ID: 950579375

View in Genome Browser
Species Human (GRCh38)
Location 3:13852554-13852576
Sequence ACTGAGGTCGCAAGAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579367_950579375 25 Left 950579367 3:13852506-13852528 CCGGTCGGAACAAGGAGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 950579375 3:13852554-13852576 ACTGAGGTCGCAAGAGGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 201
950579370_950579375 -4 Left 950579370 3:13852535-13852557 CCAATCGACAGATGTGGAAACTG 0: 1
1: 2
2: 43
3: 503
4: 3204
Right 950579375 3:13852554-13852576 ACTGAGGTCGCAAGAGGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 201
950579369_950579375 -3 Left 950579369 3:13852534-13852556 CCCAATCGACAGATGTGGAAACT 0: 1
1: 2
2: 19
3: 368
4: 2470
Right 950579375 3:13852554-13852576 ACTGAGGTCGCAAGAGGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579375 Original CRISPR ACTGAGGTCGCAAGAGGGGC TGG Intronic
900680602 1:3914315-3914337 ACTGAGGCTGAAGGAGGGGCTGG + Intergenic
901061204 1:6472726-6472748 ATGGAGGTCCCAAGAGGAGCAGG + Intronic
901674339 1:10874231-10874253 ACTGAGGTCCCAAGACGCGGAGG - Intergenic
901972735 1:12920548-12920570 AATGAGGATGCAGGAGGGGCAGG + Intronic
902012445 1:13281214-13281236 AATGAGGATGCAGGAGGGGCAGG - Exonic
902374535 1:16024087-16024109 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902379476 1:16045851-16045873 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902729749 1:18361722-18361744 TCTGAGGTCACAAGAGTGGGTGG - Intronic
903193603 1:21669532-21669554 ACTGAGGACCAGAGAGGGGCAGG + Intergenic
903658745 1:24964362-24964384 CCTGAGGTGGGAAGAGGGGTTGG - Intronic
903889561 1:26560552-26560574 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
904531250 1:31171091-31171113 GCTGAGGCCGGAAGAGGGACAGG + Intergenic
904615311 1:31746369-31746391 TCTGTGGTCCCAAGAGAGGCAGG - Intronic
904868301 1:33600128-33600150 ACTGAAGTCTCAAGTGGGGAAGG + Intronic
905446349 1:38030563-38030585 ACTGAAGCCCCCAGAGGGGCTGG + Intergenic
907286374 1:53383073-53383095 ACTGAGGCCTCAAGAGGGGAAGG + Intergenic
907341146 1:53737372-53737394 ACTGAGGTCCCAAAAGGAGAGGG + Intergenic
912460481 1:109827730-109827752 ACTGAGGTCCCAAGTGGGTAAGG + Intergenic
912561798 1:110556353-110556375 ACTGAGCTACAAAGAGGGGCGGG - Intergenic
912658645 1:111509268-111509290 CCTGAGCTCACAAGAGGGGAAGG - Intronic
922168261 1:223133841-223133863 GCAGAGGGCGCAAAAGGGGCAGG + Intronic
923262659 1:232282296-232282318 ACTGAAGTAGCACCAGGGGCTGG - Intergenic
923504209 1:234591528-234591550 AGTGAGGTAGCAAGGGGGACGGG - Intergenic
1064701317 10:18024204-18024226 ACTGTGGTTGCAAGAGAGCCTGG + Intronic
1066600626 10:37102509-37102531 ACTGAGGTTGAAAGACTGGCAGG + Intergenic
1066601572 10:37113721-37113743 ACTGAGGTTGAAAGACTGGCAGG - Intergenic
