Intronic
1039859416 8:41444070-41444092 GCAGAAACTGAGGTCCCAAAAGG + Intergenic
1039978787 8:42389313-42389335 GTGGAAACTGAGGCAGAGAGAGG + Intergenic
1041318156 8:56585254-56585276 GTGGAAGCTGAGGGCAGAAGTGG + Intergenic
1041641839 8:60211104-60211126 GTGGAAACTGAGGTTTGAAGAGG - Intronic
1041690972 8:60686652-60686674 GTGGAAACCCAGGTCGCACGCGG - Intronic
1042173987 8:66021209-66021231 GAGGAAACTGAGGCCCCACGTGG - Intergenic
1044289690 8:90453243-90453265 GTGGAAACTGAGGCATAAAGAGG + Intergenic
1044782891 8:95761879-95761901 GTGGAAACTGAGATCCAAAGAGG - Intergenic
1044995962 8:97838519-97838541 GAGGAAACTGAGGCACCAAGAGG + Intronic
1045001804 8:97884931-97884953 GAGGAAACTGAGGTCAAGAGAGG + Intronic
1045384294 8:101656394-101656416 GTAGAAACTGAGGTCCAGAGGGG + Intronic
1045712630 8:105003132-105003154 GAGGAAAGTGAGGTCACATGTGG - Intronic
1046793137 8:118343060-118343082 GAGGAAACTGAGGTCTTGAGAGG - Intronic
1047780850 8:128109751-128109773 GAGGAAACTGAGGTCCAGAGAGG + Intergenic
1047879624 8:129179271-129179293 GTTGAAACTGAGGCCCAAAGAGG + Intergenic
1048053808 8:130845430-130845452 GAGGAAACTGAGGTCCAGAGAGG + Intronic
1048306858 8:133290446-133290468 GGGGAAACTGAGGCATCAAGAGG + Intronic
1048310783 8:133321043-133321065 GAGGAAACTGACGTCCCAAGAGG - Intergenic
1048571712 8:135662366-135662388 GTGGAAGCTGAATTTGCAAGTGG - Intergenic
1048729875 8:137426457-137426479 GTGGAAAGTGAAGTCGGAAATGG - Intergenic
1048866452 8:138765127-138765149 GAGGAAACTGAGGCCGGAGGAGG + Intronic
1049246059 8:141563219-141563241 GAGGAAACTGAGGTAGGGAGGGG - Intergenic
1049787343 8:144457316-144457338 GAGGAAACTGAGGCCCCAAGAGG - Intronic
1050162908 9:2736412-2736434 GTGGAAACTGAGGCTTGAAGAGG - Intronic
1050340933 9:4637855-4637877 GTGGAAACTGAGTCTCCAAGAGG - Intronic
1051664752 9:19458148-19458170 GTGGAACCTGAGGTTACAAAGGG + Intergenic
1051742375 9:20264210-20264232 GTGGAAACTGAGGTGCAGAGAGG - Intergenic
1052834500 9:33240490-33240512 GGAGAAACTGAGGCCCCAAGAGG - Intronic
1052853398 9:33391877-33391899 GGGGAAACTGAGGCCGAGAGAGG + Intronic
1053681427 9:40488048-40488070 GGGGAAACTGAGGCCGAGAGAGG + Intergenic
1053931415 9:43116385-43116407 GGGGAAACTGAGGCCGAGAGAGG + Intergenic
1054282286 9:63136886-63136908 GGGGAAACTGAGGCCGAGAGAGG - Intergenic
1054294516 9:63323565-63323587 GGGGAAACTGAGGCCGAGAGAGG + Intergenic
1054392537 9:64628052-64628074 GGGGAAACTGAGGCCGAGAGAGG + Intergenic
1054427185 9:65133261-65133283 GGGGAAACTGAGGCCGAGAGAGG + Intergenic
1054503190 9:65888279-65888301 GGGGAAACTGAGGCCGAGAGAGG - Intronic
1055078622 9:72244246-72244268 GTGTAAACTGGGGTCACAAATGG - Intronic
1055397086 9:75887793-75887815 TTGGAAAATGAGGTAGGAAGTGG - Intergenic
1055499115 9:76885758-76885780 GGGGAAACTGAGGTAGAGAGGGG - Intronic
1055604380 9:77953120-77953142 GGAGAAACAGAGGTCCCAAGAGG + Intronic
1057902525 9:98960677-98960699 GAGGAAACTGAGGTTTCAAAAGG - Intronic
1058106654 9:100979507-100979529 TTGGATACTCACGTCGCAAGGGG + Intergenic
1059050183 9:110916245-110916267 GAGGAAACTGAGGTTCAAAGAGG + Intronic
