ID: 950581077

View in Genome Browser
Species Human (GRCh38)
Location 3:13862513-13862535
Sequence GAAAATATACAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1095
Summary {0: 1, 1: 1, 2: 14, 3: 115, 4: 964}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950581077 Original CRISPR GAAAATATACAGATGGAAAA AGG Intronic
900871549 1:5307654-5307676 GCAAGTCTAAAGATGGAAAAAGG - Intergenic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
903082002 1:20818006-20818028 AAAAATATTCAGAAGGATAATGG - Intronic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
903758416 1:25680651-25680673 AATATTATTCAGATGGAAAAAGG - Intronic
904070224 1:27790057-27790079 GAAAATATTCAGAAAAAAAAAGG + Intronic
904082085 1:27878651-27878673 GGTAATATATAGATGTAAAAGGG - Intronic
904225807 1:29018158-29018180 CAAAATATAAAGAGAGAAAAAGG - Intronic
904944980 1:34192664-34192686 GAAAATAAACAGATTGACAGAGG + Intronic
905248810 1:36634027-36634049 GAAGATATACAAATGGTCAATGG - Intergenic
905502521 1:38450947-38450969 GAAAAGACACAGAGGGAAGATGG - Intergenic
906871251 1:49483965-49483987 GAAGACATACAAATGGCAAATGG + Intronic
907265269 1:53255571-53255593 CAACAGATACTGATGGAAAAAGG - Intronic
907514365 1:54984015-54984037 GAGAATGTACACATGTAAAAGGG - Intronic
907588456 1:55642900-55642922 GGAAATACACAGAGAGAAAAAGG + Intergenic
908033435 1:60026516-60026538 GAAAATAGAGAAATGGAAGAAGG + Intronic
908083849 1:60609438-60609460 GGAACTATTCAGATGGCAAAAGG - Intergenic
908191268 1:61705989-61706011 GAAAATATGAAACTGGAAAAGGG + Intronic
908238205 1:62167624-62167646 GAAAACAAACAAATGAAAAAAGG + Intergenic
908410090 1:63855495-63855517 AATAAGATACAGAGGGAAAAAGG - Intronic
908577782 1:65479160-65479182 GTAATTTTACAAATGGAAAAAGG + Intronic
908805677 1:67929032-67929054 GAAAATTGACAGATTGATAATGG + Intergenic
908927938 1:69279147-69279169 GAACATTTAAAGATAGAAAAAGG + Intergenic
909090810 1:71223067-71223089 TACAATATAAAGATGGAAATGGG + Intergenic
909272386 1:73640099-73640121 GTAAATATTCACAAGGAAAAAGG + Intergenic
909367921 1:74849857-74849879 GAAGAAATACAAATGGAAACAGG - Intergenic
909587363 1:77305113-77305135 GACAATATACAAATGGCAAACGG - Intronic
909612591 1:77568758-77568780 GAAAATATAAAGATGGGATTGGG - Intronic
909656416 1:78038429-78038451 GGAAATACAGAAATGGAAAATGG - Intronic
909855449 1:80523711-80523733 GAATATATCCAAAAGGAAAAAGG + Intergenic
910036010 1:82790146-82790168 GAAGATAGACAAATGGCAAATGG + Intergenic
910501888 1:87901544-87901566 TAAATTATAGAGATTGAAAATGG - Intergenic
910524867 1:88166038-88166060 GAAAATAAAGAGCTGGAAACAGG + Intergenic
910620773 1:89251343-89251365 GAAAACAAAGAGATGGACAAAGG + Intergenic
910863894 1:91769683-91769705 TAAAATACACACATGGAAACAGG - Intronic
911255329 1:95626807-95626829 TAAAATATACAGCAGGAAACAGG - Intergenic
911360177 1:96866063-96866085 AAACATATACAGAAGGAAGATGG - Intergenic
911425047 1:97698802-97698824 GAAAATTTATACATGGAAATGGG - Intronic
911497139 1:98645521-98645543 GAAGATATTCAAATGGCAAATGG + Intergenic
911716289 1:101137161-101137183 GAAAATAAACAGATATTAAAAGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
912105616 1:106269847-106269869 GAAGATATACAAATGGCAACAGG - Intergenic
912171497 1:107106030-107106052 GAAAGAATACAAATGGAAAAAGG - Intergenic
912610458 1:111037380-111037402 GAAAATGTACATATGCATAATGG + Intergenic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913035172 1:114957646-114957668 GAAGACATACAGATGGAAACAGG + Intronic
913269161 1:117075990-117076012 GAAAATATAAATAGGGGAAAAGG - Intronic
913348718 1:117833874-117833896 AAAAATACACAGCTGGAAAGTGG + Intergenic
913408619 1:118525226-118525248 GGAAAGATACAGATACAAAAAGG - Intergenic
913659812 1:120996636-120996658 GAAGATTTATGGATGGAAAAGGG - Intergenic
914011169 1:143779760-143779782 GAAGATTTATGGATGGAAAAGGG - Intergenic
914166665 1:145181370-145181392 GAAGATTTATGGATGGAAAAGGG + Intergenic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914392464 1:147234812-147234834 GAAACTATACAAATGAAATAAGG - Intronic
914406759 1:147382625-147382647 GAAAATATAAAGTTGGAAACAGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
914649792 1:149688415-149688437 GAAGATTTATGGATGGAAAAGGG - Intergenic
916082891 1:161247072-161247094 GAATATAAACAAATGGAGAATGG - Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917093787 1:171380435-171380457 GAATATATACATCTGGCAAATGG - Intergenic
917174735 1:172221063-172221085 GAAAAAATGAAGAAGGAAAAGGG - Intronic
917184598 1:172339313-172339335 GAAAATAAACAGAAATAAAAAGG - Intronic
918026351 1:180752427-180752449 GAAAAGATACAGATAAAAATAGG - Intronic
918237171 1:182591958-182591980 GAAAATATTAAGATAGAATAAGG + Intergenic
918454230 1:184690723-184690745 GAAAATATACGGCTGTAAATTGG + Exonic
918550776 1:185739806-185739828 GAAAATAAAAAGCAGGAAAAGGG + Intronic
918749492 1:188255084-188255106 GAAGATATACAAATGGCCAATGG - Intergenic
919102431 1:193111001-193111023 GACAATATACAAATGGGAAATGG - Intergenic
919141499 1:193578202-193578224 GAAAGTAGACAGATGAAAAAGGG - Intergenic
919644476 1:200080107-200080129 GAGAACAGACAGTTGGAAAAAGG + Intronic
