ID: 950579374

View in Genome Browser
Species Human (GRCh38)
Location 3:13852550-13852572
Sequence GGAAACTGAGGTCGCAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 1, 2: 10, 3: 96, 4: 515}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579369_950579374 -7 Left 950579369 3:13852534-13852556 CCCAATCGACAGATGTGGAAACT 0: 1
1: 2
2: 19
3: 368
4: 2470
Right 950579374 3:13852550-13852572 GGAAACTGAGGTCGCAAGAGGGG 0: 1
1: 1
2: 10
3: 96
4: 515
950579367_950579374 21 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579374 3:13852550-13852572 GGAAACTGAGGTCGCAAGAGGGG 0: 1
1: 1
2: 10
3: 96
4: 515
950579370_950579374 -8 Left 950579370 3:13852535-13852557 CCAATCGACAGATGTGGAAACTG 0: 1
1: 2
2: 43
3: 503
4: 3204
Right 950579374 3:13852550-13852572 GGAAACTGAGGTCGCAAGAGGGG 0: 1
1: 1
2: 10
3: 96
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579374 Original CRISPR GGAAACTGAGGTCGCAAGAG GGG Intronic
900885579 1:5413111-5413133 GGAAACTGAGTCCTCGAGAGGGG + Intergenic
900978303 1:6031451-6031473 GAAAACTGAGGCTCCAAGAGAGG + Intronic
901190821 1:7408812-7408834 GGAAACTGAGGCCCCAAGTCTGG + Intronic
902292889 1:15446780-15446802 GGAAACAGAGGCCGGGAGAGAGG + Intronic
902293029 1:15447389-15447411 GGAAACTGAGGCCCAGAGAGAGG + Intronic
902388451 1:16089086-16089108 GGGAACTGAGGCCCCGAGAGGGG - Intergenic
902729751 1:18361726-18361748 GTGATCTGAGGTCACAAGAGTGG - Intronic
902822765 1:18953594-18953616 GGAAACTGAGGCCCCAGGAAAGG + Intronic
903177508 1:21589838-21589860 GGAAACTGAGGTCTGAAGGAAGG + Intergenic
903193602 1:21669528-21669550 GGAAACTGAGGACCAGAGAGGGG + Intergenic
903201818 1:21746759-21746781 TGAAACTAAGGTGGCAAGTGCGG + Intronic
903231675 1:21926130-21926152 GGAAACTGAGGCATCAGGAGGGG - Intronic
903335401 1:22621158-22621180 GGAAACTGAGGCTCCAAGATGGG + Intergenic
903359184 1:22766233-22766255 GGAAACTGAGGTTCAGAGAGGGG - Intronic
903378455 1:22880935-22880957 GGAAACTGAGGTCAAGAGAGGGG - Intronic
903516029 1:23911666-23911688 GTAAAATGAGGTGGGAAGAGAGG + Intronic
903549523 1:24148239-24148261 AGAAACTGAGACCTCAAGAGGGG - Intergenic
903658047 1:24960799-24960821 GGAAACTGAGGCCCAGAGAGAGG + Intronic
903761432 1:25701425-25701447 GGAAACTGAGGCTGAAAGGGAGG + Intronic
903957906 1:27037785-27037807 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
904033176 1:27545837-27545859 GGAAACTGAGGCCCAGAGAGGGG + Intronic
904253245 1:29238891-29238913 GGAAACTGAGGCATCAAGAATGG - Intronic
904271646 1:29354141-29354163 GAAAACTGAGGTCCAGAGAGGGG - Intergenic
904280169 1:29413418-29413440 GGAAACTGAGGCCCAAAGAGGGG + Intergenic
904290466 1:29482425-29482447 GGAAACTGAGGTCCAGAAAGTGG + Intergenic
904330992 1:29757704-29757726 GGAAACTGAGGTCCAGAGAAGGG - Intergenic
904346617 1:29876572-29876594 GGAAACTGAGGTCCTAAATGAGG + Intergenic
904474467 1:30756054-30756076 GGAAACTGAGGCCCAGAGAGAGG + Intronic
904585681 1:31579370-31579392 GGAAACTGAGGTTCAAAGAAGGG - Intronic
904616933 1:31755043-31755065 GGAAACTGAGGCCCAGAGAGAGG + Intronic
904675631 1:32197627-32197649 TAAAACTGAGGTCACAAGTGTGG - Exonic
904754614 1:32761217-32761239 AGAAACTGAGGTCCAGAGAGTGG - Intronic
904868300 1:33600124-33600146 AGAAACTGAAGTCTCAAGTGGGG + Intronic
905485566 1:38293343-38293365 GTAAAATGAGGTCGTATGAGTGG - Intergenic
905853418 1:41290945-41290967 GGGAAGTGAGGGCGAAAGAGGGG - Intergenic
905853423 1:41290965-41290987 GGAGAGTGAGGGCGAAAGAGGGG - Intergenic
906501199 1:46342724-46342746 GGAAACTGGAGTGGGAAGAGGGG - Intronic
906516833 1:46444059-46444081 AGAAACAGAGGTCCCAAGAGAGG - Intergenic
906545228 1:46615612-46615634 GGAAACTGAGGCCTAAAAAGAGG + Intronic
907189248 1:52634520-52634542 GGAAACTGAGGTCCTATGGGTGG - Intronic
907246130 1:53110218-53110240 GGAAACTGAGGCCTGGAGAGGGG + Intronic
907268754 1:53278100-53278122 GGAAACTGAGGCCCAGAGAGAGG + Intronic
907286373 1:53383069-53383091 GGGAACTGAGGCCTCAAGAGGGG + Intergenic
907317658 1:53582777-53582799 GGAAACTGAGGCCCATAGAGAGG - Intronic
907482921 1:54757159-54757181 GGAAACTGAGGCCCCAGCAGGGG + Exonic
907490424 1:54805757-54805779 GGAAACTGAGGCCCACAGAGAGG - Intergenic
907756091 1:57312262-57312284 GGAAAGTGAAGTCCAAAGAGGGG + Intronic
907756109 1:57312448-57312470 GGAAAGTGAAGTCCAAAGAGGGG + Intronic
907823699 1:57995080-57995102 GGAAACTGAGGCCCAGAGAGGGG - Intronic
908563048 1:65326243-65326265 GGAAACTGAGGCCTAGAGAGAGG + Intronic
910108254 1:83654402-83654424 GGAAACTGAGGCCAGAAGAATGG - Intergenic
912658647 1:111509272-111509294 GGGACCTGAGCTCACAAGAGGGG - Intronic
912944991 1:114077494-114077516 AGGAACTGAGGTCTTAAGAGAGG + Intergenic
913339044 1:117738920-117738942 GGTAAATGAGGTCATAAGAGTGG - Intergenic
915579321 1:156803970-156803992 GGAAACTGAGGTCTAGAGAGGGG - Intergenic
917468825 1:175308343-175308365 GGGAACAGAGGACGCAGGAGTGG - Intergenic
918195036 1:182213327-182213349 GGAAATTGAGGATGCCAGAGAGG + Intergenic
919144374 1:193615064-193615086 GGAAACTGAGATTCAAAGAGGGG - Intergenic
919855746 1:201704903-201704925 GGAAACTGAGGCCCAAAGAGGGG + Intronic
920514646 1:206575751-206575773 GGAAACTGAGGCCCTGAGAGGGG + Intronic
920555645 1:206902354-206902376 GGCAACTGAAGTCAGAAGAGAGG + Intronic
920689310 1:208133849-208133871 GGAAACTGATGCCTCCAGAGAGG - Intronic
921931921 1:220761898-220761920 CTTAACTGAGGTCCCAAGAGAGG - Intronic
922336587 1:224623321-224623343 GGAAACAGAGGACGCAGCAGTGG - Intronic
922336883 1:224625081-224625103 GGACACTGAGGCCACAAGTGAGG - Intronic
924642436 1:245847052-245847074 GGGAACTGAAGTAGCAAGGGTGG - Intronic
924729102 1:246696007-246696029 AGAAACTGAGGCCTCCAGAGAGG + Intergenic
1063884150 10:10561004-10561026 GGAAACTTAGGGGGCAAGAGTGG + Intergenic