1059135772 9:111804767-111804789 GAGGAAACTGAGGTTTAAAGAGG + Intergenic
1059389151 9:113988050-113988072 GGGGAAGCTGAGGTCTCAAGAGG - Intronic
1059643401 9:116239370-116239392 ATGGAAACTGAGGTCCAAATAGG - Intronic
1060090830 9:120741550-120741572 GGGGAAACTGAGGTCCAGAGAGG + Intergenic
1060324711 9:122602806-122602828 GATGAAACTGAGGTCCAAAGAGG + Intergenic
1060395119 9:123310897-123310919 GTGGAAACTGAGGCCCCAAGAGG + Intergenic
1060525084 9:124315881-124315903 GAGGAAACTGAGGTCCTGAGAGG - Intronic
1060596588 9:124852490-124852512 TGGGAAACTGAGGTCCGAAGGGG - Intergenic
1060946258 9:127570860-127570882 GTGGAAACTGAGGCCCAGAGAGG + Intronic
1061140086 9:128760834-128760856 GAGGAAACTGAGGTCTGGAGAGG - Intronic
1061453733 9:130682419-130682441 GGGGAAACTGAGGCCCAAAGAGG - Exonic
1061659421 9:132118846-132118868 GAGGAAACTGAGGTCTCTGGAGG - Intergenic
1061750094 9:132771155-132771177 GAGGAAACTGAGGCTCCAAGAGG - Intronic
1061952675 9:133945073-133945095 GAGGAAACTGAGGTTTCAGGAGG + Intronic
1186568568 X:10690687-10690709 GAGGAAACTGAGGCACCAAGAGG - Intronic
1187334339 X:18368894-18368916 GTGGAAACTGTGCTAGCAAATGG - Intergenic
1187929763 X:24283306-24283328 GTAGAAGCTGAGATGGCAAGGGG + Intergenic
1188859934 X:35244338-35244360 GAGGGAACTGAGGTGGCCAGGGG + Intergenic
1188870712 X:35367575-35367597 GAGGAAACTGAGGTTCCAACAGG - Intergenic
1188944680 X:36284715-36284737 GAGGAAACTGAGGCCCAAAGAGG + Intronic
1189279589 X:39811829-39811851 GGGGAAACTGAGGTCTGGAGGGG - Intergenic
1189766134 X:44373974-44373996 GAGGAAACTGAGGCCCAAAGAGG - Intergenic
1190305019 X:49076958-49076980 GAGGAAACTGAGGTTCAAAGTGG + Intronic
1190323589 X:49192983-49193005 GAGGAAACTGAGGTCCCAAGAGG + Intronic
1190325767 X:49206026-49206048 GAGGAAACTGAGGTCCTGAGAGG - Intronic
1190427968 X:50350330-50350352 TGGGAAACTGAGGTCCCAAGAGG + Intronic
1190442986 X:50494453-50494475 GTGGAAACTGAAGTCCAGAGAGG - Intergenic
1190627098 X:52346626-52346648 GAGGAGACTGAGGTCGGTAGAGG - Intergenic
1192022436 X:67408673-67408695 GTGGGAACTGAGGTTGCACATGG + Intergenic
1192453607 X:71259271-71259293 GTGGACACTGAGGTTCAAAGTGG - Intergenic
1192547445 X:72025898-72025920 GAGGAAACTGAGGCATCAAGAGG - Intergenic
1195348897 X:103978508-103978530 GTGAAGAATGAGGTGGCAAGGGG + Intergenic
1195350948 X:103996596-103996618 TTGAAAACTGAGCTCGCAAAAGG - Intergenic
1195358546 X:104060331-104060353 GTGAAGAATGAGGTGGCAAGGGG - Intergenic
1195773860 X:108381566-108381588 GTGGAAGCTGAGGTCCAAGGAGG - Intronic
1196753400 X:119137486-119137508 GTGAGAACTGAGGTCCAAAGAGG - Intronic
1196940085 X:120766879-120766901 GGGAAAACTGAGGTGCCAAGAGG - Intergenic
1197162896 X:123344029-123344051 GTGGAAACTGAGGTTCAGAGAGG + Intronic
1198035605 X:132798316-132798338 CAGGAAACTGAGGTCCCAAGAGG + Intronic
1198193675 X:134337799-134337821 GAGGAAACTGAGATATCAAGAGG + Intergenic
1198541783 X:137647795-137647817 GAGGAAACTGAGGTCAAAGGAGG + Intergenic
1198661941 X:138978717-138978739 GGGGAAACTGAAGTAACAAGAGG + Intronic
1201729962 Y:17192605-17192627 GTGGGAACTGAGGCTGCAGGAGG - Intergenic