1068078232 10:52285107-52285129 GCTGGGGTTGTAAGAGGGGCAGG - Intronic
1069788554 10:71005030-71005052 ACTGAGGCCCCAGGAGGGGCAGG + Intergenic
1071397514 10:85238332-85238354 ACGGAGGTCCCAAGAGTGGCAGG + Intergenic
1072155798 10:92722754-92722776 ACTGAGGTCCAAAGAGGGAAAGG - Intergenic
1073345310 10:102778391-102778413 ACTGAGGTGGCAAGAGGGCGAGG + Intronic
1074265115 10:111893899-111893921 ACTGAGGCCTCAAAAGGGGAGGG + Intergenic
1076352917 10:129831222-129831244 ACTGAGGCAGCCAGAGGGGCTGG - Intergenic
1077464289 11:2726247-2726269 GCTGACGTGGCAAGATGGGCGGG + Intronic
1077915781 11:6610763-6610785 ACTGTGGCCCCAAGAGGGGCGGG + Exonic
1082852303 11:57776223-57776245 ACTGAGGTCTCAGGAGGGGAGGG + Intronic
1083285091 11:61653559-61653581 TCTGGGGGCGAAAGAGGGGCAGG - Intergenic
1083324207 11:61865332-61865354 AGTGGGATCACAAGAGGGGCTGG + Intronic
1084634856 11:70384997-70385019 ACTGAGGTGGGAGGAGGGGAAGG - Intergenic
1085386510 11:76161133-76161155 ACTGAGGTCCAGAAAGGGGCAGG + Intergenic
1085619930 11:78030418-78030440 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1085889754 11:80564400-80564422 ACTGAGGTTGAAAGACTGGCAGG - Intergenic
1089676998 11:120096883-120096905 ACTGAGCTGTCAAGAGCGGCTGG - Intergenic
1090907974 11:131094216-131094238 ACTGAGGAAGGAAGAGAGGCAGG - Intergenic
1091542155 12:1471964-1471986 GCTGAGGTCTCAAGAGGTACAGG - Intronic
1091605728 12:1949769-1949791 AGTGAGGCCGCAGGAGGGGCGGG - Intronic
1092556826 12:9568943-9568965 TATGAGGTCACAAAAGGGGCAGG - Intergenic
1096634149 12:52948089-52948111 AGTGAGGTCGGGAGAGGGGAGGG + Intronic
1097058972 12:56268087-56268109 ATTAAGGTCGGAAGAGTGGCAGG - Intronic
1097107075 12:56632292-56632314 ACTGAGGCCTCAAGGGCGGCGGG + Intronic
1099198329 12:79646283-79646305 ACTGAGGTGGCATACGGGGCAGG - Intronic
1099524111 12:83697945-83697967 ACTGAGGTACAAAGAGGAGCTGG + Intergenic
1100963033 12:99984594-99984616 ACTGAGGTCGGAGGAGGAGGAGG + Intronic
1101882164 12:108633066-108633088 ACTGAGGTCGGGAGAGGTGAAGG - Intronic
1103860720 12:124010974-124010996 AGTGAGGTGGGGAGAGGGGCAGG + Intronic
1104430604 12:128713024-128713046 ACTGCTGTCCCAAGAGGAGCTGG - Intergenic
1104686449 12:130788055-130788077 ACTGAGGTCCCAGGAGGCCCAGG + Intergenic
1108535459 13:51371936-51371958 ACTGAGAACGCAAGAGGGAATGG - Intronic
1119733607 14:76966909-76966931 ACTGAGGGAGCTAGAGAGGCAGG - Intergenic
1121318247 14:92974874-92974896 ACTGTGGTCACAGGAGGAGCGGG + Intronic
1123459642 15:20458200-20458222 ACTGAGGTGGCAGTGGGGGCAGG + Intergenic
1123658420 15:22542220-22542242 ACTGAGGTGGCAGTGGGGGCAGG - Intergenic
1124265871 15:28234037-28234059 ACTGAGGTGGCAGTGGGGGCAGG + Intronic
1124312285 15:28636712-28636734 ACTGAGGTGGCAGTGGGGGCAGG - Intergenic