1065452505 10:25873963-25873985 GGAAACTGAGGAGCCAAGAGGGG - Intergenic
1066549213 10:36536943-36536965 GGAAGCTGAGGTGGGAAGATTGG - Intergenic
1068712689 10:60151482-60151504 GGAGAGTTAGGTGGCAAGAGAGG - Intronic
1069694878 10:70379373-70379395 GAAAGCTGAGGACCCAAGAGGGG + Intronic
1069788553 10:71005026-71005048 GGAAACTGAGGCCCCAGGAGGGG + Intergenic
1069800973 10:71081235-71081257 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1069903100 10:71717117-71717139 GGAAACTGAGGTCCGAAGAGGGG + Intronic
1070343871 10:75523052-75523074 GGAAACTGAAGTTCAAAGAGGGG - Intronic
1070666935 10:78351574-78351596 GGACACAGAGATCACAAGAGAGG + Intergenic
1071732544 10:88262998-88263020 GAAAACTGAGGCCCTAAGAGAGG - Intergenic
1072223726 10:93348947-93348969 GGAAACTGAGGCCTAAAGAGGGG - Intronic
1072256070 10:93621438-93621460 GGAAACTGAGGTCCAGAGAGTGG - Intronic
1073043349 10:100621935-100621957 GGAAACTGAGCCGGCAACAGAGG + Intergenic
1073249581 10:102113661-102113683 GGAAACTGAGGAGGCAGGGGTGG - Intronic
1073747808 10:106490110-106490132 GGAAGCTGAGGTGGCAGGGGTGG - Intergenic
1073915273 10:108396269-108396291 GGAAACAGAGTTCTCTAGAGCGG + Intergenic
1074126803 10:110535072-110535094 GAAATCTGAGGTGTCAAGAGGGG - Intergenic
1074296453 10:112193576-112193598 GGAAACTGAGGCACCAGGAGAGG + Intronic
1076223473 10:128754298-128754320 GTAAAATGAGGTCACTAGAGTGG + Intergenic
1076312338 10:129517416-129517438 GGCAACTGAGGACACAGGAGGGG - Intronic
1078062493 11:8056980-8057002 GGAAACTGAGGCCCACAGAGTGG + Intronic
1078849866 11:15153811-15153833 GGAAACTGAGGCCCGGAGAGGGG + Intronic
1079498305 11:21071666-21071688 GGAAACACAGCTTGCAAGAGAGG - Intronic
1079891790 11:26064927-26064949 GAAAACTGAGGTGAAAAGAGGGG - Intergenic
1080877781 11:36292411-36292433 TGAAATTGAGGTTCCAAGAGGGG - Intergenic
1080947367 11:36989162-36989184 GGAAACTCAGGTGTCAAGACAGG - Intergenic
1081494620 11:43596214-43596236 GAAAACTGAGGCAGCATGAGAGG + Intronic
1081541355 11:44036855-44036877 GGAAACTGTGGTCCAGAGAGAGG - Intergenic
1083275988 11:61597458-61597480 GCAAACTGAGGTCCAGAGAGGGG - Intergenic
1083341252 11:61959783-61959805 GGAAACTGAGGTCCAGAGAGAGG + Intronic
1083698976 11:64461884-64461906 GGGAACTGAGATTTCAAGAGAGG - Intergenic
1084198639 11:67540963-67540985 GGAAACTGAGGCCCAGAGAGAGG + Intergenic
1084389902 11:68868445-68868467 GGAACTGGAGGTGGCAAGAGTGG + Intergenic
1084758822 11:71255448-71255470 GGAAGCTGAGGTCCAAGGAGGGG + Intergenic
1084937934 11:72596943-72596965 GGAAACTGAGGTCTAGAAAGGGG + Intronic
1085057039 11:73411081-73411103 GGAAACTGAGACCCAAAGAGGGG - Intronic
1085101187 11:73801391-73801413 GGAAACTGGGGCCCCAGGAGAGG - Intronic
1085173730 11:74468995-74469017 GAAAACTGAGGTTGCAGGATGGG - Intergenic
1085257295 11:75182349-75182371 GGAAACTGAGGCCCCAAAAGGGG - Intronic
1085301262 11:75460085-75460107 GGAAACTGAGGCCTGAAGAGGGG + Intronic
1085738839 11:79062695-79062717 GGAAACTGAGGTCCCAAGAAAGG + Intronic
1085802433 11:79602853-79602875 GGAAACTGAGGCCCAGAGAGAGG + Intergenic
1085933344 11:81113191-81113213 GGAAAATGTGGGCTCAAGAGAGG - Intergenic
1089406140 11:118199259-118199281 GGAAACTGAGGTCCCGACAGGGG + Intronic
1089487861 11:118861030-118861052 GGAAACTGAAGCCCCAAGAGTGG + Intergenic
1089623026 11:119733362-119733384 GAAAACTGAGGTCCAGAGAGGGG - Intergenic
1090319158 11:125827036-125827058 GGAAACAGAGGTGGGCAGAGTGG - Intergenic
1090907975 11:131094220-131094242 GGGAACTGAGGAAGGAAGAGAGG - Intergenic
1091135250 11:133182655-133182677 GGAAACTGAGAGAGCCAGAGCGG + Intronic
1091681622 12:2531623-2531645 GGCAGCAGAGGTCACAAGAGAGG + Intronic
1091870321 12:3884491-3884513 GGAAACTGAGGCCCCAAAATGGG - Intergenic
1092215195 12:6677132-6677154 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1092215614 12:6679833-6679855 AGAAACTGAGCTCACGAGAGGGG + Intronic
1092225512 12:6745794-6745816 GGGAACTGATGTTGCGAGAGAGG + Intergenic
1096163662 12:49402331-49402353 GGAAAATGAGGATGTAAGAGGGG + Intronic
1096515689 12:52153948-52153970 AGAAACTGAGGTCCAGAGAGAGG - Intergenic
1096673955 12:53216497-53216519 AGAAACTGAGGCCACGAGAGGGG + Intronic
1097058973 12:56268091-56268113 AGAAATTAAGGTCGGAAGAGTGG - Intronic
1098606721 12:72399324-72399346 TGAAATTGAGTTTGCAAGAGAGG + Intronic
1101807247 12:108075145-108075167 GGAAACTGAGGCTCCAAGAGGGG - Intergenic
1101882566 12:108635330-108635352 GGAAACTGAAGCCACAAGAGGGG + Intergenic
1101897950 12:108769938-108769960 GGAAACTGAGGCCCAGAGAGAGG - Intergenic
1102021603 12:109687224-109687246 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1102036791 12:109775202-109775224 GGAAACTGAGGTTCAGAGAGGGG + Intergenic
1102056057 12:109897447-109897469 GGAAACTGAGGCCCAGAGAGTGG + Intergenic
1102195948 12:111025265-111025287 CGAATCTGTGGCCGCAAGAGGGG + Intergenic
1102224168 12:111216290-111216312 GGAAACTGAGGTCCCAAGAGGGG - Intronic
1102274350 12:111568929-111568951 GTCAAATGAGGTGGCAAGAGGGG + Intronic
1102456360 12:113073255-113073277 GGAAACTGAGGCCCTGAGAGGGG + Intronic
1102498829 12:113337413-113337435 GGAAACTGAGGCTCAAAGAGAGG - Intronic
1102544280 12:113643469-113643491 GGAAACTGAGAGTCCAAGAGGGG - Intergenic
1102622236 12:114205343-114205365 AGAAACTGAGGCCCCAACAGTGG - Intergenic
1102653128 12:114457439-114457461 GGAAACTGAGGCCAAGAGAGAGG - Intergenic
1102818580 12:115888593-115888615 GGAGACTGGGGTCTCAAGAGGGG - Intergenic
1103036221 12:117658934-117658956 GAAAACTGACGTACCAAGAGAGG - Intronic
1103224842 12:119277930-119277952 GGAAACTGAGACATCAAGAGGGG + Intergenic
1103379677 12:120484200-120484222 GGAAACTGATGATGCAGGAGAGG + Intronic
1103394755 12:120599065-120599087 GGAAACTGAGGCCCAGAGAGAGG + Intergenic
1103443874 12:120981407-120981429 GGAAACTGAGGCAGAAGGAGAGG - Intronic