920718352 1:208363090-208363112 GAATTTAGACAAATGGAAAAAGG - Intergenic
920910732 1:210213897-210213919 AAAAAGACAGAGATGGAAAATGG + Intergenic
921009119 1:211123633-211123655 GAAGACAGACAGATGGAGAAAGG + Intronic
921088833 1:211823491-211823513 GAAAATATACAGGGGTACAAGGG - Intronic
921277067 1:213531183-213531205 GAAAAGAAAGAGATGGAAACAGG - Intergenic
921295145 1:213694322-213694344 GAAAATAGAGAGAGGAAAAAAGG - Intergenic
921457248 1:215386833-215386855 GAAAATATACATATACACAATGG + Intergenic
921515751 1:216089077-216089099 AACAATATAGTGATGGAAAATGG - Exonic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
921694891 1:218197685-218197707 GAAAATATTTAAATGGAGAAAGG + Intergenic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
922299274 1:224281969-224281991 GAAAAAAGACAAATGGGAAAAGG + Intronic
922658075 1:227403008-227403030 TAAAGTAAAGAGATGGAAAAAGG + Intergenic
923356947 1:233166591-233166613 GGAGATATACAGATGGCAAATGG + Intronic
923800402 1:237203727-237203749 GAAAATATACATATATTAAATGG + Intronic
923901507 1:238330893-238330915 GAAGACATATACATGGAAAATGG - Intergenic
923945590 1:238883697-238883719 GAAAATCTGAAGATGTAAAAGGG + Intergenic
924053280 1:240098929-240098951 GAAAATATACAGTTGGATGAAGG + Intronic
1062887261 10:1026463-1026485 GAAAAAATAAAGGTGGCAAATGG + Intergenic
1062998250 10:1889296-1889318 GAGAATATATAGATAGAAAGAGG + Intergenic
1063302263 10:4860989-4861011 AAAATTATACAAATGGCAAAGGG - Intergenic
1063772256 10:9216956-9216978 CAAATTATACATATAGAAAATGG + Intergenic
1063940131 10:11120013-11120035 GAAAATTAACAGCTGGGAAATGG - Intronic
1064605899 10:17038392-17038414 TAAAATATACAGTGGGAGAAGGG - Intronic
1064938868 10:20710901-20710923 GAAGATTTAAGGATGGAAAAAGG + Intergenic
1065072639 10:22042102-22042124 AAAGATATACAGGTGAAAAATGG - Intergenic
1065278383 10:24109526-24109548 AAAAATGAACAGATGGAAACTGG + Intronic
1065757243 10:28942730-28942752 TAAAATATTCAGTTGGAAAATGG - Intergenic
1066368319 10:34798027-34798049 GAAAATATACAGACTGGATATGG + Intronic
1066707409 10:38196261-38196283 GCAAATATATAGTTGGTAAAAGG + Intergenic
1067034796 10:42905708-42905730 GAAAAAATACAGAAGATAAATGG + Intergenic
1067287883 10:44920771-44920793 GAAAATAAAAACATGCAAAATGG - Intronic
1067496552 10:46765818-46765840 ACAAACATACATATGGAAAAAGG + Intergenic
1067598103 10:47574584-47574606 ACAAACATACATATGGAAAAAGG - Intergenic
1067940964 10:50655534-50655556 GAAGATATATAGATAGAAGATGG - Intergenic
1068107630 10:52638848-52638870 CAAAAAATGAAGATGGAAAATGG - Intergenic
1068110946 10:52680425-52680447 GACAGTATCCATATGGAAAATGG - Intergenic
1068217888 10:54007137-54007159 GAAAATACACAGAAAGAAAAGGG - Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1068650699 10:59519559-59519581 GAAAATATGCCCAAGGAAAATGG - Intergenic
1068812063 10:61267232-61267254 TAAAATATAGAGATGGCAATTGG - Intergenic
1068904343 10:62306744-62306766 GAAGGTATTCAGCTGGAAAATGG + Intergenic
1069131946 10:64716016-64716038 TAAAATATTCAGAGGCAAAATGG - Intergenic
1069243974 10:66178721-66178743 AAAAAAATCCAGTTGGAAAATGG + Intronic
1069588313 10:69625310-69625332 GAAAGTAAAATGATGGAAAAAGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070053328 10:72910353-72910375 AAAAATACACAGATGTATAATGG + Intronic
1070062812 10:73001467-73001489 GAATATAGACAAAAGGAAAAGGG - Intergenic
1070435634 10:76389996-76390018 GTATATATACAGATTTAAAATGG + Intronic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1071161400 10:82749794-82749816 AAAAAAAAAAAGATGGAAAATGG + Intronic
1071351115 10:84746318-84746340 CAAATTATACAGAGAGAAAATGG - Intergenic
1071677925 10:87673946-87673968 GATAACATGCAGAAGGAAAAGGG - Intronic
1071870838 10:89792650-89792672 ACAAATAAATAGATGGAAAAAGG - Intergenic
1072084029 10:92060728-92060750 GAAGACATACAGATGGCAAACGG + Intronic
1072183769 10:93014889-93014911 AAAAATAAAGAGGTGGAAAAAGG - Intronic
1072391853 10:94995190-94995212 AAAAAAATTCAGAAGGAAAAAGG - Intergenic
1072437395 10:95426733-95426755 GAAAGGATACAGATTAAAAAAGG - Intronic
1072568507 10:96638281-96638303 GAAAGTATTCACATGGCAAAAGG - Intronic
1073728341 10:106260939-106260961 TAAAATAAAGAGATGGATAAAGG + Intergenic
1073733234 10:106316067-106316089 GAAAAAATAAAGATGAAATAAGG + Intergenic
1074315569 10:112358354-112358376 GAAAGTATACATATGGAAGGTGG - Intergenic
1074317702 10:112374443-112374465 GAAAAAAATCAGTTGGAAAAGGG + Intronic
1075173717 10:120140186-120140208 GAAAATATTCAGAATCAAAATGG - Intergenic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1075509562 10:123060086-123060108 TGAAATAAAGAGATGGAAAAAGG + Intergenic
1076019359 10:127058364-127058386 GAAAATAAAAGGATGGAAATAGG - Intronic
1076146005 10:128122541-128122563 CAAAATATACACAGAGAAAAAGG - Intronic
1077682753 11:4259673-4259695 GAAGACATACAAATGGCAAATGG - Intergenic
1077687286 11:4307080-4307102 GAAGACATACAAATGGCAAATGG + Intergenic
1077692448 11:4358257-4358279 GAAGACATACAAATGGCAAATGG + Intergenic
1078127251 11:8579831-8579853 GAAGACATACAAATGGCAAACGG + Intronic
1078263566 11:9735119-9735141 AAAAATATACAAATATAAAAAGG + Intronic
