ID: 950579677

View in Genome Browser
Species Human (GRCh38)
Location 3:13854038-13854060
Sequence GCCCCAGGATGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950579677_950579685 15 Left 950579677 3:13854038-13854060 CCCCCAGGACACCATCCTGGGGC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 950579685 3:13854076-13854098 TTCCCCTGTGTGACTCACCAAGG 0: 1
1: 0
2: 1
3: 13
4: 177
950579677_950579689 27 Left 950579677 3:13854038-13854060 CCCCCAGGACACCATCCTGGGGC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 950579689 3:13854088-13854110 ACTCACCAAGGCCACCTGTGAGG 0: 1
1: 0
2: 4
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950579677 Original CRISPR GCCCCAGGATGGTGTCCTGG GGG (reversed) Intronic
900093769 1:931973-931995 GCCCCAGGAAGCTGGCCTTGTGG - Intronic
900563852 1:3322818-3322840 GCCCCAGGATGGGGACAGGGAGG + Intronic
900642863 1:3695643-3695665 GCCCCAGGGCCCTGTCCTGGAGG - Intronic
900838891 1:5031153-5031175 TCCCCAGGAGGCTGACCTGGAGG - Intergenic
902551199 1:17220619-17220641 GACCTTGGGTGGTGTCCTGGTGG + Intronic
902874738 1:19334031-19334053 GTCCCAGGCTGGGGGCCTGGAGG - Intergenic
903035749 1:20491574-20491596 ACCACAGGAGTGTGTCCTGGGGG + Intergenic
903243289 1:21998454-21998476 GCATCTGGATGGTGTCCTGATGG - Intronic
903476702 1:23624389-23624411 TCCCCAGAATGGTGTGCTGCAGG - Intronic
903760590 1:25695444-25695466 GCCCCATGGTGGTCTCCTTGTGG + Intronic
904214805 1:28910899-28910921 GCCCCAGGATGGGGTCCCTAAGG - Intronic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
906052648 1:42887703-42887725 GCCCCAGGAGCGTGTGCGGGAGG - Intergenic
906204262 1:43978938-43978960 TCCCCAGGAAGGGGACCTGGAGG - Intronic
906701100 1:47858845-47858867 TCCTCAGGATGGCGGCCTGGTGG + Intronic
907300026 1:53481273-53481295 GCCCCAGGAGGCTGACCTGTGGG - Intergenic
909742333 1:79045645-79045667 GGCCCAGGATGGGGACGTGGTGG + Intergenic
910050892 1:82973178-82973200 GGCCCAGGATGGGGTTGTGGTGG - Intergenic
912558457 1:110533281-110533303 GCTCCAGGATGGCAGCCTGGAGG - Intergenic
914224325 1:145707716-145707738 ACCCCAGGATGGGGGACTGGAGG - Intronic
915163424 1:153934883-153934905 GCTCCGGAATGTTGTCCTGGGGG - Exonic
916655925 1:166875738-166875760 GCCCCTGGAGGGCTTCCTGGAGG - Intronic
918792452 1:188846774-188846796 GCCCCATGGTGGTGTCCAGGTGG + Intergenic
918813308 1:189149710-189149732 GGCCCAGGATGGGGGCGTGGTGG - Intergenic
921187466 1:212682957-212682979 TCCACAGGAGGGTGTGCTGGGGG - Intergenic
921840542 1:219823510-219823532 GCTCCACTATGGTGCCCTGGTGG + Intronic
923634232 1:235679648-235679670 GCCCCAGGCTGGTGTGGTAGTGG - Intronic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1062816278 10:503211-503233 TCCGCAGGTCGGTGTCCTGGCGG - Intronic
1063443096 10:6089212-6089234 GCCCCGGGTGGGTGGCCTGGCGG + Intronic
1065811381 10:29447048-29447070 TCCCCAGGATGGTGCCCAGAGGG + Intergenic
1065857512 10:29842295-29842317 TCCCCAGGCTGGTGGCCAGGGGG + Intergenic
1066212300 10:33252022-33252044 GGCCCAGGATGGGGGCGTGGTGG - Intronic
1066649088 10:37638785-37638807 GGCCAAGGATGGAGTCCTGCTGG + Intergenic
1067088926 10:43256831-43256853 GCCCCAAGATGGACTCCTGCCGG - Intronic
1067473299 10:46550994-46551016 GCCCTAGGGTGGGGTCCTGGAGG + Intronic