1125549385 15:40533947-40533969 GCTAAGATCCCAAGAGGGGCTGG + Intronic
1129658710 15:77541442-77541464 ACTGAGGCAGCAGGAGGGGAGGG + Intergenic
1130984565 15:88836590-88836612 ACTGAGCTTGCCGGAGGGGCAGG + Intronic
1132799836 16:1746619-1746641 ACTGGGGACCCAAGAAGGGCTGG - Intronic
1136578077 16:31135807-31135829 ACTTTGGTGGCAAGAGGAGCTGG - Intergenic
1137540673 16:49359594-49359616 ACTGAGGTCCCATCAGTGGCAGG - Intergenic
1138527879 16:57619522-57619544 ACTGAGGTAGACAAAGGGGCAGG - Intronic
1142352693 16:89587240-89587262 ACTGAGGGGGCGGGAGGGGCGGG - Intronic
1142670750 17:1486378-1486400 ACTGAGCCCTCCAGAGGGGCCGG - Intronic
1143104169 17:4520115-4520137 ACTGAGGCCCCAAGAGGTGGAGG - Intronic
1143115960 17:4582047-4582069 ACTGAGGCCCTAAGAGGGGCAGG - Intergenic
1143508607 17:7383354-7383376 AATGAGGTGGCTTGAGGGGCAGG + Intronic
1145252489 17:21304238-21304260 ACTGAGGCTGCAAGAGGTGCCGG - Intronic
1146260152 17:31415657-31415679 ACTGAGGCCGAGAGAGGGGAAGG + Intronic
1146811587 17:35908158-35908180 ACTGAGATGGGAAGAGGGACAGG + Intergenic
1146923496 17:36729040-36729062 ACTGAGGTCTGGAGAGGGGAAGG + Intergenic
1146969749 17:37062981-37063003 TCTGATGTCACCAGAGGGGCAGG - Intergenic
1148173827 17:45547404-45547426 ACTGAGATCGGGAGAGGGACAGG + Intergenic
1148297547 17:46515622-46515644 ACTGAGATCGGGAGAGGGACAGG - Intronic
1148362100 17:47020101-47020123 ACTGAGATCGGGAGAGGGACAGG - Intronic
1148438747 17:47701022-47701044 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1149513290 17:57259799-57259821 ACCCAGGTAGCAAGAGGGGGTGG - Intronic
1150405039 17:64894326-64894348 ACTGAGATCGGGAGAGGGACAGG + Intronic
1150463872 17:65375319-65375341 CCAGAGGTTGCAAGAGGGGCTGG + Intergenic
1151340330 17:73466874-73466896 ACTGAGGTCCAGAGAGGGGAAGG + Intronic
1151790040 17:76299438-76299460 AAAGATGTTGCAAGAGGGGCCGG + Intronic
1151790578 17:76303178-76303200 AAAGATGTTGCAAGAGGGGCCGG - Intronic
1152237724 17:79147205-79147227 ACTGTGGTCACAGGAGGCGCTGG + Intronic
1157240993 18:46009201-46009223 AATGAGGGCACAAGAGGTGCAGG - Intronic
1158452306 18:57578192-57578214 GCTGAGGTGGGGAGAGGGGCTGG + Intronic
1160798579 19:956797-956819 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1161232278 19:3180240-3180262 ACTGAGGCCCAGAGAGGGGCCGG - Exonic
1161977676 19:7615443-7615465 ACTGCGGACACAAGCGGGGCTGG - Exonic
1162671479 19:12261134-12261156 ACTGTGGTTGGAAGTGGGGCTGG + Intronic
1163234969 19:16024757-16024779 AGTGAGGTGGCAAGGGGGCCAGG + Intergenic
1163454915 19:17400859-17400881 AGTGAGGGGGCAAGAGGGCCAGG + Intergenic
1163889308 19:19996870-19996892 ACTGAGGCCCCAAAAGAGGCTGG + Intergenic
1165406524 19:35634170-35634192 ACTGTGGTGGCAGGAGGGCCGGG + Intronic
1166521347 19:43482263-43482285 ACTGAGGCTCCCAGAGGGGCAGG - Intronic