1078851347 11:15166896-15166918 GAAAATATAGAGGTGTAGAAAGG - Intronic
1079169843 11:18082560-18082582 GAAAATACAAATATGGAAAAGGG + Intronic
1079213094 11:18481257-18481279 GAAAATTAACAGATAAAAAATGG + Intronic
1079324890 11:19483312-19483334 GAAAAAATACACTGGGAAAATGG - Intronic
1080083620 11:28252235-28252257 GAAAATATAAAGAAGGGAAAGGG + Intronic
1080502556 11:32884715-32884737 GAAGATTTACAGACGGGAAAAGG - Intergenic
1080606074 11:33865986-33866008 GGAATTTTACAGATGGAAGAAGG - Intronic
1080806076 11:35655305-35655327 GAAAATATTCAGAAGGGAATTGG + Intergenic
1080976390 11:37345968-37345990 GAAAATATAAAGATAAAAGATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081282578 11:41227866-41227888 TAAAATATTCAGACAGAAAAAGG - Intronic
1082109144 11:48254474-48254496 GAAAATATACAATTTGAATATGG + Intergenic
1082686228 11:56242256-56242278 GAAGATGAACAGAAGGAAAAAGG + Intergenic
1083313920 11:61802543-61802565 GAAAACCTCCAGATGGAAGAAGG - Intronic
1084507620 11:69578681-69578703 GAAGATATACAGATGGCAATTGG - Intergenic
1084969286 11:72761418-72761440 GAAAATTTACAGAAACAAAATGG + Intronic
1085293410 11:75416436-75416458 GAAATAATCAAGATGGAAAATGG - Intronic
1085436330 11:76506705-76506727 GAAAATATACTGGTGGGAAGGGG + Intronic
1085772828 11:79340207-79340229 GAAGATATTGAGAAGGAAAATGG + Intronic
1085821580 11:79799271-79799293 TAAAATAGACAGGTGGAAATGGG - Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086497173 11:87416307-87416329 GAATATATACAAATGGCTAATGG + Intergenic
1087080622 11:94167842-94167864 GAAAAAATAAACATGGAAGAAGG + Intronic
1087416750 11:97866433-97866455 AAAAAAATACAGAATGAAAAAGG - Intergenic
1087449630 11:98302576-98302598 GGAAATATATACATTGAAAAGGG - Intergenic
1087646099 11:100810204-100810226 AAAAATATAAAGATAGTAAAGGG + Intronic
1087956223 11:104290946-104290968 GAATCTATACAGATTCAAAAAGG + Intergenic
1088003085 11:104906380-104906402 AAAAATATACAAATTAAAAATGG + Intergenic
1088206632 11:107399358-107399380 TAAAATAAAGGGATGGAAAAAGG + Intronic
1088306502 11:108415182-108415204 AAAAGTATACAGATTGAGAAGGG + Intronic
1088549525 11:110997589-110997611 GAAAAAATCCAGTTGGATAATGG + Intergenic
1088873806 11:113916252-113916274 GAAGATATACAGTTGGCAATTGG - Intronic
1088967041 11:114733885-114733907 GAAAATATACACATGGGACTGGG - Intergenic
1088999284 11:115037157-115037179 GAAGATTTATAGACGGAAAAAGG - Intergenic
1090519963 11:127468115-127468137 TAAAATACACCGTTGGAAAAGGG + Intergenic
1091530093 12:1346361-1346383 GGAGAAAAACAGATGGAAAAGGG - Intronic
1091997437 12:5004946-5004968 GAAAGTGAAGAGATGGAAAAAGG + Intergenic
1092015914 12:5157831-5157853 GAAAAGATAAAGAGGGAAAATGG + Intergenic
1092051888 12:5477058-5477080 GAAAAAATAAACATGAAAAAGGG + Intronic
1092460708 12:8683532-8683554 AAAGATATACAGATGGCAAATGG - Intronic
1092632883 12:10403009-10403031 AAAAATATGAAGATGAAAAATGG + Intronic
1092647955 12:10600061-10600083 TGAAATAAACAGATAGAAAAAGG - Intergenic
1092677527 12:10938464-10938486 GAAAAAAGACAGAGAGAAAATGG + Exonic
1093047008 12:14458383-14458405 ACAAATATATAGATGGAAAAGGG + Intronic
1093163983 12:15784353-15784375 GAAGATGTACAGATGAAAAGGGG + Intronic
1093196408 12:16134755-16134777 GAAAATACAGTGATAGAAAAAGG - Intergenic
1093265300 12:16996620-16996642 TAAAATCTAATGATGGAAAAGGG - Intergenic
1093601646 12:21033201-21033223 GAAAATGAAGAGTTGGAAAAAGG - Intronic
1093607727 12:21113190-21113212 GAAGACATACAAATGGCAAATGG - Intronic
1093668899 12:21848850-21848872 GAAAATATGCAGAAAGAGAAGGG + Intronic
1093718447 12:22410593-22410615 ACAAGTATACAGATGCAAAATGG - Intronic
1093890342 12:24512523-24512545 GCCAAGATACAGAGGGAAAAAGG - Intergenic
1094420029 12:30261014-30261036 GAAAATAATGAGATGGAAAAAGG + Intergenic
1094804920 12:34080661-34080683 GAAAATATATAGGTAGAAATTGG - Intergenic
1095116931 12:38365578-38365600 GAAAATATATAGGTAGAAATTGG - Intergenic
1095240830 12:39856883-39856905 GAAAATATAAATATGAAACAAGG - Intronic
1095347252 12:41165811-41165833 GAAGATATATAGAAGCAAAATGG + Intergenic
1095482319 12:42649332-42649354 GAAGATTTATGGATGGAAAAAGG + Intergenic
1095538567 12:43280995-43281017 AAAAATAGGCAGTTGGAAAAAGG - Intergenic
1095565163 12:43614478-43614500 GAAGACATACAAATGGCAAATGG - Intergenic
1096429480 12:51531361-51531383 GAACATACACAGCTGGAAAGGGG - Intergenic
1096683674 12:53273752-53273774 GAAAATATTCAGATGTGAGATGG - Intronic
1096713930 12:53479489-53479511 GAAACTACACAGATGGATCATGG - Exonic
1096898874 12:54853624-54853646 GAGAGTTTAGAGATGGAAAATGG - Intronic
1097579611 12:61438693-61438715 GAAAAAAAAAAGAGGGAAAAAGG - Intergenic
1097602638 12:61713307-61713329 GAAGATTTATAGACGGAAAAAGG - Intronic
1097807184 12:63978984-63979006 GATGATATACAAATGGCAAATGG - Intronic
1099054490 12:77822003-77822025 AAAAATACACATCTGGAAAAAGG - Intergenic
1099206564 12:79735270-79735292 GAAAAAATTCAAATTGAAAATGG + Intergenic
1099211546 12:79796091-79796113 GAAAATATATAGCTGGAAATTGG + Intronic
1099224159 12:79949242-79949264 GAAAATAATGAGAGGGAAAAGGG - Intergenic
1099243977 12:80172580-80172602 GAAAAAAATCAGATAGAAAAAGG - Intergenic