1068134636 10:52939872-52939894 GGCCCAGGATGGGGTCGTGGTGG - Intergenic
1069933709 10:71900843-71900865 GACCCAGCATGGTAGCCTGGGGG + Intergenic
1070725308 10:78783664-78783686 GCACCAGGAGGGAGCCCTGGAGG - Intergenic
1071664204 10:87538009-87538031 TGCCCAGGCTGGTCTCCTGGTGG + Intronic
1072782298 10:98259170-98259192 TCCCCAGGCAGGTGACCTGGTGG + Exonic
1075686464 10:124368118-124368140 GCCCCAGGCTGTGGTCCTCGGGG - Intergenic
1075725252 10:124607660-124607682 GTCCAAGGAGGGGGTCCTGGGGG + Intronic
1076735902 10:132458797-132458819 GCTCCAGGGTGGTTTCCAGGGGG - Intergenic
1076917921 10:133433608-133433630 GTCCCAGGTTGGTGTCCCCGGGG - Intergenic
1076937919 10:133577685-133577707 GTCCCAGGTTGGTGTCCCCGGGG - Intergenic
1077075391 11:698906-698928 GCCTCTGGGTGCTGTCCTGGAGG - Intronic
1077178036 11:1199427-1199449 GCACCAGGATGGGCTCGTGGTGG + Intronic
1077409300 11:2396015-2396037 GCCCCTGGGTGGGGTCCTAGGGG + Intronic
1077492083 11:2866090-2866112 GCCTCAGAATGGAGTCCTGGGGG + Intergenic
1078743952 11:14093278-14093300 ACCACATGAGGGTGTCCTGGAGG + Intronic
1079318647 11:19431370-19431392 GCCGCAGGAGGAGGTCCTGGGGG + Intronic
1079333329 11:19551120-19551142 GCCCTTGCATGCTGTCCTGGGGG + Intronic
1079481295 11:20883167-20883189 GCATCAGGATGGTGTCTTTGTGG + Intronic
1081127860 11:39342094-39342116 GGGCCAGGATGGTGTTCTGTTGG + Intergenic
1083572930 11:63769477-63769499 GCCCCAGGATGGAAGCCGGGAGG + Intergenic
1083637739 11:64129509-64129531 CCCCCAGGAGGCTGTGCTGGGGG - Intronic
1083936662 11:65872990-65873012 GCCCCAGGATCGAGCACTGGGGG - Intronic
1090265466 11:125350679-125350701 GCCCCAGGGTGGCTGCCTGGAGG - Intronic
1090740466 11:129654841-129654863 GCCCAAGGATAGTGCACTGGTGG - Intergenic
1090770067 11:129912135-129912157 GCACCTGGATGGCGTGCTGGGGG + Exonic
1091281224 11:134382977-134382999 GCACCAGGAGGGTGTCCGTGTGG - Exonic
1091327645 11:134703129-134703151 GGCTCTGGGTGGTGTCCTGGAGG + Intergenic
1092907616 12:13116305-13116327 GGCCCAGGCTGGTGTCCCTGTGG - Intronic
1094169732 12:27479357-27479379 GCCCCAGGATGGTGCTCAGGTGG + Intronic
1094498175 12:31002211-31002233 GCTGCAGGATGGGGCCCTGGAGG + Intergenic
1096550709 12:52369982-52370004 TTCCCAGGATGCTGTCCAGGTGG + Intergenic
1096553847 12:52391256-52391278 GTCCCTGGTGGGTGTCCTGGAGG + Intergenic
1096587204 12:52630455-52630477 CCTCCAGGATGGTGTCTTGCAGG + Intergenic
1100722340 12:97372286-97372308 GCCCCAGGATGGAGACATGGAGG + Intergenic
1101995961 12:109524990-109525012 GCCCTTTGATTGTGTCCTGGTGG + Intronic
1102326055 12:111985628-111985650 CACCCAGGCTGGTGTCATGGCGG + Intronic
1103415154 12:120738399-120738421 CCCCCAGGATGCTGTCCTTGGGG - Exonic
1104569665 12:129914065-129914087 GCCCCAGGATGGAGAACTAGAGG + Intergenic
1105323088 13:19346042-19346064 GACCCAAGATGAAGTCCTGGAGG - Intergenic
1105532267 13:21230697-21230719 GCCCCAGGTGGATGTCCTGAAGG - Intergenic
1107423313 13:40269679-40269701 AGCCCAGGAGGGTGGCCTGGTGG - Intergenic
1107993438 13:45838550-45838572 CCCCCAGCGTGGTGGCCTGGGGG - Intronic
1110457319 13:75704141-75704163 GCCCCAGGCTGGTATACAGGAGG - Intronic
1110833130 13:80054271-80054293 GACCCAGGAGGGTGTCCCTGAGG + Intergenic
1110835124 13:80074409-80074431 GGCCCAGGATGGGGGCATGGCGG - Intergenic