1103944158 12:124517134-124517156 GGAAACTGAGGTCTGCAAAGGGG + Intronic
1103961201 12:124610180-124610202 GGAAACTGAGGTTTGTAGAGAGG - Intergenic
1105488685 13:20864543-20864565 GGAAACTGAGGTCACATGGCTGG + Intronic
1105683381 13:22752384-22752406 GGAAAAGAAGGTGGCAAGAGGGG - Intergenic
1106512105 13:30421441-30421463 GGAAAATGAGGGCGCAAAAGGGG - Intergenic
1106700751 13:32225856-32225878 GGAAATTGCTGTTGCAAGAGAGG - Exonic
1110059270 13:71020961-71020983 GCAAGCTGAGGTCCCAAAAGAGG - Intergenic
1111294586 13:86262603-86262625 TTAAACTGAAGTGGCAAGAGAGG + Intergenic
1112049482 13:95631634-95631656 GCAAAATGAAGACGCAAGAGAGG - Intronic
1112740779 13:102471092-102471114 GGAAAGTGAGGTGGCGAGGGTGG - Intergenic
1112781342 13:102904238-102904260 GGACACTGGGGTGGGAAGAGAGG + Intergenic
1113131054 13:107037324-107037346 GGAACCAGAGGTGGCAAGAAGGG - Intergenic
1113594113 13:111519344-111519366 GGAGGCTGAGGTGGCAAGGGTGG + Intergenic
1114569109 14:23653521-23653543 GGAAACTGAGGGCCATAGAGGGG + Intergenic
1119180246 14:72600457-72600479 GGAAACTGAGGCCTAGAGAGGGG - Intergenic
1119545069 14:75465687-75465709 GGAAACTGAGGCCCAGAGAGAGG + Intronic
1121252812 14:92512706-92512728 GGAAACTGAGGCCTAGAGAGTGG - Intergenic
1121285477 14:92732126-92732148 GGAAACTGAGGCCTAGAGAGTGG - Intronic
1121381715 14:93476300-93476322 GGAAACTGAGGTCCGGAGAGAGG - Intronic
1121443968 14:93967093-93967115 AAAAACTGAGGACACAAGAGAGG - Intronic
1121444385 14:93969483-93969505 GGAAACTGAGGTCCAAAGAGGGG - Intronic
1121571741 14:94951522-94951544 GGAAACTGAGGCCTACAGAGGGG - Intergenic
1122024455 14:98865077-98865099 GGAAACTGAGGCTTGAAGAGAGG - Intergenic
1122357136 14:101130038-101130060 GCAAACTGAGGCCCCAGGAGGGG + Intergenic
1122555747 14:102578986-102579008 GGAGACTGAGGTCCCGAGAGAGG - Intergenic
1122878426 14:104679277-104679299 AGAAACTGAGGCTGCAAGAGGGG - Intergenic
1124107607 15:26754821-26754843 GGAAACTGAGGTCTCAGGCTTGG - Intronic
1124166123 15:27327493-27327515 GGAAACTGAGCTTCCAAGAAGGG + Intronic
1128114484 15:65096693-65096715 GGAAACTGAGGCTAAAAGAGGGG + Intronic
1128248777 15:66150751-66150773 GGAAATTGAGGTCTAAAGAGAGG + Intronic
1128314501 15:66652181-66652203 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1128472759 15:67968738-67968760 GAAAACTGAGGTCCCCAGACAGG + Intergenic
1128520545 15:68372025-68372047 AGAAACTGAGGCCCCAAGAGGGG + Intronic
1128535223 15:68485383-68485405 GGAAACTGAGGCCCAAAGAGGGG - Intergenic
1128542068 15:68543244-68543266 GCAAACTGAGGGCTCCAGAGGGG - Intergenic
1128543412 15:68552085-68552107 GGAAACTGAGGACCAAGGAGGGG + Intergenic
1128631648 15:69274141-69274163 GTAAAATGAGGTCACATGAGTGG - Intergenic
1128720913 15:69947702-69947724 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1129292561 15:74579445-74579467 GGAAACTGTGGCCACCAGAGTGG - Intronic
1129517452 15:76165337-76165359 AGAAACTGAGGTGCGAAGAGTGG - Intronic
1129653049 15:77505096-77505118 GGAAACCAAGGCCTCAAGAGAGG - Intergenic
1129659069 15:77543069-77543091 GGAAACTGAGGCCCAGAGAGAGG - Intergenic
1130705684 15:86230980-86231002 GGAAACTGAGGACCAGAGAGAGG + Intronic
1130993983 15:88894197-88894219 GGAAACTGAGGCCAAGAGAGTGG + Intronic
1131122311 15:89830250-89830272 GGAAACTGAGTGGGCAGGAGAGG - Intergenic
1132476703 16:142862-142884 GGAAACTGAGGTCCAAAGCAAGG - Intergenic
1133837660 16:9381079-9381101 GGCAACAGAGGAAGCAAGAGAGG + Intergenic
1134013939 16:10875447-10875469 GGAAACTGAGGACCACAGAGAGG + Intergenic
1134062331 16:11206596-11206618 GGAAACTGAGGACACCAGACTGG + Intergenic
1134065612 16:11226095-11226117 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1134271611 16:12737756-12737778 GGGCTCTGAGGTCGCCAGAGTGG + Intronic
1134297457 16:12959683-12959705 GGAAACTGAGGCCCCTAGGGTGG + Intronic
1134442887 16:14309815-14309837 GGAAACTGAGGCAGCGAGCGGGG - Intergenic
1134782847 16:16914474-16914496 GGAAAATAAGGTGGAAAGAGAGG - Intergenic
1135124159 16:19793137-19793159 TTAAACTGAAGTGGCAAGAGAGG - Intronic
1136464921 16:30436098-30436120 GGAAACTGAGGAAGCAAAGGTGG - Intergenic
1137367943 16:47876993-47877015 GAAAACTGAGGTCCAAAGAGAGG - Intergenic
1137587191 16:49670639-49670661 GGAAACTGAGTCCCCAACAGAGG - Intronic
1137761812 16:50947175-50947197 GGAAATTGAGGCCTCAAGAGAGG + Intergenic
1138008130 16:53355986-53356008 GGAAACTGAGGTCCAGAGTGGGG - Intergenic
1138224896 16:55284686-55284708 GGAAACTGAGGCTGGAAGAGAGG + Intergenic
1138237905 16:55401052-55401074 GGAAACTGAGGTCCAGAGAGAGG + Intronic
1138431961 16:56974832-56974854 GGAAACTGAGGCCCACAGAGGGG + Intronic
1138501123 16:57445647-57445669 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1139434577 16:66928633-66928655 GGAAGCTGAGGGCTCCAGAGAGG - Intergenic
1140300756 16:73755232-73755254 GGAAACTGGGTTGGCAAAAGGGG - Intergenic
1142363237 16:89637012-89637034 GGACACTGAGGTCCCACGTGAGG - Intronic
1143020451 17:3914807-3914829 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1143114425 17:4574626-4574648 GGAAACTGAGGCCCAAGGAGTGG + Intergenic
1143115961 17:4582051-4582073 GGAAACTGAGGCCCTAAGAGGGG - Intergenic
1143125817 17:4640398-4640420 GGAAACTGCGGTCGCCGGAGCGG - Intronic
1143402659 17:6656424-6656446 GGAAACTGCGGTCGCCGGAGCGG + Intergenic
1143790900 17:9294795-9294817 TGAAAATGAGGTCATAAGAGTGG + Intronic
1143954092 17:10655374-10655396 GGAAAAGGCGGTCCCAAGAGTGG - Intronic
1144284401 17:13759046-13759068 GGAAACTGAGGCCCCAAAAGTGG + Intergenic
1144441528 17:15286954-15286976 GGAAACTGAGGTCATATGGGTGG - Intergenic
1144718341 17:17450217-17450239 GGAAACTGAGGTTCAGAGAGAGG + Intergenic
1144970751 17:19107957-19107979 GGAAACTGAGGTCCAGGGAGGGG + Intergenic