1099289921 12:80763801-80763823 AAATATAGTCAGATGGAAAATGG + Intergenic
1099339053 12:81403931-81403953 GATAAAGTACAGCTGGAAAAGGG - Intronic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1099796173 12:87402880-87402902 GGAAATTTACAGATAGTAAAGGG - Intergenic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100468253 12:94867895-94867917 GAGCATATACTGTTGGAAAATGG - Intergenic
1100657793 12:96666144-96666166 GCAAAAACAAAGATGGAAAAAGG + Intronic
1100788465 12:98104334-98104356 GAATAGAAAGAGATGGAAAAAGG - Intergenic
1100913518 12:99391689-99391711 GAAAATATATAGTTAGATAATGG - Intronic
1101289291 12:103351351-103351373 GAAGATTTACAGACCGAAAAGGG - Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102031489 12:109742427-109742449 GAAATTATACAGTTTAAAAAGGG - Intronic
1102310883 12:111843191-111843213 GGAAATCTGCAGTTGGAAAAAGG + Intronic
1102318274 12:111908042-111908064 GAAAACAAAGAGATGGAAAAAGG + Intergenic
1102434653 12:112911347-112911369 GGAAATAGAGGGATGGAAAAAGG + Intronic
1102754187 12:115323513-115323535 GAAAAGATAGAGAAAGAAAAAGG + Intergenic
1103403974 12:120661771-120661793 GGAGATAAACAGATGAAAAATGG - Intronic
1104244037 12:127019996-127020018 GAAAATAAAAAGATTTAAAAAGG - Intergenic
1104802819 12:131566311-131566333 TAAAATAAACAGAATGAAAATGG - Intergenic
1105271462 13:18879821-18879843 CAAAATATGTAGTTGGAAAAGGG - Intergenic
1106442105 13:29784663-29784685 AAAATTATAGAGATGGAGAATGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106937956 13:34745422-34745444 TAAAGTAAACAGGTGGAAAAAGG - Intergenic
1106963633 13:35032781-35032803 GAAGATATACAAATGGCAAATGG - Intronic
1107156332 13:37171680-37171702 GAAAATAAACAGATAAAAAAGGG - Intergenic
1107374476 13:39787016-39787038 AGAAATTTACAGATGGGAAATGG + Intronic
1107657643 13:42608208-42608230 GGATATATCCAGATAGAAAATGG + Intergenic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1108255703 13:48608820-48608842 GAAAATAGAGGGATGAAAAAAGG - Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108514894 13:51191753-51191775 CAAAATATCCAGTTGGAAAGGGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108830323 13:54469805-54469827 GAAAATATGCTGATGGGAGAGGG - Intergenic
1109235694 13:59815872-59815894 GAAAATGTAAAGATTGAAAAGGG - Intronic
1109357840 13:61254823-61254845 AAAAATATACTGATGGGCAAAGG + Intergenic
1109376822 13:61506280-61506302 GAAAACATACAAATGGCTAATGG + Intergenic
1109405161 13:61888139-61888161 GAAAATATACAATTAGACAATGG + Intergenic
1109919603 13:69038768-69038790 GAAATTATAAATATGGACAATGG + Intergenic
1109969634 13:69750884-69750906 GAAAAAATACATCTGGAATATGG + Intronic
1109991220 13:70060134-70060156 GAAGATATACAAATGGAAACAGG + Intronic
1110094272 13:71496700-71496722 GAATATATACAGATAAAAAAAGG + Intronic
1110769133 13:79317109-79317131 GAAAAGTTACAATTGGAAAAAGG + Intronic
1110960611 13:81619357-81619379 GAATATTTTCAGATGGAAATAGG + Intergenic
1111122901 13:83878206-83878228 GCAAATATGAAGCTGGAAAAAGG + Exonic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1111347865 13:86985688-86985710 GAAAACATACAGTTGGTCAAAGG + Intergenic
1111443580 13:88314168-88314190 GAAAAGAGACAAATTGAAAAGGG - Intergenic
1111499401 13:89095960-89095982 GAAAATTTACCGACAGAAAAAGG + Intergenic
1112125580 13:96463770-96463792 GAAAATAAACACAAGAAAAAAGG + Intronic
1112374997 13:98830843-98830865 TTAAATACAGAGATGGAAAAGGG + Intronic
1112392687 13:98999630-98999652 AAAATTATAAAAATGGAAAAGGG + Intronic
1112681593 13:101772958-101772980 AAAAATATATAGATAGCAAATGG + Intronic
1112708445 13:102099220-102099242 GAAGATAAATGGATGGAAAAAGG + Intronic
1113444916 13:110357823-110357845 GAAAGTAAAAAGATGTAAAATGG + Intronic
1113577448 13:111404277-111404299 GAAAATATAGAAAAGGAAGAAGG - Intergenic
1113924244 13:113931374-113931396 GAAAGTCTACAAATGGAAGAAGG - Intergenic
1114217910 14:20671132-20671154 GAAAACTAACAGAAGGAAAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115370653 14:32610337-32610359 GGAAAAATACATTTGGAAAAGGG - Intronic
1115381893 14:32749270-32749292 AAAAATTTACCAATGGAAAAAGG - Intronic
1115483046 14:33881127-33881149 GAGAATATAAAGCTGGATAAGGG + Intergenic
1115677035 14:35688301-35688323 GGAAAAATACAGCTGGGAAAAGG + Intronic
1115762280 14:36586771-36586793 AAAAATATATAGAAGTAAAATGG + Intergenic
1115813724 14:37139501-37139523 GAAAATATATGGAGGGATAAAGG - Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116290195 14:43024653-43024675 GAATATATACAGACGGTAAAAGG - Intergenic
1116413740 14:44655645-44655667 GCAAATATTCAGATGGGAAGAGG + Intergenic
1116467056 14:45245977-45245999 GTAAATGTGCAGATGGTAAATGG - Intronic
1116501099 14:45622972-45622994 AAATATATATAGATAGAAAATGG + Intergenic
1116672711 14:47863771-47863793 GAAACTGTACAGTTGGAAGAAGG + Intergenic
1116716542 14:48433317-48433339 GAAAGTATATTAATGGAAAAAGG - Intergenic
1116887473 14:50234835-50234857 GAAGACATACAAATGGCAAATGG + Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117368566 14:55054605-55054627 TAACTTCTACAGATGGAAAATGG + Intronic
1117549802 14:56823674-56823696 GACAAATTACAGAAGGAAAAAGG + Intergenic
1118263663 14:64272177-64272199 GAAGATGTACAAATGGCAAATGG - Intronic