1111217182 13:85159531-85159553 GGCACAGGATGGGGGCCTGGTGG - Intergenic
1113711254 13:112466853-112466875 GCGCTGGGCTGGTGTCCTGGGGG - Intergenic
1113867538 13:113537060-113537082 GCACCTGGGTGTTGTCCTGGCGG + Intronic
1117394822 14:55298688-55298710 GCCGCTGGATGGCCTCCTGGAGG - Intronic
1119595359 14:75927954-75927976 GCAACAGGATGGTGTCAGGGAGG - Intronic
1119650169 14:76377449-76377471 GCCCCCGGCGGGTGTCCCGGAGG + Intronic
1119734789 14:76974979-76975001 GCCCCAGGATGGTCTCCCTCTGG - Intergenic
1121112393 14:91321203-91321225 GCCCCTGGATGGTGCTCTGGAGG + Exonic
1121529330 14:94641419-94641441 GCCCAGGGCTGCTGTCCTGGGGG - Intergenic
1121532194 14:94662811-94662833 GACCCAGTATGGTGTCCAGAAGG + Intergenic
1122113241 14:99515754-99515776 GCCCCAGCCTGGTGGGCTGGAGG + Intronic
1122343615 14:101044702-101044724 GCCCCAGGAGGGCTTCCTGGAGG + Intergenic
1122366462 14:101197610-101197632 GCTCCAGGAGGGCTTCCTGGAGG + Intergenic
1124237275 15:28001763-28001785 GCCCCAGAATGTGGTGCTGGAGG + Intronic
1125212983 15:37238152-37238174 GGACCAGGATCGTGTCCTGTAGG - Intergenic
1125519776 15:40341166-40341188 GGCCCAGGCTGGGGTCCTGCTGG - Intergenic
1126745067 15:51817836-51817858 GGCCCAGGATGGGGGCGTGGCGG + Intergenic
1126846623 15:52766377-52766399 TCCCCAGGATGGTGAAATGGGGG + Intronic
1129937497 15:79463114-79463136 GCCCAAAGATGGCTTCCTGGTGG + Exonic
1130220281 15:82013575-82013597 GCTCTAGAATGGTCTCCTGGGGG + Intergenic
1130541400 15:84822965-84822987 CCCCCAGGCTGGTGTGCTGTGGG + Intronic
1130872881 15:87985205-87985227 GCTTCAGCATGGTGTCCTGTTGG - Intronic
1131028509 15:89166251-89166273 GCCCCAGCTTGGTGTTTTGGTGG - Intronic
1131047291 15:89324148-89324170 GCCCCAGGAGGCCGGCCTGGCGG - Exonic
1132116177 15:99138039-99138061 TCCCCAGCAGGGTGTCCTGAGGG + Exonic
1132295687 15:100732582-100732604 GCCCCAGCATGCTGTGTTGGTGG + Intergenic
1132552665 16:559914-559936 GCCCCTGGGGGCTGTCCTGGGGG - Intergenic
1132666213 16:1082418-1082440 GCCCCATGCTGGTGCCCTGCAGG - Intergenic
1132744835 16:1432261-1432283 GGCCCAGGATGGTGACTGGGTGG - Intergenic
1132804067 16:1767644-1767666 GCCTCAGGGTGGAGTCCAGGCGG - Exonic
1133320590 16:4911008-4911030 GCCAGAGGATGGGGTGCTGGTGG - Intronic
1133767593 16:8848693-8848715 GCCCCTGGCTGGCTTCCTGGAGG + Exonic
1134268392 16:12711662-12711684 CCCCCATGATGGTGCCCTTGGGG + Intronic
1134301580 16:12996415-12996437 GGCTCAGGAGGGTGTTCTGGGGG - Intronic
1134536053 16:15027818-15027840 GGCCCAGGATGGTGGTGTGGTGG + Intronic
1134685367 16:16154779-16154801 GGAACAGGATGGGGTCCTGGCGG + Exonic
1135221909 16:20621333-20621355 GGCCCAGGGTAGGGTCCTGGGGG + Intronic
1136381657 16:29898892-29898914 GCCCCAGGAAGGCGTCCAGCGGG - Intronic
1136615238 16:31394411-31394433 ACCCCAGGGAGGTGTCCTGGAGG + Intronic
1136747513 16:32604757-32604779 CACCCAGGATGGTGTCCCAGTGG + Intergenic
1141435694 16:83998555-83998577 ACCCCAGCAAGGAGTCCTGGGGG - Intronic
1141663499 16:85453977-85453999 GCCCCAGGAAGGAGACTTGGGGG + Intergenic
1141664237 16:85457664-85457686 GCCCCAGGAAGGAGACTTGGGGG + Intergenic
1141729067 16:85809773-85809795 GCCCGAGGGTGGGCTCCTGGGGG + Intergenic
1141851653 16:86650239-86650261 GTCCCAGGAGTGTGTTCTGGGGG + Intergenic