1144991053 17:19234119-19234141 GGAAACTGAGGTCCAGGGAGGGG + Intronic
1145904931 17:28511081-28511103 GGAAACCGAGGTCCCACCAGTGG - Intronic
1146260151 17:31415653-31415675 GGAAACTGAGGCCGAGAGAGGGG + Intronic
1146671540 17:34741312-34741334 GGAAACTTGGGTCGAGAGAGAGG + Intergenic
1146712685 17:35056255-35056277 GGAAAATAAGGGAGCAAGAGTGG - Intronic
1146923495 17:36729036-36729058 GGAAACTGAGGTCTGGAGAGGGG + Intergenic
1146925786 17:36743878-36743900 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1147410927 17:40251765-40251787 GGACACTGAAGTCCCAGGAGTGG - Intronic
1147936447 17:44014133-44014155 GGAAACTGAGGTCTAGAGATGGG - Intronic
1148238056 17:45982629-45982651 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1148911492 17:50945256-50945278 GGAGGCTGGGGTCGCAAGATTGG + Intergenic
1149391691 17:56197904-56197926 GGAGGCTGAGGTGGGAAGAGTGG + Intronic
1150328261 17:64274030-64274052 GGAAACTGAGGGTCCAGGAGCGG + Intergenic
1150463870 17:65375315-65375337 GAAACCAGAGGTTGCAAGAGGGG + Intergenic
1150665433 17:67131673-67131695 GGAAACTGAGATATAAAGAGAGG - Intronic
1151296892 17:73192762-73192784 GGGAAGTGAGGTCGCCAGAGAGG - Intronic
1151340329 17:73466870-73466892 GAAAACTGAGGTCCAGAGAGGGG + Intronic
1151367219 17:73625447-73625469 GGAAACTGAGGCCTGGAGAGGGG + Intronic
1151785968 17:76275249-76275271 GGAAACTGAGGTCTGGAGAGGGG + Intronic
1151888812 17:76940173-76940195 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1152033134 17:77855964-77855986 GAAAATTGAGGTCCCAAGAGGGG - Intergenic
1152147997 17:78580773-78580795 GGAAGCTGACGTCTCCAGAGGGG - Intergenic
1152167957 17:78723226-78723248 GGACACTGGGGCCGCAGGAGAGG - Intronic
1203167867 17_GL000205v2_random:114547-114569 GGAAAATGAGGCCCCAAAAGAGG - Intergenic
1157191115 18:45582624-45582646 GGAAACTGAGGTCCAGTGAGGGG + Intronic
1157508750 18:48252449-48252471 GGAAACTGAGGCCCAGAGAGAGG - Intronic
1157825303 18:50806821-50806843 GGAAACTGAGGTTCCAGAAGCGG - Exonic
1159468171 18:68812946-68812968 GGAAGCTGAGGTCAGAAAAGAGG + Intronic
1160100804 18:75917561-75917583 GGAAACTGAGGCTGCCTGAGGGG - Intergenic
1160775875 19:855485-855507 GGAAACTGAGGCCCGGAGAGGGG + Intronic
1160798578 19:956793-956815 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1160815207 19:1032256-1032278 GGAAACTGAGGCCCAGAGAGAGG + Intronic
1160833525 19:1114015-1114037 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1160909056 19:1466468-1466490 AGAAACTGGCGGCGCAAGAGGGG + Exonic
1161200284 19:3010810-3010832 GGAAACTGAGGCCTGGAGAGTGG - Intronic
1161204784 19:3035379-3035401 GGAAACTGAGGCGCAAAGAGGGG - Intronic
1161265943 19:3364653-3364675 GGAAACCGAGGTTCCAAGAGGGG + Intronic
1161271641 19:3392851-3392873 GGAAACTGAGGCCCGGAGAGGGG + Intronic
1161272799 19:3399197-3399219 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1161346274 19:3770317-3770339 GGAGACTGAGGCCCCAGGAGGGG + Exonic
1161649147 19:5473640-5473662 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1161704486 19:5812748-5812770 AGAAACTGAGGCCCCATGAGGGG - Intergenic
1162006532 19:7783972-7783994 GGTAACTGAGAGCGGAAGAGAGG - Intergenic
1162308305 19:9889138-9889160 GGAAACTGAGGCCTGGAGAGGGG + Intronic
1162370017 19:10272946-10272968 GGAAATTGAGGCCCAAAGAGGGG + Intronic
1162531524 19:11238808-11238830 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1163152394 19:15423033-15423055 GGAGACAGAGGTGGCACGAGAGG + Exonic
1163460735 19:17436015-17436037 GGAAACGGAGGCCCCAAGAGAGG - Exonic
1163548312 19:17951923-17951945 GGAAACTGAGGCCCGGAGAGCGG - Intronic
1163577408 19:18118711-18118733 GGAAACTGAGACTCCAAGAGCGG - Intronic
1163583917 19:18153867-18153889 GGAAACTGAGGCCCCGAGAGGGG - Intronic
1163638775 19:18450183-18450205 GGGAACTGAGGCCGCAGAAGGGG - Intronic
1163889307 19:19996866-19996888 GGAAACTGAGGCCCCAAAAGAGG + Intergenic
1164051031 19:21586203-21586225 GGAAACTGAGGCCCAAAGAGGGG - Intergenic
1164589504 19:29498635-29498657 AGAAACTGAGGCCCAAAGAGGGG + Intergenic
1165007594 19:32819211-32819233 GGACACTGAGGTGGGAAGATTGG + Intronic
1165114423 19:33520722-33520744 GGAAACTGAGGTCAGAATGGGGG - Intronic
1165308902 19:35018988-35019010 GGAAACTGAGGCTGCAGCAGTGG + Intronic
1165811688 19:38615644-38615666 GGAAACTGAGGCCCAAAGAGAGG - Intronic
1166051443 19:40263101-40263123 GGACACTGAAGGCCCAAGAGGGG + Intronic
1166087028 19:40483133-40483155 GAAAACTGGGGTCCCGAGAGGGG + Intronic
1166220508 19:41361326-41361348 GGAAACTGAGGCTCCAAGAGGGG + Intronic
1166337585 19:42117556-42117578 GGAAACTGAGGCCAGAGGAGTGG - Intronic
1166343459 19:42151626-42151648 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1166354631 19:42219635-42219657 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1166670085 19:44704350-44704372 GGAAACTGAGGCCAGGAGAGGGG + Intronic
1166717275 19:44976618-44976640 GGAAACTGAGGCTTCAAGAAGGG - Intronic
1166724114 19:45015237-45015259 GGAAACTGAGGTTAAAAGAGGGG + Intronic
1166766327 19:45253643-45253665 GGAAACTGAGGCTGCAAGCTGGG - Intronic
1166775018 19:45307212-45307234 GGAAACTGAGGCCCCGAGGGAGG + Intronic
1167459430 19:49616470-49616492 GGAAGCTGAGGCTCCAAGAGAGG + Intronic
1167534336 19:50040027-50040049 TGAAACTGAGGTTAAAAGAGTGG + Intronic
1167552438 19:50170212-50170234 GGAAACTGAGGGACAAAGAGAGG - Intergenic
1167796388 19:51712431-51712453 GGAAACTGAGGTCAAGAGTGGGG + Intergenic
1167985285 19:53309433-53309455 GGAAACTCAGGTTGCAGGGGCGG - Intergenic
1168276364 19:55280661-55280683 AGAAACTGAGGCCGAGAGAGGGG - Intergenic
1168325032 19:55534197-55534219 GTAAAATGAGGTCACTAGAGTGG + Intronic
925098316 2:1224854-1224876 GATAACTCAGGTCACAAGAGTGG + Intronic
925187710 2:1860499-1860521 GGGGCCTGGGGTCGCAAGAGAGG + Intronic