1118450723 14:65899162-65899184 GCAATTATGCAGTTGGAAAAGGG + Intergenic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1119375124 14:74184727-74184749 GAAAATTGACAGATGAAAAGAGG - Intronic
1119399661 14:74354240-74354262 TCAGATATATAGATGGAAAAAGG + Intronic
1120036201 14:79701499-79701521 GAATACATAGAGAGGGAAAAGGG - Intronic
1120651297 14:87136310-87136332 GAAAAGAAAAAGAAGGAAAATGG - Intergenic
1121205751 14:92165601-92165623 GAACATAAACAAATTGAAAATGG - Exonic
1121402779 14:93695486-93695508 AATAATATACATATGGCAAATGG + Intronic
1121484406 14:94303621-94303643 GAAGATTTACAGACAGAAAAAGG - Intergenic
1121701937 14:95961348-95961370 GAAAAGAAAGAGATGGAAATTGG + Intergenic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1121805420 14:96816033-96816055 GAAAATGTACAGAAGGAACCTGG + Intronic
1122014943 14:98787355-98787377 GAAAAAAAAAAGATGGAGAAGGG - Intergenic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1122345623 14:101057780-101057802 AAAAATGGACAGATGGGAAAAGG - Intergenic
1123451465 15:20365198-20365220 AAAACTATACAGATTGCAAAAGG + Intergenic
1123461066 15:20472287-20472309 GAAAATCTAGAAATGGTAAAGGG + Intergenic
1123470301 15:20546254-20546276 GAAATGATTCAGAGGGAAAAAGG + Intergenic
1123647754 15:22454446-22454468 GAAATGATTCAGAGGGAAAAAGG - Intergenic
1123656993 15:22528093-22528115 GAAAATCTAGAAATGGTAAAGGG - Intergenic
1123828071 15:24103475-24103497 GAAAATATGAAGAAGGAACAAGG - Intergenic
1124123917 15:26918802-26918824 GAAAATGAAGGGATGGAAAAGGG - Intronic
1124228649 15:27920252-27920274 GAAAGGAAAAAGATGGAAAAAGG + Intronic
1124281113 15:28362540-28362562 GAAATGATTCAGAGGGAAAAAGG + Intergenic
1124301590 15:28549081-28549103 GAAATGATTCAGAGGGAAAAAGG - Intergenic
1124310905 15:28623269-28623291 GAAAATCTAGAAATGGTAAAGGG - Intergenic
1124947791 15:34286487-34286509 GAAATTTTAAAAATGGAAAATGG - Intronic
1125863632 15:43021685-43021707 GAAAATATTCAGGGGGAAAAAGG - Intronic
1126052489 15:44699021-44699043 GAAGACATACAAATGGCAAACGG - Intronic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126222791 15:46233906-46233928 CAAAATATGTAGTTGGAAAAGGG + Intergenic
1126491583 15:49242967-49242989 CAAAATACAAAGATGGAAAGTGG + Intronic
1126730593 15:51678080-51678102 GAAAATACAGATAAGGAAAAAGG - Intergenic
1126961804 15:54004783-54004805 GAATATATACAAACGGAAAATGG - Intergenic
1127006264 15:54573413-54573435 GAAAATAAACAAATCCAAAATGG + Intronic
1127173737 15:56330946-56330968 GAAAATAAAGAAATGGAAAAAGG + Intronic
1127216478 15:56828485-56828507 GAGATTATACAGAGGCAAAAAGG + Intronic
1127712626 15:61615200-61615222 GGAAACATACAGATGCTAAACGG + Intergenic
1128319748 15:66684901-66684923 GAAAATAAACAGACAGAAATAGG + Intronic
1128957730 15:71966207-71966229 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1129153495 15:73703539-73703561 GAAAATAGGAAGATGGAACAGGG + Intronic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1129482728 15:75840899-75840921 GAAAATATCCAGAGGCAGAAAGG - Intergenic
1131578206 15:93613528-93613550 GGAACTAAACAGATGGAAAAAGG + Intergenic
1132785266 16:1653514-1653536 TAAAATGTACAAATGAAAAAGGG - Intronic
1132899993 16:2248406-2248428 AAAAAAATAAAGATAGAAAATGG - Intronic
1133416902 16:5613895-5613917 GAAATTCTACAGGAGGAAAATGG - Intergenic
1133754043 16:8748866-8748888 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1134296767 16:12953058-12953080 GAAAAAATAAAGAAGGACAAAGG + Intronic
1134540819 16:15063827-15063849 GAAAATGGAAAGATGAAAAACGG - Intronic
1134861856 16:17567410-17567432 GGAAATATACAGAGTGAGAAAGG - Intergenic
1136263992 16:29103510-29103532 GAAAATGGAAAGATGAAAAATGG + Intergenic
1136296021 16:29302441-29302463 GACAATAAACATAAGGAAAAAGG - Intergenic
1137482359 16:48863223-48863245 AAAAATATAGTGATGGAAAACGG + Intergenic
1137587742 16:49674096-49674118 AAAAATAGGCAGGTGGAAAACGG + Intronic
1137869557 16:51936631-51936653 GAACATACAAAGATGCAAAAAGG - Intergenic
1137938829 16:52661162-52661184 TAAAGTAAATAGATGGAAAAAGG + Intergenic
1138764700 16:59587948-59587970 GAAGACATACAAATGGCAAACGG + Intergenic
1138806633 16:60097757-60097779 GAAAACAAAGGGATGGAAAAAGG - Intergenic
1138968960 16:62121505-62121527 TCAAATATACACATGGTAAAAGG - Intergenic
1139159785 16:64490547-64490569 AAAAATATACAGATATAAAAAGG + Intergenic
1139376799 16:66504128-66504150 GAAAATATACAAATGCAATGTGG - Intronic
1139835301 16:69833722-69833744 GAAAATATTCAGCTGGCAAGAGG - Intronic
1139868330 16:70082051-70082073 GAAAATAAACAACAGGAAAAGGG - Intergenic
1140024756 16:71276126-71276148 GAAGATTTATAGATAGAAAAAGG - Intergenic
1140024923 16:71278558-71278580 GAAAATATACACAATGAAACAGG + Intergenic
1140387001 16:74549810-74549832 GAAAATAAACAACAGGAAAAGGG + Intronic
1140621554 16:76740471-76740493 GAAAATATAAAGATACTAAATGG - Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1140888746 16:79267530-79267552 GAAGATACACAGAGGGATAATGG + Intergenic
1141110994 16:81270588-81270610 GAAAATATAGATAAGTAAAAAGG + Intronic
1141968651 16:87464653-87464675 GAAAATATACGGAGGAAAACAGG - Intronic