1142222089 16:88860545-88860567 GCCCCAAGACAGTGTCCTGGTGG - Intronic
1203049648 16_KI270728v1_random:863962-863984 CACCCAGGATGGTGTCCCAGTGG + Intergenic
1143026676 17:3945214-3945236 ACCCCAGGGTGGGGTCCTGCAGG + Intronic
1143462046 17:7110049-7110071 TCCCCAGGATGTGGTCCTGCTGG - Intronic
1143477363 17:7210617-7210639 GCCCCAGAATTGAGACCTGGGGG + Intronic
1143781601 17:9232222-9232244 CCCCCAGGCTGCTGTGCTGGAGG + Intronic
1144071000 17:11671121-11671143 GCCCCAGGATGGAGCACTGTTGG + Intronic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1144654936 17:17029378-17029400 GCTCCAGGAAAGCGTCCTGGTGG + Intergenic
1144662338 17:17079350-17079372 GCTCCAGGGTAGTGTACTGGAGG + Intronic
1144664146 17:17090797-17090819 GCCACAGGTTGGAGACCTGGTGG + Intronic
1146503385 17:33383645-33383667 GGCCCAGGGTGGGGCCCTGGTGG - Intronic
1146749732 17:35367889-35367911 GCCCCAGGATCTAGTCCTGCAGG + Intronic
1147418085 17:40307979-40308001 GCCCCAGGGTGGAGTCCATGGGG - Intergenic
1147674028 17:42192727-42192749 GACCCAGCAAGGTGGCCTGGAGG + Exonic
1147675460 17:42202269-42202291 GCCCCAGGCTGGACCCCTGGAGG - Intronic
1147690101 17:42309532-42309554 GCCCCAGGCTGGACTCCTGGAGG + Intronic
1148127669 17:45245254-45245276 GTCCCTGGACAGTGTCCTGGCGG + Exonic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148674963 17:49439760-49439782 GTCCCAGGAAGGCTTCCTGGAGG - Intronic
1149650048 17:58271099-58271121 CCTCCAGCATGGTGCCCTGGAGG - Intronic
1151800958 17:76379467-76379489 GTCCCAGGCCTGTGTCCTGGTGG - Intronic
1152067927 17:78121658-78121680 GCCCCAGGAGCGTGTGCGGGAGG - Exonic
1152111275 17:78359032-78359054 GGCGCAGGCTGGTGTCCAGGGGG + Exonic
1152457987 17:80426996-80427018 GCCCGAAGGTGGTGGCCTGGGGG - Intronic
1152740125 17:82015074-82015096 GCCCCAGCTTGGTGACCGGGTGG + Exonic
1152760108 17:82103313-82103335 GCCCCCTGCTGGGGTCCTGGGGG + Intronic
1152903426 17:82957974-82957996 ACCCCAGGCTGCTGTCCCGGGGG + Intronic
1153685630 18:7542054-7542076 TCCTCAGGTTGTTGTCCTGGTGG - Intergenic
1154352052 18:13592000-13592022 GACCCAGGGTGATGTCCTTGTGG - Intronic
1157311867 18:46559115-46559137 GCCGCAAGATGGTGTCTTGGGGG - Intronic
1157570423 18:48708766-48708788 GGTCCAGGGTGGTGTGCTGGGGG - Intronic
1158425248 18:57334153-57334175 GGCCCAGGGTGCTGTGCTGGAGG + Intergenic
1159949102 18:74466810-74466832 GCCCCAGGAGGTGGTACTGGAGG - Intergenic
1160227646 18:77023738-77023760 TCCCCAGGGTGGGGACCTGGAGG - Intronic
1160782548 19:884304-884326 GCCCCAGGATTTTGTGCCGGAGG + Intronic
1160874266 19:1289985-1290007 GCCTGAGGGTGGGGTCCTGGAGG + Intronic
1160957036 19:1698579-1698601 GCCCCTGGACAGTGTCCTGAAGG - Intergenic
1161140681 19:2645956-2645978 GCCCCTGGATGGGGTCAGGGTGG - Intronic
1161231964 19:3178912-3178934 GCCGGAGGATGGCGGCCTGGGGG + Exonic
1161333610 19:3699728-3699750 GCCCCACCAGTGTGTCCTGGGGG + Intronic
1162898218 19:13778179-13778201 TCCTCAGGAAGGTGTCTTGGAGG - Exonic
1163143491 19:15365422-15365444 ACCCCAGTGTGGTGGCCTGGGGG - Intronic
1163403975 19:17111079-17111101 GGCCCAGGCAGGTGTCCTTGAGG - Intronic
1163843682 19:19627176-19627198 GCCCAAGGATGTGGTCGTGGTGG - Exonic
1164674919 19:30094638-30094660 GCCCCAGCATGATGTAGTGGAGG + Intergenic
1165661055 19:37580560-37580582 TCCCCAGTATGGCGTCTTGGGGG + Intronic