1167449779 19:49560332-49560354 ACTGAGGCCCAAAGAGGGACAGG - Intronic
1168020599 19:53606307-53606329 ACTCAGGAAGCAAGAGGGACTGG + Intergenic
1168441920 19:56375918-56375940 ATTAAGGGTGCAAGAGGGGCTGG - Intronic
925710115 2:6731071-6731093 AGGGAGGTGGCAAGAGGAGCAGG + Intergenic
925785230 2:7425323-7425345 ACAGAGGTAGGAAGAGGGACAGG + Intergenic
926832071 2:16974506-16974528 ACTGAGGTCTAGAGAGGAGCAGG + Intergenic
931185560 2:59947659-59947681 ACTGATGTCAGAAGAGGGGAAGG + Intergenic
932579816 2:72985814-72985836 ACTGGAGTCTGAAGAGGGGCAGG + Intronic
936058792 2:109281187-109281209 GCTGGGGTCGCAGGAGGGACAGG - Intronic
940703092 2:157071159-157071181 CCAGAGGTAGAAAGAGGGGCTGG + Intergenic
946327052 2:218990173-218990195 ACCAAGGAGGCAAGAGGGGCAGG + Exonic
947401151 2:229732679-229732701 ACTCAGGTGTCAAGAAGGGCAGG + Intergenic
947549048 2:231033458-231033480 GCTGAGGTGGGAAGAGGGGCTGG - Intergenic
947565120 2:231188793-231188815 GGTGAGGTGGCAAGAGGAGCAGG - Intergenic
948601613 2:239110903-239110925 GCTGAGGAGGCAGGAGGGGCCGG - Intronic
948609183 2:239155935-239155957 GCTGGGGTAGCAAGAAGGGCAGG - Intronic
1168837124 20:884832-884854 ACTGAGGCCAAGAGAGGGGCAGG + Intronic
1172181436 20:33006246-33006268 GGTGAGGGCGCAGGAGGGGCCGG + Intergenic
1172842736 20:37911758-37911780 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1172880037 20:38193896-38193918 ACTGAGGCCTCCAGCGGGGCTGG - Intergenic
1173175650 20:40762933-40762955 ACAGAGGCAGCAAGAGGGGAGGG + Intergenic
1173668258 20:44778341-44778363 ACTGAAGCCCAAAGAGGGGCAGG + Intronic
1174142540 20:48425917-48425939 ACTGAGGGAGCAAGAGGGAGGGG - Intergenic
1174294207 20:49533090-49533112 ACTGAGGTCCAGAGATGGGCAGG - Intronic
1175138494 20:56842577-56842599 GCCGAGGTGGCATGAGGGGCTGG - Intergenic
1176045583 20:63091025-63091047 ACTGAGGTCACAACAGGCCCTGG - Intergenic
1182098141 22:27639475-27639497 CCTGGGGTCCCAAGAGGGACAGG + Intergenic
1182308652 22:29388831-29388853 TCTGAGGTTCTAAGAGGGGCAGG + Intronic
1182529120 22:30941715-30941737 GCTGAGGACGTGAGAGGGGCGGG - Intronic
1183843222 22:40517874-40517896 TCTGGGGATGCAAGAGGGGCTGG + Intronic
950579375 3:13852554-13852576 ACTGAGGTCGCAAGAGGGGCTGG + Intronic
950674894 3:14548771-14548793 ACTGAGGTCGAGAGAGGGGAAGG + Intergenic
953750956 3:45607970-45607992 ACTGAGGTAGCAGGAGGGGAGGG - Intronic
953969104 3:47333240-47333262 ACTGGGGCCGACAGAGGGGCAGG - Exonic
954380136 3:50214958-50214980 ACTGAGGTCACAACACAGGCCGG + Intronic
954412613 3:50377644-50377666 TCTGAGGGTGGAAGAGGGGCAGG - Intronic
954675547 3:52313511-52313533 ACTGAGGTGGCAAGAAAGGAGGG - Intergenic
954747494 3:52795387-52795409 ACTGAGGTCCAGAGAGGGGCAGG - Intronic
959595667 3:108126001-108126023 ACTGGGGTCACAGGAGGGGCTGG + Intergenic
960832053 3:121860248-121860270 CCAGAGGTAGAAAGAGGGGCTGG - Intronic