1142101940 16:88276628-88276650 GACAATAAACATAAGGAAAAAGG - Intergenic
1142649367 17:1337221-1337243 GAAAATATAGAGATGGCAAATGG + Intergenic
1142676725 17:1517940-1517962 GGATACATACAGCTGGAAAATGG + Exonic
1142801604 17:2349745-2349767 AACCATATACAGAAGGAAAAGGG - Intronic
1143825633 17:9604469-9604491 GAAGATATACAGATGGCAGCCGG + Intronic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144191043 17:12846104-12846126 AAAAAAATACAGCTGGCAAATGG + Intronic
1144427790 17:15160562-15160584 GCAAATTTCCAGATGAAAAATGG - Intergenic
1144647108 17:16982557-16982579 CAATATATTCAGATGGAATAAGG + Intergenic
1144820324 17:18068561-18068583 GAAAACATTCAGAATGAAAAAGG - Intergenic
1145043462 17:19594067-19594089 CAAAATATAAAGATGCCAAATGG - Intergenic
1145183893 17:20777547-20777569 GAAGATATGCAAATGGACAATGG - Intergenic
1145222685 17:21102288-21102310 GAAGATTTACAGACAGAAAAAGG + Intergenic
1145894725 17:28448304-28448326 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
1146641465 17:34544762-34544784 GGAAATCCTCAGATGGAAAAAGG + Intergenic
1146759282 17:35462074-35462096 GAAAATAAAATGATGGAAAAAGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148340224 17:46869015-46869037 GAAAATAAACAGAGGGAAACTGG + Intronic
1149190210 17:54051853-54051875 AAAAATATACAAATACAAAATGG + Intergenic
1149530868 17:57394183-57394205 GAAAAAAAACAATTGGAAAAAGG - Intronic
1150307812 17:64101091-64101113 GGAAAAATGCAGATAGAAAAAGG + Intronic
1151650365 17:75464562-75464584 GAAAAAATACACAGGGATAAGGG - Intronic
1153289996 18:3491812-3491834 AAAAATACACAGCTGGTAAAGGG + Intergenic
1153559271 18:6354644-6354666 GAAGACATACAAATGGCAAATGG + Intronic
1154279084 18:12985208-12985230 GACATAATACAAATGGAAAAGGG - Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155303812 18:24459164-24459186 TAAAATAGTCAGATGGAATATGG - Intergenic
1155373664 18:25132885-25132907 GGAAACATACAGATGCCAAACGG + Intronic
1155875485 18:31081588-31081610 GAATATATACAAAAAGAAAACGG + Intronic
1155937546 18:31769703-31769725 GAAGACATACACATGGCAAATGG + Intergenic
1156040532 18:32815655-32815677 GGAAATCTCCAGATTGAAAATGG + Intergenic
1156149687 18:34226354-34226376 GAAAATATAAATAAGGTAAAAGG - Intergenic
1156409508 18:36814393-36814415 AAATATATAAACATGGAAAAAGG + Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1156547059 18:37974296-37974318 GAAAATATAGCAATGTAAAAGGG + Intergenic
1156728944 18:40166235-40166257 GAAAATAAAAAGAAAGAAAATGG + Intergenic
1156877737 18:42036205-42036227 GAAAACAAAAACATGGAAAATGG - Intronic
1156972896 18:43178899-43178921 GAAAACATACAAATGGCAACAGG + Intergenic
1157057576 18:44249041-44249063 GAATGTATACAGTAGGAAAATGG + Intergenic
1157302090 18:46486380-46486402 GAAAAGTTACAGAGGCAAAAGGG - Intronic
1157510658 18:48269997-48270019 GAAAATAAAGTAATGGAAAAAGG + Intronic
1157633102 18:49120178-49120200 GAAAAAATGCAAATGAAAAAGGG + Intronic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158146291 18:54317015-54317037 GAAAAGATAATGATGGAAAAAGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158730939 18:60021824-60021846 CAAAATCTACAGAAGTAAAATGG + Intergenic
1159112248 18:64073031-64073053 GAAAAAAAAAAGATAGAAAAAGG - Intergenic
1159263567 18:66048868-66048890 GAAAATATAGAAAAGGAAACAGG - Intergenic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159666524 18:71168078-71168100 GAAATGAGTCAGATGGAAAATGG + Intergenic
1159710827 18:71757485-71757507 GAAGATATACAAATGGCAAAAGG + Intronic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161640012 19:5416400-5416422 GAGGAGATACAGATGGCAAATGG - Intergenic
1162240796 19:9352361-9352383 GAAAATATAAAGAAATAAAAGGG - Intronic
1165613858 19:37181315-37181337 AAAATTATACAGACAGAAAATGG + Intronic
1165935640 19:39386924-39386946 GAATAAATACAGATTGAATAAGG + Intronic
1166238222 19:41471873-41471895 CACAATATTCAGAGGGAAAAAGG - Intergenic
1166954497 19:46454278-46454300 GAAAAACAACAAATGGAAAACGG - Intergenic
1168486808 19:56770015-56770037 GAAATTTTACATTTGGAAAAAGG + Intergenic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168535312 19:57164093-57164115 GCAAATAGACACATCGAAAAAGG + Intronic
1168653496 19:58109867-58109889 GAGAATATAAAGATGGATGAAGG + Intronic
925093182 2:1171791-1171813 GATATTATACAGCTGGACAAAGG + Intronic
925634502 2:5929929-5929951 GAACAAATAGAGATGGAATAGGG + Intergenic
925914461 2:8595077-8595099 GAAAATATTCAGATGTGAACAGG - Intergenic
926453079 2:13029778-13029800 GAATATATACATATAGAAATGGG - Intergenic
926485516 2:13451117-13451139 AAAACTATACAGATTGCAAAAGG - Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926896700 2:17698574-17698596 GAAAGTAAAAGGATGGAAAATGG - Intronic
927091219 2:19714176-19714198 GGAGAAATACAGATGAAAAACGG + Intergenic
927239082 2:20903989-20904011 GTAGATATATAGTTGGAAAAGGG + Intergenic
927315760 2:21679791-21679813 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
927318322 2:21712314-21712336 GAAAATATTCAGAAGAAATATGG - Intergenic
927395467 2:22645819-22645841 GAAGAAATAAAGAAGGAAAAAGG + Intergenic
927441134 2:23118744-23118766 GAAATTACACAACTGGAAAATGG - Intergenic