1166246298 19:41529434-41529456 GTCTCAAGCTGGTGTCCTGGAGG - Intergenic
1166872509 19:45879356-45879378 GCCCCAGGAAGCTTTCCGGGTGG + Intergenic
1167144678 19:47674679-47674701 GCCACAGGAATGAGTCCTGGTGG - Intronic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1167510956 19:49895165-49895187 CCTCCAGGATGGTGACCTGAGGG + Exonic
1168252761 19:55149738-55149760 TCACCAGGATGGAATCCTGGCGG - Intergenic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925898386 2:8490406-8490428 GACCCAGGAAGGCTTCCTGGAGG + Intergenic
926247765 2:11133396-11133418 GACCGAGGCTGGTGGCCTGGTGG - Exonic
926799392 2:16646246-16646268 GCCACAGGGTAGTGGCCTGGTGG - Intronic
927518007 2:23683137-23683159 GGGCCAGGAAGGAGTCCTGGCGG + Intronic
928453923 2:31402508-31402530 GATCCAGGATGGCTTCCTGGAGG + Intronic
932447792 2:71791354-71791376 GCCCCAGGATGGAGCCCTTTGGG - Intergenic
932485176 2:72080419-72080441 GCCCCAGGGTGGTGGGCTGCAGG - Intergenic
932655921 2:73611106-73611128 GCCCATGGCTGGTGGCCTGGGGG - Intergenic
933258634 2:80107808-80107830 GCCCCATGGTGGTGCCCAGGTGG - Intronic
934559223 2:95303674-95303696 GCCTCAGAAGGGTGGCCTGGTGG - Intronic
934751474 2:96796896-96796918 TCACCAGGATGGGGTCATGGTGG - Intronic
934994961 2:98949479-98949501 GCCCCAAGAGGGAGTCCTTGGGG + Intergenic
935783852 2:106531542-106531564 GGGCCAGGATGATGTCCTGCAGG + Intergenic
936254541 2:110900645-110900667 GTCCCAGGATGGTCTCCTACAGG + Intronic
936585734 2:113756381-113756403 GCCCCGCGATGGCGTCGTGGCGG + Exonic
937134049 2:119537039-119537061 ACACCAGGATGGTGGCCAGGTGG + Intergenic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
937883623 2:126886054-126886076 GCCCAAGGATGGCTTCGTGGGGG + Intergenic
938110683 2:128562977-128562999 GCCCTGGGCTGGTGGCCTGGTGG - Intergenic
939017712 2:136920907-136920929 GCCCCAGAATGGTTGCCAGGAGG + Intronic
940445580 2:153772637-153772659 TCCCCAGGATGGCGTACTAGAGG - Intergenic
940751034 2:157628124-157628146 GCTCAAGGATGGTGGCATGGTGG - Intronic
940779935 2:157922401-157922423 GCCCCAGAATGGAGGCCTGTGGG - Intronic
941843133 2:170108982-170109004 GGCCCATGACAGTGTCCTGGAGG + Intergenic
944688400 2:202137840-202137862 GCCCCATGCTGGTGTCCGGGTGG + Intronic
944728402 2:202495537-202495559 GGCCCAGGATGGGGACATGGCGG + Intronic
946195233 2:218028755-218028777 GCACCAGGCTGGGGTCTTGGGGG + Intergenic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
947098545 2:226593423-226593445 TCCCCAGGATGGACTCTTGGTGG - Intergenic
947536124 2:230941388-230941410 AACCCAGGGTGGTATCCTGGGGG + Intronic
947551887 2:231052449-231052471 TTCCAAGGATGGTGTCCGGGAGG - Intergenic
948257641 2:236579399-236579421 GACCCAGGACTGTGGCCTGGAGG + Intronic
948464593 2:238146105-238146127 GCCCCAGGAGGGGTTCCTGCAGG + Intronic
949008051 2:241661410-241661432 GCCCCAGGAGGGAGTAGTGGGGG + Intronic
1169198578 20:3696745-3696767 GACCCAGGCTGGTGGCCAGGAGG + Exonic
1171947353 20:31390191-31390213 GGGCCAGGGTGGTATCCTGGTGG - Intronic
1172295990 20:33811531-33811553 GCCGCTGGATGGCCTCCTGGGGG - Exonic
1174485000 20:50855537-50855559 GTCCCAGGAAGGTCTCTTGGAGG - Intronic
1175870315 20:62206245-62206267 GCCCCGGGATGGAGGCCTGAAGG + Intergenic