926064268 2:9824542-9824564 GGACACTGAAGTCACAAGTGGGG - Intergenic
926808369 2:16734101-16734123 GGAAACTGAGGTCTCCAATGGGG - Intergenic
926971098 2:18468265-18468287 GGAAATTCAGGTCCCAAGAGAGG - Intergenic
927107449 2:19840328-19840350 GGAAACTGAGGCCCCAAGAAGGG + Intergenic
927125850 2:20012249-20012271 GGAAACTGAGGTCCAGAGAAGGG - Intronic
927181482 2:20449522-20449544 GGAAACGGAGTTGGCAAGAAAGG - Intergenic
927644712 2:24870378-24870400 GGATACTGAAGTCCAAAGAGGGG + Intronic
930059491 2:47276601-47276623 GGAGACCGAGGTTGGAAGAGGGG - Intergenic
930770181 2:55122709-55122731 AGAAGCTGAGGTGGCAATAGTGG + Intergenic
931185559 2:59947655-59947677 GGAAACTGATGTCAGAAGAGGGG + Intergenic
932053991 2:68426200-68426222 GGAAGCTGAGGTGGGAAGATCGG - Intergenic
932409211 2:71535250-71535272 GGAAACTGAGGAAGGAATAGAGG - Exonic
932453214 2:71829408-71829430 GGAAACTGAGGCCGCAGAGGAGG + Intergenic
932462884 2:71894610-71894632 GGAGACGGAGCTCGCATGAGAGG - Intergenic
933129087 2:78650894-78650916 GGAAACTGAGGTTGTAAGATGGG - Intergenic
933727057 2:85433132-85433154 GGAAACTGAGGTGGAAATGGAGG - Intronic
935123562 2:100202628-100202650 GGAAACTGAGGCAGAAAGGGAGG + Intergenic
936058658 2:109280307-109280329 GGAAACTGAGGCCCAGAGAGGGG + Intronic
937085422 2:119168783-119168805 GGAAACTGAGGTTTGGAGAGGGG - Intergenic
937127419 2:119483306-119483328 GGAAGCTGAGGTTCCAAGAGGGG + Intronic
937270089 2:120644076-120644098 GGAAACTGAAGCCCAAAGAGGGG - Intergenic
937412876 2:121691534-121691556 GGAAACTGAGGTTTGAAGAAAGG - Intergenic
937779198 2:125818361-125818383 GGGAATTGAGGTTGAAAGAGTGG - Intergenic
941482884 2:166039822-166039844 GGAAACTGAGGTCTTCAGATGGG + Intronic
941805174 2:169705297-169705319 GGAAATTTATGTCCCAAGAGAGG + Intronic
942062628 2:172241662-172241684 AGAAACTGAGGTATCCAGAGAGG + Intergenic
943402688 2:187435286-187435308 GGCAACAGAGGGAGCAAGAGAGG + Intronic
945680630 2:212909774-212909796 AGAAACTGGGGACACAAGAGCGG + Intergenic
945736670 2:213609392-213609414 GAAAACTGAGATGGCAACAGAGG - Intronic
946046513 2:216825928-216825950 GGAAACTGAAGCCCCAAGAGGGG - Intergenic
946304490 2:218847968-218847990 GGAAACTGAGACAGCAAGTGGGG + Intergenic
946332930 2:219020616-219020638 GGAAGCTGAGGTGGGAAGATTGG - Intronic
947536494 2:230943168-230943190 GGAAACTGAGGCCCCAGCAGAGG + Intronic
948668709 2:239552622-239552644 GGAAGCTGAGGCTGCCAGAGTGG + Intergenic
948972038 2:241436290-241436312 AAAAACAGAGGTCCCAAGAGAGG - Intronic
949035137 2:241812728-241812750 GGAAACTGAGGCCCACAGAGAGG - Intronic
1168954470 20:1825211-1825233 GGAAACTGAGGTCCAGAGAGAGG + Intergenic
1168955294 20:1830272-1830294 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1169541249 20:6601822-6601844 GGAAACTGAAGGCAGAAGAGAGG - Intergenic
1170644248 20:18182571-18182593 GGAAGCTGAGCTTGCTAGAGAGG + Intronic
1172114411 20:32565062-32565084 GGAAGCTGAGGTTGAGAGAGGGG - Intronic
1172226724 20:33310264-33310286 GGAAACTGAGGCCCACAGAGGGG - Intergenic
1172252639 20:33490402-33490424 GGAAACTGAGGCCCGAAGCGGGG + Intronic
1172480354 20:35267694-35267716 AGAAACTGAGGTCCCAAGAAGGG - Intronic
1172530503 20:35627572-35627594 GGAAACTAAGGTTCAAAGAGAGG + Intronic
1172624203 20:36337956-36337978 GGAAGCCGAGGCCCCAAGAGGGG + Intronic
1172842737 20:37911762-37911784 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1173729918 20:45320966-45320988 GGAAACTGAGGCTCCAAGAGAGG + Intergenic
1173851017 20:46218333-46218355 GAAAACTGAGGCCCCAAAAGTGG - Intronic
1173868022 20:46325091-46325113 GGCCACCGAGGTCTCAAGAGAGG - Intergenic
1173872976 20:46353162-46353184 GGAAACTGAGGTCCAGAAAGGGG - Intronic
1173907356 20:46638666-46638688 GGAAACTGAGGCCTAAAGAGGGG - Intronic
1174194589 20:48764071-48764093 GGAAGCTGAGATCGCAAGAGAGG - Intronic
1174363866 20:50044506-50044528 GGCAACTGAGGCTGAAAGAGGGG - Intergenic
1174383243 20:50171078-50171100 GGAAACTGAGGCCCAGAGAGTGG - Intergenic
1174425323 20:50428064-50428086 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1174684031 20:52436403-52436425 GGAAAGTGAGGTCCAGAGAGTGG - Intergenic
1175180169 20:57140732-57140754 GGAAACTGAGGTTCCGGGAGGGG + Intergenic
1175543953 20:59766106-59766128 GGAAACTGAGGTCATCAGACCGG - Intronic
1176333689 21:5576068-5576090 GGAAACTGAGGCCCCAGAAGAGG + Intergenic
1176394068 21:6244884-6244906 GGAAACTGAGGCCCCAGAAGAGG - Intergenic
1176403890 21:6344589-6344611 GGAAAATGAGGCCCCAAAAGAGG + Intergenic
1176433267 21:6644515-6644537 GGAAAATGAGGCCCCAAAAGAGG - Intergenic
1176467351 21:7071290-7071312 GGAAACTGAGGCCCCAGAAGAGG + Intronic
1176490912 21:7453068-7453090 GGAAACTGAGGCCCCAGAAGAGG + Intergenic
1176509730 21:7685315-7685337 GGAAACTGAGGCCCCAGAAGAGG - Intergenic
1179808321 21:43854182-43854204 GTAAAATGAGGTCGCTAGGGTGG + Intergenic
1180065392 21:45409717-45409739 GGAAACTGAGGCAGCAAGGCTGG - Intronic
1181349081 22:22242634-22242656 GGGAACAGAGGTGGGAAGAGTGG + Intergenic
1181452116 22:23030138-23030160 GGGAACTCAGGTAGCAAGAAAGG - Intergenic
1181601122 22:23952406-23952428 GGAAACTGAGGCTGGAGGAGGGG + Intergenic
1181607387 22:23988920-23988942 GGAAACTGAGGCTGGAGGAGGGG - Intergenic
1181677667 22:24467302-24467324 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1182019689 22:27071134-27071156 GAAAACTGAGGTCACGGGAGAGG - Intergenic
1182065596 22:27429319-27429341 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1182067563 22:27441563-27441585 GGAAACTGAGGCTGCAAGAAGGG + Intergenic
1182369879 22:29803385-29803407 GGAAACTGAGGTTCAGAGAGGGG - Intronic
1182415315 22:30217679-30217701 GGACACTGAGCTCAGAAGAGGGG - Intergenic
1182753765 22:32661821-32661843 GGAAACTGAGGCCTCAAGAGGGG + Intronic
1182759947 22:32714311-32714333 GGAAACTGAGGTCCACAGAGTGG - Intronic