927902920 2:26834568-26834590 TAAAAGATACAGATTGGAAAAGG + Intergenic
927987506 2:27422821-27422843 GAAGATATACAAATGGCTAACGG + Intergenic
928102187 2:28445527-28445549 GAAATGAGACACATGGAAAATGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929541048 2:42822217-42822239 GAAAATAAAGGGATGGAAAAAGG - Intergenic
930527832 2:52552858-52552880 GAAGATATACAAATGGCAACAGG + Intergenic
930626459 2:53703767-53703789 GAAAATATACAAATGAGAAAAGG + Intronic
930848109 2:55927171-55927193 GCAATAATACAGTTGGAAAATGG - Intergenic
930916841 2:56701982-56702004 GAAATTTTACCGATGCAAAAGGG + Intergenic
931037720 2:58261822-58261844 GAAGATTTACAGACAGAAAAAGG + Intergenic
931055856 2:58470322-58470344 GAAACTGGACAGGTGGAAAAGGG - Intergenic
931638058 2:64358413-64358435 GAAATTATACTGCTGGAAATCGG - Intergenic
931786765 2:65626205-65626227 AACAAGATACTGATGGAAAAGGG + Intergenic
931884003 2:66596062-66596084 GAATAAATAAAGTTGGAAAAAGG - Intergenic
932060066 2:68488068-68488090 GAAAAAATACAGTTTAAAAAAGG + Intronic
932646977 2:73512498-73512520 GAAAACATATAGATAGTAAATGG - Intronic
932881195 2:75503719-75503741 GATCATATGCAGATGGAAACTGG + Intronic
932946922 2:76245569-76245591 GATAATCTACATAAGGAAAAAGG - Intergenic
933346701 2:81095655-81095677 GAAAATATTCAAATGGGAAAGGG + Intergenic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
933994668 2:87659515-87659537 GAAAATAAACAGAGAGAAAGAGG - Intergenic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934071271 2:88385991-88386013 GAAAATATACAAATGGGGCAGGG + Intergenic
934206738 2:89937237-89937259 AAAAATATACAGTTTCAAAATGG - Intergenic
935464405 2:103379358-103379380 GAAAATAAATACATGGGAAATGG - Intergenic
935542753 2:104368942-104368964 GAAAAGAAACATAAGGAAAAGGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935799884 2:106685052-106685074 GAAAGTAAAAGGATGGAAAATGG - Intergenic
935870231 2:107440007-107440029 GAAAGCATGCACATGGAAAAGGG - Intergenic
936299188 2:111291398-111291420 GAAAATAAACAGAGAGAAAGAGG + Intergenic
936665843 2:114594448-114594470 GAACACATACATATGTAAAAGGG + Intronic
936672421 2:114672856-114672878 GAAAATCTGCATATGGAAGAAGG - Intronic
936743313 2:115542269-115542291 AAAATTATAGAAATGGAAAACGG - Intronic
936834948 2:116698168-116698190 GAAAAAATACATCTTGAAAATGG - Intergenic
936876857 2:117200570-117200592 GAAAAGACACAGAGGGAAATAGG - Intergenic
937539435 2:122930204-122930226 GAAAATTTATGGATAGAAAAAGG + Intergenic
937616643 2:123930943-123930965 AAAAATATAAAGTGGGAAAAGGG - Intergenic
937805402 2:126137121-126137143 AAAAATATCTAGATGGAATATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937889179 2:126923435-126923457 AAAAATACACAGAAAGAAAAGGG - Intergenic
938198592 2:129354645-129354667 GGAATTAGCCAGATGGAAAAGGG - Intergenic
938704366 2:133909016-133909038 GAAAGTAAAAGGATGGAAAATGG + Intergenic
938872307 2:135492328-135492350 GAAAATAAAAAGATGGTTAAAGG + Intronic
939470935 2:142618343-142618365 TAAAAAATAAAGATGGACAAAGG + Intergenic
939482279 2:142764006-142764028 GAAAGTAAAAAAATGGAAAAAGG + Intergenic
940108030 2:150120025-150120047 GAAAATTTACATTTGAAAAAGGG + Intergenic
940195438 2:151089215-151089237 GAAAATATAGGGACAGAAAAGGG - Intergenic
940559660 2:155279878-155279900 GAAAATACACAGACAGAAGAGGG - Intergenic
940785453 2:157976402-157976424 GAAGAGATACAAATGGCAAACGG - Intronic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
941177995 2:162223035-162223057 GTATATATATATATGGAAAATGG + Intronic
941185913 2:162321153-162321175 CAAAAAATATAGATGAAAAAAGG - Intronic
941210167 2:162628216-162628238 TAAAATGAACACATGGAAAAAGG + Intronic
941227939 2:162871593-162871615 GAAAATAAAGAGATGATAAAAGG + Intergenic
941255282 2:163221738-163221760 GAAAATTAAAAGAAGGAAAAGGG - Intergenic
941332089 2:164191125-164191147 GATAATATACATCTGGAAAATGG + Intergenic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
942257559 2:174119683-174119705 GAACACATAAAGATGGGAAAGGG + Intronic
942425934 2:175860693-175860715 GAAAGTACAAAGATGGGAAAAGG + Intergenic
942556038 2:177173309-177173331 GAAAATATCCAACTGGGAAATGG + Intergenic
942927605 2:181452589-181452611 GAAGATATACAAATGGCAAACGG - Intergenic
943453830 2:188078172-188078194 GACAATGTACAAATAGAAAAGGG + Intergenic
943467930 2:188253243-188253265 AAAAACAAAAAGATGGAAAAGGG + Intergenic
943766734 2:191671027-191671049 GCATATATACAAAGGGAAAATGG + Intergenic
943845334 2:192637930-192637952 GAAAATAATGGGATGGAAAAAGG + Intergenic
943872925 2:193025126-193025148 GAAAACAAAGAAATGGAAAAAGG + Intergenic
943935651 2:193912327-193912349 AAAAATATACATATGGACATAGG + Intergenic
943990429 2:194682870-194682892 GAAAAGGTAAAGATGGAGAAAGG + Intergenic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945050403 2:205818663-205818685 GAAAATATACTGATGTTGAATGG - Intergenic
945247981 2:207738146-207738168 GCAAATATATAGTTGGTAAAAGG + Intronic
945384006 2:209175214-209175236 GATAAAATAAAGAAGGAAAATGG + Intergenic
945601545 2:211872149-211872171 GAAAAAATACATATATAAAAAGG + Intronic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946591616 2:221255640-221255662 GAAATTATATATATGGAAAATGG + Intergenic