1175895936 20:62335588-62335610 TACCCATGAGGGTGTCCTGGAGG - Intronic
1176150576 20:63588840-63588862 GCCCCAGGACCCTGGCCTGGAGG + Exonic
1178382353 21:32121352-32121374 GGCACTGGATGGTGTCCTGCAGG + Intergenic
1179120373 21:38539804-38539826 ACCCCAGGTTGGCGTCTTGGAGG + Intronic
1179573587 21:42292474-42292496 GCCCTAGGCAGGGGTCCTGGGGG - Intronic
1179803903 21:43825436-43825458 GCCCCTGGATCGAGTCCGGGTGG + Intergenic
1179954951 21:44733402-44733424 GCTTCAGGATGGGGTGCTGGTGG - Intergenic
1180159830 21:45994072-45994094 GCCACAGCATGCTGTCCAGGTGG - Intronic
1180701822 22:17785352-17785374 GCACCAGCTCGGTGTCCTGGCGG - Intergenic
1180705040 22:17804270-17804292 GCCCCAGGCTGAGGGCCTGGAGG + Intronic
1180840029 22:18954866-18954888 GGGCCAGGATGGTGTCTAGGAGG - Intergenic
1181061871 22:20285614-20285636 GGGCCAGGATGGTGTCTAGGAGG + Intergenic
1181082529 22:20424629-20424651 GCCCCAGGATGGGCTCCTCCCGG - Exonic
1181533350 22:23529637-23529659 GCAACAGGATGTTGTCTTGGCGG - Intergenic
1181573659 22:23781036-23781058 GCCCAGGGCTGGGGTCCTGGAGG - Exonic
1182512702 22:30830379-30830401 GCCCCAGGGCGCTGTCCAGGTGG - Intronic
1182727407 22:32459201-32459223 GGCCCAGGAAGGTGACCTTGTGG + Intronic
1184406920 22:44305605-44305627 GCCCAAGGCTGGTGTCCCGCAGG - Intronic
1184475111 22:44716125-44716147 TCCCCAGGAGTGTGTGCTGGGGG + Intronic
1184867402 22:47209355-47209377 GCCCCTGGCTGGTGGCCAGGAGG - Intergenic
1185040972 22:48504225-48504247 AACCCAGGGTGGCGTCCTGGGGG + Intronic
1185317206 22:50184366-50184388 TCCCCAGCACGGAGTCCTGGTGG + Intergenic
949901954 3:8822526-8822548 GTCCCTGGATTGTGTCCTAGAGG + Intronic
949968705 3:9383192-9383214 GCCCCAGGAGGGTTTGCTGTGGG - Exonic
950100077 3:10351291-10351313 GCTCCAGGCTGGTTTCCTCGGGG - Intronic
950446672 3:13042695-13042717 CCCCCAGGATGATGGACTGGGGG - Intronic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
950662918 3:14477763-14477785 GCCACAGGACCGAGTCCTGGTGG + Intronic
952031125 3:29143937-29143959 GCTCCAGGCTGGTGACCTGAAGG - Intergenic
952919382 3:38274610-38274632 GCGCCAGGATTGTGGCCTTGCGG - Exonic
954386817 3:50248481-50248503 GCCCCAGGATGGCATCTGGGTGG - Intronic
954388647 3:50257768-50257790 GCCCCAGCAGGGGGTTCTGGGGG + Intronic
954681774 3:52349861-52349883 GCCGCAGGATGTTGTGGTGGAGG + Intronic
954697953 3:52437430-52437452 GCCCCAGAAAGGGGTTCTGGGGG - Intronic
960161543 3:114355516-114355538 GCCTCAGCATTGTGTGCTGGAGG - Intronic
960936165 3:122904212-122904234 GCCCTAGGATGGGGTCAGGGAGG - Intergenic
961015368 3:123464412-123464434 CCACCAGGATCGTGTCCTGGTGG + Intergenic
961104596 3:124230350-124230372 GATCCAGGAAGGTCTCCTGGAGG - Intronic
962198102 3:133380418-133380440 GCCCCAGAGTGGGGTCCTGGGGG - Exonic
962978798 3:140469526-140469548 GACCCAGGATGGCTTCCTGGGGG - Intronic
964661581 3:159125823-159125845 GCCCCAGGTTGGTCCCCTGTAGG - Intronic
968199181 3:196737935-196737957 GTCCCAGGCTGGAGTTCTGGGGG - Intergenic
968497422 4:926409-926431 GCCCCAGGGAGGTGTCCTTAGGG - Intronic
968661164 4:1799390-1799412 GCCCTCGGAGCGTGTCCTGGTGG + Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968727179 4:2253180-2253202 GCCCGATGAATGTGTCCTGGAGG - Intronic
971153439 4:24058134-24058156 GCCCCAGAGGGGTGGCCTGGGGG + Intergenic