1183064383 22:35353201-35353223 GGAAACTGAGGCCCAGAGAGAGG - Intergenic
1183084296 22:35477168-35477190 GGAAACTGAGGCCCAGAGAGTGG + Intergenic
1183179704 22:36251843-36251865 GGAAACTGAGGCAAGAAGAGAGG - Intergenic
1183470189 22:38001168-38001190 GGAAACTGAGGCTGAGAGAGGGG - Intronic
1183593156 22:38793624-38793646 GGAAACTGAGGCCCAAACAGGGG + Intronic
1183653319 22:39171414-39171436 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1183739386 22:39661724-39661746 GGGAAGTGAGGTGGCAGGAGGGG + Intronic
1184365601 22:44049159-44049181 GGAAACTGAGGCCCTGAGAGAGG + Intronic
1184495339 22:44837885-44837907 GAAAACTGAGGTCCCCAAAGAGG - Intronic
1184606260 22:45576435-45576457 GGAAACTGAGGCCCACAGAGAGG + Intronic
949872607 3:8602110-8602132 GGAAACTGAGGCTGAGAGAGGGG - Intergenic
950141932 3:10621494-10621516 GGAAACTGAGGTCAGGAGAAGGG + Intronic
950159467 3:10749030-10749052 GGAAACTAAGATCCAAAGAGAGG - Intergenic
950206840 3:11087266-11087288 GGAAAGTGAGGTCCACAGAGAGG + Intergenic
950546077 3:13638784-13638806 GGAAACTGAGGCCCTGAGAGCGG + Intergenic
950563065 3:13746945-13746967 GGAAACTGAGGCCAAGAGAGGGG + Intergenic
950579374 3:13852550-13852572 GGAAACTGAGGTCGCAAGAGGGG + Intronic
950674893 3:14548767-14548789 CGAAACTGAGGTCGAGAGAGGGG + Intergenic
950678561 3:14569358-14569380 GGAAACTGAGGCCAGGAGAGAGG + Intergenic
950869358 3:16215381-16215403 GAAAACTGAGGTCCCATGAGAGG + Intronic
952030215 3:29132615-29132637 GGAAACTGAGGCACTAAGAGTGG - Intergenic
952749849 3:36816277-36816299 AGAAACTGAGGGAGCAGGAGGGG + Intergenic
952878387 3:37967260-37967282 AGAAACTGAGGTCCAAGGAGAGG + Intronic
953033269 3:39191489-39191511 GGAAACAGAGGCCCAAAGAGGGG + Intronic
953227363 3:41033058-41033080 AGAAACTGAGGTGCAAAGAGAGG + Intergenic
953326984 3:42020333-42020355 GGTAATAGAGGTCACAAGAGTGG - Intronic
953705474 3:45226655-45226677 GGAAACTGAGGTCGAGAGAGGGG + Intergenic
953750958 3:45607974-45607996 GCAAACTGAGGTAGCAGGAGGGG - Intronic
953820689 3:46205205-46205227 GGACACTGAGGGCACCAGAGTGG + Intronic
953906689 3:46872019-46872041 GAACACTGAGGTCTCCAGAGGGG - Intronic
954444884 3:50541244-50541266 GGAAGCTGATGTGGCAGGAGGGG - Intergenic
954675549 3:52313515-52313537 GCAAACTGAGGTGGCAAGAAAGG - Intergenic
954747495 3:52795391-52795413 GGAAACTGAGGTCCAGAGAGGGG - Intronic
955086849 3:55710884-55710906 GGAGACTGAGGCTCCAAGAGGGG + Intronic
955216012 3:56985631-56985653 GGAAACTGAGGTTCTGAGAGGGG + Intronic
960575358 3:119223650-119223672 GGAAAGTGATGTCTCAACAGAGG + Intronic
961826104 3:129599913-129599935 GGAAACTGAGGCCAAGAGAGGGG - Intronic
961873632 3:130004742-130004764 GGAGACTGAGGTATAAAGAGGGG + Intergenic
962923098 3:139968321-139968343 TGAAACTGAGGACACAGGAGAGG - Intronic
963138049 3:141925357-141925379 GGAAACTGAGGTGGGAGGATTGG + Intronic
963982910 3:151560138-151560160 AGAAACTGTGGACACAAGAGTGG + Intergenic
964388408 3:156173580-156173602 GGAAACTGAGGTCCCCAGAGAGG - Intronic
964687522 3:159413666-159413688 GGGAACTGAGGGCTAAAGAGGGG - Intronic
964941546 3:162162988-162163010 GGAAACTGAGGGTGGGAGAGTGG - Intergenic
967136730 3:186519047-186519069 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
967223091 3:187265656-187265678 GGAAACAGAGGTCAAGAGAGGGG + Intronic
967818108 3:193815881-193815903 GGAGAATGAGGTGGCAAGCGTGG + Intergenic
967931867 3:194695754-194695776 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
968120506 3:196122652-196122674 GGAAACTGAGGCCCCGAGAAGGG - Intergenic
968922364 4:3528935-3528957 GGAAACTGAGGTCTGCAGAGAGG - Intronic
969671462 4:8592553-8592575 GGAAACTGAGGCCCAAGGAGGGG + Intronic
969676676 4:8618236-8618258 GGAAACTGAGGCCCAGAGAGGGG + Intronic
969703431 4:8780027-8780049 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
971932473 4:33102693-33102715 TGAAACTGAGGGAGTAAGAGAGG + Intergenic
975639499 4:76485163-76485185 GGAAAGTGAGGTCACAAGGGAGG - Intronic
979073877 4:116245429-116245451 AGAAACTGAGTTCACAGGAGAGG - Intergenic
979691535 4:123564004-123564026 GGAAGCTGAGGTAGGAAGATTGG - Intergenic
981036356 4:140173551-140173573 GGAAGCTGAGGTGGGAAGAGGGG + Intergenic
981694030 4:147541486-147541508 GGAAACTGAAAAAGCAAGAGAGG - Intronic
981721478 4:147806170-147806192 GGACACTGAGGTGGTAAGATGGG - Intronic
983980349 4:173987979-173988001 GAAAACTGAGGCCGAAAGAGAGG - Intergenic
984769608 4:183425950-183425972 GGACACTGAGGACACAGGAGGGG - Intergenic
984873741 4:184349608-184349630 GGAAACTGAGGTCACACAACTGG - Intergenic
985724127 5:1506753-1506775 GGAGACTCAGGTCGCTAAAGTGG + Intronic
985972876 5:3392126-3392148 GGAGACTGGGGTGGCCAGAGAGG + Intergenic
986942735 5:12974938-12974960 GGAAATTGAGGTGCCAATAGAGG - Intergenic
988778401 5:34497451-34497473 GGAAACCGCGGTCCCAAGGGTGG + Intergenic
989004600 5:36796402-36796424 GGGAACTGAGGTCATAAAAGAGG + Intergenic
989529364 5:42489195-42489217 GGAAAATGAGGTAAGAAGAGTGG - Intronic
992150297 5:73895918-73895940 GGAAACTGAGGTCTTGAGAAGGG + Intronic
992898154 5:81265302-81265324 GGAAACTTAGGCCCCAAGAGAGG - Intronic
993096506 5:83485126-83485148 GGAAACTGTGGTACCAAGAGAGG + Intronic
993132402 5:83915189-83915211 GGAAACTGTGGTGGGAAGATTGG + Intergenic
994710726 5:103259988-103260010 GAAAACTGAGGTGGAAGGAGAGG - Intronic
994842345 5:104941636-104941658 GGAAACTGAGACCGCAAGTTAGG - Intergenic
997587965 5:135055379-135055401 GGAAACTGAGGTCTGGAGAAGGG - Intronic
997666462 5:135633377-135633399 GGTAACTGAGGTCATAAGGGTGG + Intergenic
998136879 5:139678640-139678662 GGAAACTGAGGCCCCAAGCGGGG - Intronic
998154329 5:139775975-139775997 GCAAACTGAGGTCAGAAGACAGG - Intergenic
998374219 5:141680706-141680728 GGAAACTGAGGCCCAGAGAGGGG + Intronic