960835737 3:121904927-121904949 CCAGAGGTAGAAAGAGGGGCTGG - Intronic
961274989 3:125719446-125719468 TATGAGGTCACAAAAGGGGCGGG + Intergenic
962382996 3:134911994-134912016 ACTGAGGGCCCAGGAGGGCCTGG + Intronic
964683246 3:159365747-159365769 ACTGAGGTCACTAGAGGTGAGGG - Intronic
966917715 3:184594112-184594134 ATTGGGGTCGCAAGAGGGAAGGG - Intronic
968377121 4:53157-53179 ACTGATGTGGCAAGAGTGACAGG - Intergenic
968450514 4:674050-674072 GCAGAGGTCGCAGGAGGGGTGGG + Intronic
968674838 4:1871684-1871706 ACTGAGGAGGCCTGAGGGGCCGG + Intronic
968735782 4:2295955-2295977 GCAGATGTCGCAAGAGGTGCGGG + Intronic
969509397 4:7609071-7609093 ACTCAGGCTGCATGAGGGGCTGG + Intronic
969671464 4:8592557-8592579 ACTGAGGCCCAAGGAGGGGCGGG + Intronic
969976351 4:11105929-11105951 GCAGAGGACGCAAGAGTGGCTGG + Intergenic
972479655 4:39485509-39485531 ACCCAGGACGCAAGAGTGGCAGG + Intergenic
975849817 4:78560646-78560668 TCTGAGGAGGAAAGAGGGGCTGG - Intronic
981721476 4:147806166-147806188 ACTGAGGTGGTAAGATGGGTGGG - Intronic
984769606 4:183425946-183425968 ACTGAGGACACAGGAGGGGGAGG - Intergenic
985791010 5:1926760-1926782 CCTGAGGCTGCAAGAGAGGCAGG - Intergenic
985972877 5:3392130-3392152 ACTGGGGTGGCCAGAGAGGCTGG + Intergenic
986220966 5:5768179-5768201 ACTGAGGTGGCCAGGGAGGCAGG + Intergenic
990545489 5:56816484-56816506 GCGGTGGTCGGAAGAGGGGCGGG + Intronic
994710725 5:103259984-103260006 ACTGAGGTGGAAGGAGAGGCAGG - Intronic
996316949 5:122170708-122170730 TCTGAGGAGGGAAGAGGGGCTGG - Intronic
999324655 5:150636446-150636468 ACTGAGGCCCCAAGAGGGTCAGG + Intronic
999925550 5:156372137-156372159 GCTGAGGTCCAAAGAGGGCCTGG - Intronic
1001808571 5:174609589-174609611 ACTGGGGACCCAAGAGGGGATGG - Intergenic
1002580679 5:180208169-180208191 ACTGAGGTTTAGAGAGGGGCGGG - Intronic
1003095547 6:3140286-3140308 ACTGAGGGCCAAGGAGGGGCAGG + Intronic
1006717750 6:36130982-36131004 ACCGAGGCCCCAAGAGGGGGAGG + Intronic
1007663166 6:43498827-43498849 ACTGGAGTCACTAGAGGGGCAGG - Intronic
1007785382 6:44276618-44276640 ACTGAGGCCGCGCGGGGGGCAGG + Exonic
1011334013 6:86240200-86240222 ACAGAGGTACAAAGAGGGGCTGG + Intergenic
1013289734 6:108709527-108709549 AGTGAGGTAGAAACAGGGGCAGG - Intergenic
1015371366 6:132457272-132457294 ACTGAGGTCACAAGATAGGTAGG - Exonic
1016992517 6:149939993-149940015 ACTGAGGTTGCCAGAGGAACAGG + Intergenic
1017007214 6:150036628-150036650 ACTGAGGTTGCCAGAGGAACAGG - Intergenic
1017775217 6:157675308-157675330 AGTGAGGTGGGAAGAAGGGCTGG - Exonic
1018509588 6:164510699-164510721 ACTGAGGCATCAAGATGGGCAGG - Intergenic
1019287697 7:231845-231867 ACTGAGGCCCAAAGAGGGGTGGG - Intronic
1019521253 7:1461461-1461483 ACTGTGGTGGCTGGAGGGGCAGG - Intergenic
1019733550 7:2639814-2639836 ACGGAGCTGGCACGAGGGGCGGG + Intronic