971434569 4:26606473-26606495 ACCCCAGGATGGAGTGGTGGAGG + Intronic
972311486 4:37887805-37887827 GGCCCAGGAAGGTGTTCTGTTGG - Intergenic
973543723 4:51959607-51959629 GCCCCAGGTTGGTGAGGTGGTGG + Intergenic
977536101 4:98258926-98258948 GGCCCAGGCTGGTCTTCTGGAGG + Intergenic
981018769 4:140003487-140003509 GGCCAAGGATGATGTCCTTGAGG + Intronic
982657706 4:158170514-158170536 GCCCCAGGATCCTGTCTAGGTGG + Exonic
985047357 4:185953479-185953501 GTCCCACCTTGGTGTCCTGGTGG - Intronic
985420232 4:189777909-189777931 GCCCCACTCTGGTGTCATGGCGG - Intergenic
985570075 5:639973-639995 TCCCTAGGCTGGTGTCCTGTGGG + Intronic
985781147 5:1872444-1872466 GCCCCAGGCTTGAGTCTTGGGGG - Intergenic
985832301 5:2242713-2242735 GCCCCAGGGTCCTGCCCTGGAGG + Intergenic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
989155382 5:38340010-38340032 ACCCCAGCCTGGTGTCCTGCAGG + Intronic
989195718 5:38714342-38714364 CCCACAGGGTGGTGTCCTGGGGG - Intergenic
989417371 5:41195441-41195463 GTGCCAGGGTGGGGTCCTGGAGG - Intronic
991002377 5:61795221-61795243 TCCCCAGGATGAACTCCTGGAGG + Intergenic
995329674 5:110933332-110933354 TCCCCAGGATGGAGTGCTTGGGG - Intergenic
996291089 5:121852620-121852642 GGCCCCGGATGCTGGCCTGGCGG + Exonic
997616368 5:135248956-135248978 GGCCCAGGATGGTGTGGAGGAGG + Intronic
997975349 5:138438843-138438865 GCCCTAGGCTGTTGTCGTGGAGG - Intergenic
999007333 5:147997054-147997076 TGCCCAGGATGGGGGCCTGGTGG + Intergenic
1002925319 6:1602359-1602381 GCCCCGGCATGGTGTCCTGGAGG + Intergenic
1003390420 6:5708463-5708485 GCCCCAGGCAGGTGTCCTGAAGG + Intronic
1004602474 6:17163541-17163563 AGCCCAGCATGGTGTCTTGGAGG - Intergenic
1005979726 6:30827808-30827830 TCCCTAGGATGGGGTGCTGGTGG + Intergenic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1007607166 6:43125382-43125404 GCCCCAGGAGTGGGTGCTGGAGG + Intronic
1007750281 6:44067054-44067076 TCCTCAGGAGGGTGGCCTGGTGG - Intergenic
1012437583 6:99230854-99230876 GCCCCAGAATGATGCCCTTGAGG + Intergenic
1018051870 6:160016279-160016301 TCCCCAGAATGTTGCCCTGGAGG + Intronic
1019140662 6:169940380-169940402 GCCCCAGGCTGAAGTACTGGGGG + Intergenic
1019468070 7:1201447-1201469 GGCCCAGGATGGGGGCATGGCGG - Intergenic
1019592940 7:1844687-1844709 GCCACAGCAGGATGTCCTGGGGG - Intronic
1020118119 7:5487716-5487738 GCCCCAGGCAGGCGCCCTGGAGG + Intronic
1020980193 7:15057279-15057301 GCCACTGCATGGTGTGCTGGTGG - Intergenic
1021627607 7:22609688-22609710 GCCCCAGGGTGGAGCCCTGAGGG - Intronic
1024118583 7:46215299-46215321 GCCCTGGGCTGGTGTCCTGCAGG - Intergenic
1024845109 7:53633709-53633731 GGCCCAGGATGGGGCCATGGTGG + Intergenic
1025820145 7:64955300-64955322 GGCCCAGGATGGGGGCATGGTGG - Intergenic
1026020444 7:66700991-66701013 GCCCAAGGAAGCCGTCCTGGAGG + Intronic
1026767098 7:73167008-73167030 GCACCAGGGTGGCTTCCTGGAGG - Intergenic
1027043567 7:74976719-74976741 GCACCAGGGTGGCTTCCTGGAGG - Intronic
1027080080 7:75225640-75225662 GCACCAGGGTGGCTTCCTGGAGG + Intergenic
1028346858 7:89793751-89793773 GGCACAGGATGGTGGCATGGCGG + Intergenic
1029389301 7:100264245-100264267 GCACCAGGGTGGCTTCCTGGAGG + Intronic
1029503893 7:100950467-100950489 GCTCCAGGATGTGGCCCTGGAGG - Intronic