999297088 5:150466413-150466435 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
999451825 5:151684351-151684373 GGAAACTGCAGCCTCAAGAGAGG + Intronic
999640529 5:153668096-153668118 GGAAACTGAGGCCCAAAGAGGGG - Intronic
1000021404 5:157322213-157322235 GGAAACTGAGGTCTAGAGAGGGG + Intronic
1000407586 5:160904947-160904969 GGAGACTGAGGCCCAAAGAGAGG + Intergenic
1000692410 5:164339933-164339955 GGAAACAGAGGGCGAAAGAGAGG + Intergenic
1001303587 5:170555463-170555485 GGAAACTGAGGCTGTAAGTGAGG + Intronic
1001808572 5:174609593-174609615 AGAAACTGGGGACCCAAGAGGGG - Intergenic
1002047521 5:176550231-176550253 GGAAACTGAGGCCTGGAGAGGGG + Intronic
1002254516 5:177949487-177949509 GGAAACTGAGGCCCTCAGAGAGG + Intergenic
1002483474 5:179518325-179518347 GGAAACTGAGGCCCTCAGAGAGG - Intergenic
1003095546 6:3140282-3140304 GGAAACTGAGGGCCAAGGAGGGG + Intronic
1003918794 6:10812653-10812675 GGAGAATGAGGTTGCAAGATGGG + Intronic
1005949978 6:30624736-30624758 GGAAACTGAGGTCCATGGAGGGG + Intronic
1006167979 6:32076650-32076672 GGAAGCTGAGGTTCCAGGAGAGG + Intronic
1006847775 6:37074804-37074826 GGAAACTGAGGCCCCAAGAGGGG + Intergenic
1007123382 6:39402111-39402133 GGAAACTGAGGCAGCAAGTGAGG - Intronic
1007250035 6:40489362-40489384 CGAAACTGAGGACCCAAGTGGGG + Intronic
1007266133 6:40597492-40597514 GGAAACTGAGGTCTACAGAGCGG - Intergenic
1007269277 6:40623942-40623964 GGAAACTAAGGTCTGAAAAGGGG - Intergenic
1007443124 6:41881337-41881359 GAAAACAGAGGTCCCTAGAGAGG + Intronic
1007733209 6:43964516-43964538 GGAAACTGAGGGCCAAAGAGAGG + Intergenic
1007820324 6:44556011-44556033 GGAAACTGAGATCCAGAGAGGGG + Intergenic
1007849686 6:44791339-44791361 GGAAACTGAGACCTAAAGAGAGG - Intergenic
1010149244 6:72711116-72711138 GTAAAATGAGGTTGTAAGAGTGG + Intronic
1011300369 6:85866835-85866857 GGAACTGGAGGTGGCAAGAGTGG - Intergenic
1011300379 6:85866874-85866896 GGAACTAGAGGTGGCAAGAGTGG - Intergenic
1012509028 6:99981561-99981583 GGAAACTGAGGTTACAAAAGAGG - Intronic
1014779033 6:125542138-125542160 GGAAAATGAGGTCATAAGGGTGG - Intergenic
1015604007 6:134937374-134937396 AGAAACTGAGGGCTCAAGAGAGG + Intronic
1016961286 6:149674831-149674853 GGAGACAGAGGTTGCATGAGAGG + Intronic
1017667962 6:156739679-156739701 GTTAAATGAGGTCGTAAGAGTGG - Intergenic
1018294304 6:162329225-162329247 TGAAAATGAGGACGGAAGAGCGG + Intronic
1019287699 7:231849-231871 GGAAACTGAGGCCCAAAGAGGGG - Intronic
1019423622 7:963099-963121 GAAAACTGAGCTGGCAGGAGTGG + Intronic
1019553670 7:1617809-1617831 GGAAAATGAGGTCACTAGGGTGG + Intergenic
1019557129 7:1638147-1638169 GGAAACTGAGGCCAAGAGAGAGG + Intergenic
1019558687 7:1645267-1645289 GGAAACTGAGGCCGGGTGAGGGG - Intergenic
1019818152 7:3216644-3216666 GGAAACTGAAGTCTACAGAGGGG - Intergenic
1019981927 7:4628069-4628091 AGAAACTGAGGCCGAAAGAGAGG - Intergenic
1020112199 7:5453587-5453609 GGAAACTGAGGCCTCAGGAAAGG + Intronic
1020130447 7:5556203-5556225 GGAAACTGAGGCCCAGAGAGAGG - Intronic
1020461583 7:8434487-8434509 GGAAACTTAAGAGGCAAGAGAGG - Exonic
1021098586 7:16562223-16562245 GAAAACTGAGCTAGAAAGAGAGG - Intronic
1022526366 7:31040169-31040191 GGAAACTGAGGTCCACAAAGGGG + Intergenic
1022955488 7:35376564-35376586 GGAAAATCAGGACCCAAGAGAGG - Intergenic
1024354029 7:48396132-48396154 GGAAACTGAGGTAGCAGTGGAGG - Intronic
1025981610 7:66411814-66411836 AATAACTGAGGTGGCAAGAGGGG - Intronic
1025988819 7:66479192-66479214 AATAACTGAGGTGGCAAGAGGGG - Intergenic
1026040382 7:66863484-66863506 AAGAACTGAGGTGGCAAGAGGGG + Intergenic
1026652339 7:72226421-72226443 GGAAACTGAGGCCCAAAGAGGGG - Intronic
1027211777 7:76155182-76155204 AATAACTGAGGTGGCAAGAGGGG - Intergenic
1029272502 7:99385491-99385513 GGAAACTGAGGCCCCAGGAGGGG + Intronic
1029590219 7:101502470-101502492 GGAAACTGAGGTTCCAAGAAGGG + Intronic
1029881403 7:103814778-103814800 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1030972122 7:116072917-116072939 TTAAACAGAGGTGGCAAGAGTGG - Intronic
1030980371 7:116179117-116179139 GGAAATTGAGGTGGCAGGAAGGG - Intergenic
1032185190 7:129719099-129719121 GGAAACTGAAGTAGTAAGAATGG + Intronic
1032705041 7:134414233-134414255 GAAACCTGAGGTCCCAAGTGTGG - Intergenic
1033266670 7:139892931-139892953 GGAAAATGAGGCCCAAAGAGGGG - Intronic
1034067147 7:148147910-148147932 GGACAGTGAGCTCCCAAGAGTGG - Intronic
1034132008 7:148727753-148727775 GGAGACTGAGGTGGCAAGGGGGG + Intronic
1035869914 8:3126484-3126506 GGAAGCTGAGGACTCAAGCGGGG - Intronic
1037767980 8:21783450-21783472 GGAAACTGAGGCCCAAAGAAGGG + Intronic
1038207313 8:25478831-25478853 GGAAAATAATGTAGCAAGAGAGG - Intronic
1038403472 8:27304461-27304483 GGAACCTGAGCTGGCAAGATCGG - Intronic
1038851109 8:31277140-31277162 GGAAACTGAGATGGCATGGGAGG - Intergenic
1039411663 8:37360082-37360104 AGAAACTGAGGTCCAGAGAGGGG - Intergenic
1040291068 8:46124839-46124861 GGAACTAGAGGTGGCAAGAGTGG + Intergenic
1040541587 8:48362011-48362033 GTAAAATGAGGTCATAAGAGTGG - Intergenic
1040799200 8:51322439-51322461 GGGAACTGAGGTGGGATGAGTGG + Intronic
1041315661 8:56559554-56559576 GGAAGATGATGTCGCAAGGGTGG - Intergenic
1041495700 8:58483164-58483186 GTTAAGTGAGGTCACAAGAGTGG + Intergenic
1042845773 8:73168302-73168324 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1043949022 8:86287101-86287123 GTAAATTCTGGTCGCAAGAGTGG - Intronic
1045299864 8:100901735-100901757 GGAAGCTGAGAACCCAAGAGAGG - Intergenic
1046754187 8:117956264-117956286 GGAAACTGAGGTCCAGTGAGTGG - Intronic
1046793135 8:118343058-118343080 GGAAACTGAGGTCTTGAGAGGGG - Intronic
1047501766 8:125447065-125447087 GGAAGCTGTGGTCTCGAGAGAGG - Intergenic
1047811208 8:128411078-128411100 AGAAACTGAAGCCCCAAGAGGGG + Intergenic