1022844137 7:34192867-34192889 ACTGAGGTTGAAGGAGGTGCTGG + Intergenic
1024301028 7:47887829-47887851 ACTGTAGAGGCAAGAGGGGCTGG + Intronic
1027782806 7:82540851-82540873 GCTGAGGTGGTAAGAGGGGATGG - Intergenic
1029821569 7:103151887-103151909 ACTGAGGTTGTAATAGGGCCTGG - Intergenic
1030983062 7:116209663-116209685 ACTGAGGACTCCAGAGGTGCAGG - Intergenic
1031374236 7:121004589-121004611 ACTGAGGTCACAAACTGGGCAGG + Intronic
1035365425 7:158346300-158346322 ACTGAGGTCGCCAGAGGCCAGGG - Intronic
1036304417 8:7589908-7589930 TATGAGGTCACAAGGGGGGCGGG + Intergenic
1036355269 8:8037900-8037922 TATGAGGTCACAAGGGGGGCGGG + Intergenic
1036615134 8:10381893-10381915 CCTGGGGTCCCAAGAGTGGCAGG - Intronic
1039411662 8:37360078-37360100 ACTGAGGTCCAGAGAGGGGAAGG - Intergenic
1039457695 8:37718440-37718462 ACTGTGGTCACTAGAGGGGTGGG + Intergenic
1041020788 8:53636177-53636199 ACTGAGGTCCCAGGAGGAACAGG - Intergenic
1044707230 8:95020577-95020599 GCTAAGGGAGCAAGAGGGGCTGG - Intronic
1048861711 8:138728702-138728724 ACTGAGGCCCAAAGAGGGTCAGG + Intronic
1049203009 8:141350985-141351007 ACTGAGGCCCAGAGAGGGGCAGG + Intergenic
1049340416 8:142109383-142109405 TCTGGGGTCTCTAGAGGGGCTGG + Intergenic
1049957978 9:711130-711152 AGTGAGGTCTCCAGAGGGGGAGG - Exonic
1051675176 9:19551700-19551722 ACAGAGGTGGCATGAGGGGCAGG + Intronic
1052834497 9:33240484-33240506 ACTGAGGCCCCAAGAGGGTAGGG - Intronic
1059534780 9:115070451-115070473 ACTGAGGTCAGAGGATGGGCTGG + Intronic
1060456515 9:123803616-123803638 TCTGAGTTGGCAAGAGGGGATGG - Intronic
1061453732 9:130682413-130682435 ACTGAGGCCCAAAGAGGTGCAGG - Exonic
1061668644 9:132175340-132175362 TCTGAAGGAGCAAGAGGGGCAGG + Intronic
1061808350 9:133148785-133148807 ACTGAGGACAGGAGAGGGGCAGG - Intronic
1062395212 9:136350041-136350063 ACTGAGGCCCAAAGAGAGGCGGG - Intronic
1062569478 9:137178526-137178548 CCTGAGGCAGCCAGAGGGGCAGG + Intronic
1203572116 Un_KI270744v1:141089-141111 ACTGATGTGGCAAGAGTGACAGG + Intergenic
1186260378 X:7772159-7772181 GCTGAGGTGGCAAGAGTTGCAGG - Intergenic
1188110695 X:26193558-26193580 ACTGAGGTGACAGCAGGGGCTGG - Intronic
1189105982 X:38235692-38235714 ACTGAGGTTGCAGGAGGGACAGG - Intronic
1191670257 X:63742257-63742279 ACTGAGGTCTAAGGAGAGGCAGG - Intronic
1191842715 X:65524584-65524606 ACTGAGGTCCAGAGAGGGGAAGG - Exonic
1192690178 X:73354219-73354241 GCTGGGGTCCCAAGAGAGGCTGG + Intergenic
1198035606 X:132798322-132798344 ACTGAGGTCCCAAGAGGAACAGG + Intronic
1199743513 X:150757458-150757480 CCTGAGGTCGTAAGGGTGGCAGG - Intronic
1200068134 X:153514707-153514729 ATGGAGGACCCAAGAGGGGCTGG + Intergenic
1200281543 X:154781173-154781195 ACTGAGGTCCCAGTATGGGCAGG + Intronic
1201454307 Y:14151943-14151965 GCTGAGGTGGCAAGAGTTGCAGG + Intergenic