1029608409 7:101613818-101613840 GCCCCAGGTTGATGTCCTCCTGG - Intronic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032979884 7:137269333-137269355 GCCCCAGAAGGGAGTCCTGGAGG + Intronic
1036088325 8:5637491-5637513 CCCCCAGGCTGGTCTCCTGGAGG - Intergenic
1036627526 8:10483937-10483959 GCCCCAGACTTGTGTCCAGGAGG + Intergenic
1039439431 8:37584471-37584493 GCTCCAGGGTGGTGGCCTGAGGG - Intergenic
1039498642 8:38000079-38000101 GCCCCAGGATGTTGACCTAAGGG + Intergenic
1040579779 8:48688358-48688380 GCAGCAGGAGGGTGTCCTGGCGG - Intergenic
1040787347 8:51181355-51181377 GGCCCAGGATGGGGGCATGGTGG - Intergenic
1042872495 8:73411339-73411361 GCCCCACGCAGGTGTCCTGAGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045635255 8:104178587-104178609 GCCACAGGATGGAATCTTGGGGG + Intronic
1047382105 8:124372958-124372980 GCCCCAGGTTGGGGGCCGGGTGG - Intergenic
1047667054 8:127103836-127103858 GGCACAAGATGGAGTCCTGGTGG + Intergenic
1049212734 8:141394224-141394246 GTACCAGGCTGGTGTCCAGGTGG + Intronic
1049426495 8:142540244-142540266 GCCCCAGGAGGGCTTCCTGGAGG + Intronic
1049494741 8:142924401-142924423 GCCCCAGGATCTTCTCCAGGCGG - Intergenic
1049604263 8:143521717-143521739 GCCCCAGGCAGGTGCACTGGTGG - Intronic
1052537201 9:29761977-29761999 GCTCCAGGCTGGTGTACTGGGGG - Intergenic
1052917242 9:33932780-33932802 GCCCAGTGATGGGGTCCTGGTGG + Intronic
1055611626 9:78031042-78031064 GGCCAAGGATGGTGGGCTGGGGG + Intronic
1056331035 9:85521496-85521518 GCCCCTGGAAGGCGTCCTGGTGG - Intergenic
1056925407 9:90830243-90830265 GCCTCAGGATGGCGCCGTGGAGG + Intronic
1057322921 9:94030872-94030894 GCCCCAGGACGTTGTCCGGCGGG + Intronic
1057346938 9:94259594-94259616 GGCCCAGTATGTTGACCTGGAGG + Intronic
1057716840 9:97502121-97502143 GCCCCGGGCTGGGGTCCTGGCGG + Intronic
1060219180 9:121755367-121755389 GCCCCAGGTGGGAGTCCTTGTGG + Intronic
1060936991 9:127521716-127521738 GTGCCAGGAAGGTGTCCTGCCGG - Intronic
1060944019 9:127559434-127559456 TCCCCAGGATGGGTGCCTGGAGG - Intronic
1061885116 9:133587490-133587512 GCCCCATGATGGAGGCCAGGAGG - Intergenic
1061987766 9:134139974-134139996 GCCCCCGGAAGGTGTCCAAGGGG - Intronic
1062258164 9:135640947-135640969 GCCCAGGGATGATGTCATGGAGG - Intergenic
1062337692 9:136079630-136079652 GCCCCAGGAAGGAGCTCTGGGGG - Intronic
1186514709 X:10158500-10158522 GCTCGAGGATGCTGTCCAGGTGG + Exonic
1188187007 X:27128374-27128396 GGCCCAGGATGGGGGCGTGGCGG + Intergenic
1189486972 X:41441999-41442021 GCCCCAGGAAGGTGTATTTGTGG + Intergenic
1189642329 X:43086163-43086185 GGCACAGGATGGGGTCATGGCGG + Intergenic
1192731316 X:73805118-73805140 GCAGCAGGAGGGTGTCCTGTTGG + Intergenic
1192809854 X:74537987-74538009 GCCCCAAGATGGAGGCATGGAGG + Intergenic
1193702547 X:84780452-84780474 GGCCCAGGATGGGGGCATGGCGG + Intergenic
1194298246 X:92154569-92154591 GGCCCAGGATGGAGGCATGGTGG - Intronic
1196008719 X:110863664-110863686 CCCAAATGATGGTGTCCTGGGGG - Intergenic
1196936436 X:120735314-120735336 GCACCAGAATGGGGACCTGGTGG + Intergenic
1197813405 X:130471101-130471123 TCTCCAGCATGGTGTCCAGGGGG - Intergenic
1198084308 X:133268134-133268156 CCCCCAGGACAGTGTGCTGGCGG - Intergenic
1200615855 Y:5379529-5379551 GGCCCAGGATGGAGGCATGGTGG - Intronic