1049203008 8:141350981-141351003 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1049360776 8:142211669-142211691 GGAAGCTGAGGTCTCAGGAGGGG + Intergenic
1049544691 8:143224837-143224859 TGACACTGAGGCAGCAAGAGGGG - Intergenic
1049787341 8:144457314-144457336 GGAAACTGAGGCCCCAAGAGGGG - Intronic
1052830013 9:33207401-33207423 GGAAACTGAGGTCCTTAAAGGGG + Intergenic
1052851358 9:33380379-33380401 GGAAACTGAGGCCCAGAGAGTGG + Intergenic
1052855098 9:33402153-33402175 GGAAACTGAGGCCCAGAGAGAGG + Intronic
1052964543 9:34329762-34329784 GAAAACTGAGGTCCTGAGAGCGG - Intronic
1053066761 9:35074563-35074585 GGAAACTGAGGCCTAGAGAGAGG + Intronic
1053348794 9:37397842-37397864 GTAAAATGAGGTCACAAGGGTGG - Intergenic
1055312191 9:74994033-74994055 GGTAAATGAGGTCGTAAGGGTGG + Intronic
1055489235 9:76787876-76787898 GGAAGCTGCGGTCACAGGAGAGG - Intronic
1055947335 9:81703423-81703445 GGAAACTGAGGCCCGGAGAGTGG - Intergenic
1057145431 9:92755932-92755954 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1057182091 9:93035734-93035756 GGAAACTGAGGCCCAGAGAGGGG + Exonic
1057257085 9:93558439-93558461 GGACAGTGAGGTGACAAGAGGGG + Intronic
1057304681 9:93905210-93905232 GGAAACTGAGGCCTGAAGAAGGG - Intergenic
1057307591 9:93921188-93921210 GGAAACTGAGGTTCAGAGAGGGG - Intergenic
1057749625 9:97781308-97781330 GGAAACTGAGGTCACAAGATGGG + Intergenic
1057802595 9:98199234-98199256 GGAAACTGAGGGCCAGAGAGGGG + Exonic
1057947994 9:99346482-99346504 AGAAACTGAGGCCACAGGAGAGG - Intergenic
1059107941 9:111527467-111527489 ACAAAATGAGGTCCCAAGAGTGG + Exonic
1059179362 9:112197437-112197459 GTAAAATGAGGTCATAAGAGTGG + Intergenic
1059310903 9:113388539-113388561 GTAAACTGAGGCCCCAAAAGAGG - Intronic
1059538181 9:115103581-115103603 AGAAACTGAGACCTCAAGAGTGG - Intronic
1059733388 9:117078233-117078255 GGAAACTGAGGTCCAAAAAGAGG + Intronic
1059837551 9:118172845-118172867 GTAAAATGAGGTCTCAGGAGTGG + Intergenic
1060399046 9:123336970-123336992 AGAAACTGAGGCCCCAAAAGTGG + Intergenic
1060570305 9:124632872-124632894 GAAAACTGAGGTCCATAGAGGGG - Intronic
1060976398 9:127767653-127767675 GGAAACTGAGGCCTGATGAGAGG - Intronic
1060977276 9:127771988-127772010 AGAAACTGAGGCTCCAAGAGAGG + Intronic
1061022568 9:128025744-128025766 GGAAACTGAGGTTCAGAGAGGGG + Intergenic
1061036023 9:128114825-128114847 GGAAACTAAAGTTTCAAGAGGGG + Intergenic
1061080526 9:128367126-128367148 GGAAACTGAGTTCCACAGAGGGG + Intergenic
1061211383 9:129195406-129195428 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1061399717 9:130361781-130361803 GGAAACTGAGGCTGACAGAGGGG - Intronic
1061407827 9:130402555-130402577 GGAAACTGAGGTCCAGAGAGTGG + Intronic
1061502537 9:131012322-131012344 GGAAACTGAGGCTGAGAGAGGGG - Intronic
1061808351 9:133148789-133148811 GGAAACTGAGGACAGGAGAGGGG - Intronic
1061899436 9:133665527-133665549 GGAAACTGAGGCTCCAAGAGAGG + Intronic
1061930747 9:133831898-133831920 GGAAACTGAGGTCCAGAGAGGGG - Intronic
1062033406 9:134372130-134372152 GGAAACTGAGGTGTGGAGAGGGG + Intronic
1062044679 9:134419545-134419567 GCAAACTGAGGTCCAGAGAGGGG + Intronic
1062395214 9:136350045-136350067 GGAAACTGAGGCCCAAAGAGAGG - Intronic
1062459191 9:136655805-136655827 GTAAACTGAGGCCCAAAGAGGGG - Intergenic
1203428007 Un_GL000195v1:59149-59171 GGAAACTGAGGCCCCAGAAGAGG - Intergenic
1203438269 Un_GL000195v1:164155-164177 GGAAAATGAGGCCCCAAAAGAGG + Intergenic
1185726223 X:2424069-2424091 GTAAAATGAGGTCACCAGAGTGG + Intronic
1185791826 X:2933010-2933032 TTAAAATGAGGTCACAAGAGTGG + Intergenic
1185824571 X:3237500-3237522 GTAAAATGAGGTCACTAGAGTGG + Intergenic
1188052617 X:25506459-25506481 GTAAAATGAGGTCGTATGAGTGG - Intergenic
1189950507 X:46225573-46225595 TTAAACTGAGGTCATAAGAGTGG + Intergenic
1190765831 X:53474962-53474984 GGGAAGTGAGGACACAAGAGAGG + Intergenic
1190935570 X:54996349-54996371 GGAAACTGAGGTCTGGGGAGGGG + Intronic
1191670258 X:63742261-63742283 GGAAACTGAGGTCTAAGGAGAGG - Intronic
1191673151 X:63767900-63767922 GGAAACTAAGGCTGGAAGAGGGG - Intronic
1191852338 X:65594656-65594678 GGAAACTGAGATCCAGAGAGAGG + Intronic
1191866111 X:65705140-65705162 GGAAACTGAGGTCCAAAGAAAGG - Intronic
1192142042 X:68654156-68654178 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1192181438 X:68918192-68918214 GGAAACCGAGGTCCAGAGAGGGG - Intergenic
1192233986 X:69284740-69284762 GGAAACTGCGGTCCAGAGAGGGG - Intergenic
1192611948 X:72575569-72575591 GAAAACTGAAGTCATAAGAGTGG + Intergenic
1192698586 X:73444599-73444621 GGAAACTGATGGCTTAAGAGAGG - Intergenic
1193233868 X:79082499-79082521 GGAAACTGAGGCCCCAATAAAGG - Intergenic
1195700249 X:107699917-107699939 GGAAACTGAGGCTGGGAGAGAGG - Intergenic
1196031722 X:111099793-111099815 GGAAACTGAGGCCTAGAGAGGGG - Intronic
1196058708 X:111384922-111384944 AGAAACTGAGATCCAAAGAGAGG + Intronic
1196753398 X:119137484-119137506 GAGAACTGAGGTCCAAAGAGGGG - Intronic
1196937078 X:120740777-120740799 GGAAACTGAGGTCTGAACTGAGG - Intergenic
1197702459 X:129609635-129609657 GGAAACTGAGGTTCAGAGAGGGG - Intergenic
1198046861 X:132912238-132912260 GGAAACTGATGCCCCATGAGGGG - Intronic
1198051996 X:132959096-132959118 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1198114677 X:133533685-133533707 GGAAACTGAGGTCTAGAGAGAGG + Intergenic
1198729994 X:139718647-139718669 GAAAACTGAGGTCCAAAGAAGGG - Intergenic
1198978061 X:142359836-142359858 GCAAACTGAGGTCTCAAGAAGGG - Intergenic
1199548899 X:149036688-149036710 GGAAACTGAGGGCCATAGAGGGG + Intergenic
1200327486 X:155257235-155257257 GGTAACTGAAGTCACGAGAGTGG + Intergenic
1201254749 Y:12096309-12096331 GTAAAATGAGGTCACTAGAGTGG - Intergenic
1201281830 Y:12349263-12349285 TTAAAATGAGGTCACAAGAGTGG - Intergenic