947519668 2:230835043-230835065 GAAATGATACAGATGAAAACAGG + Intergenic
948323726 2:237093831-237093853 AAAATTACAAAGATGGAAAAAGG - Intronic
948335981 2:237207367-237207389 GCAGATAAACAAATGGAAAATGG + Intergenic
948548571 2:238751551-238751573 GAAAATAAAGGGATGGAAAAGGG + Intergenic
1169231317 20:3890298-3890320 GCAAATAGACAGAAGGAAAACGG - Intronic
1169331119 20:4717209-4717231 GAAAATGTCCAAATGGAGAAAGG - Intergenic
1169430689 20:5533487-5533509 GAAAATATAGAAATGTTAAAAGG - Intergenic
1169617689 20:7468575-7468597 GAAAACAAAGGGATGGAAAAAGG - Intergenic
1169658932 20:7957061-7957083 CAAAATATAGAGAAAGAAAAAGG - Intergenic
1169944776 20:10977131-10977153 GAAAGGAAAGAGATGGAAAAGGG - Intergenic
1170286134 20:14711322-14711344 GAAAAACTACAGATCAAAAATGG - Intronic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1170444708 20:16414206-16414228 GAAAAGATGAAGATGGAACATGG + Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170778762 20:19404556-19404578 GAACAAATACAGAAGGAGAAAGG - Intronic
1171031662 20:21682150-21682172 AATCATATAGAGATGGAAAACGG - Intergenic
1172504169 20:35448960-35448982 GAAAATATCCAGCTGACAAAGGG + Intronic
1172974761 20:38897877-38897899 GAAGACATACAGATGGACAACGG - Intronic
1173235475 20:41241287-41241309 GAAGACATACAAATGGCAAACGG - Intronic
1173409865 20:42800729-42800751 GAAAAGACACAAATGGAAAGGGG + Intronic
1174310691 20:49651601-49651623 GAAGATAGATAGATAGAAAATGG + Intronic
1174333856 20:49843527-49843549 GAAAATATTCATATGAAAAAGGG + Intronic
1174394107 20:50235443-50235465 GAAAAAAAACAGATGAAAAATGG - Intergenic
1174405505 20:50300358-50300380 GAAAATATTCAGAAGTCAAAGGG - Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175631930 20:60547860-60547882 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1175821356 20:61910832-61910854 GAATATATAGACATTGAAAAGGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176546538 21:8204715-8204737 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1176554432 21:8248906-8248928 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1176565489 21:8387762-8387784 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1176573354 21:8431930-8431952 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1176912969 21:14590182-14590204 GAATATATAAAGATAGAAAAAGG - Intergenic
1177024354 21:15903926-15903948 GAAAATATACTCTTTGAAAAGGG + Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177221957 21:18206490-18206512 AAAAATAAAGAAATGGAAAAAGG - Intronic
1177403184 21:20632724-20632746 GAAAAAATAGAGAGGGAAGAGGG - Intergenic
1177441215 21:21128017-21128039 AAAAAAATACAAAGGGAAAATGG - Intronic
1177481884 21:21700722-21700744 TAAAAAATACCGATGCAAAATGG + Intergenic
1177534603 21:22407415-22407437 TAAAATAAAAAGATGGGAAAGGG + Intergenic
1177929224 21:27259526-27259548 GGAAATGTAAAGATGGAAACGGG + Intergenic
1178011257 21:28289698-28289720 GTAAATATACACATTGCAAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179180605 21:39041779-39041801 GAAAACAGACAAATGGAAAGAGG + Intergenic
1179638640 21:42732035-42732057 GAAGAAAGACAGATGGAACACGG - Intronic
1180715949 22:17872425-17872447 GAAAACACACACATGGAAGAAGG + Intronic
1181395367 22:22617657-22617679 GAAAATACACAGGTAGAAGATGG + Intergenic
1181506528 22:23362020-23362042 GAAAAGAGGAAGATGGAAAAAGG + Intergenic
1181581344 22:23829854-23829876 GCAAATCTACAGATAGAAAGTGG - Intronic
1181672410 22:24431879-24431901 GGAAATAAACAGATTTAAAATGG - Intronic
1181780274 22:25187420-25187442 GAAAACATTCATATGGAACATGG - Intronic
1183802460 22:40178588-40178610 AAAAATAAAAAGATAGAAAAAGG - Intronic
1184035608 22:41916486-41916508 GAAAAAACACAGATGAACAAAGG + Intergenic
1184317983 22:43713047-43713069 AAACATATGAAGATGGAAAATGG - Intronic
1185093341 22:48789498-48789520 GAAAAGAAACTGGTGGAAAAGGG + Intronic
1203251401 22_KI270733v1_random:120977-120999 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1203259447 22_KI270733v1_random:166051-166073 GAAAAGAGACAGATGGCGAAAGG - Intergenic
949096742 3:95389-95411 CAAAATCTAGAGATTGAAAAAGG - Intergenic
949256626 3:2055065-2055087 GAAAAAATACAGCTTGAAAAAGG - Intergenic
949411435 3:3769383-3769405 GAGAGAATAGAGATGGAAAAGGG - Intronic
949440813 3:4078231-4078253 CAAACTATGCAGATGGAAATGGG + Intronic
949557333 3:5166744-5166766 GAAATGAGACAAATGGAAAATGG - Intronic
949747888 3:7315934-7315956 GAAAAAATAGAGCAGGAAAAGGG + Intronic
950382913 3:12632514-12632536 GTAAAGATACAGATTGATAAAGG + Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
950999384 3:17540118-17540140 GAAAATATACAAATGGCAATTGG - Intronic
951113108 3:18829202-18829224 GAAAATATTCAGAATGAAAATGG - Intergenic
951255502 3:20444974-20444996 GAAGATATAGAAATGGCAAACGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951767810 3:26219437-26219459 GATAATAAAAAGATGGAAAGAGG + Intergenic
951778629 3:26338390-26338412 GAAGACATACAGATGGCCAATGG - Intergenic
951793513 3:26513038-26513060 GAAGACATACAAATGGCAAATGG - Intergenic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952534998 3:34300098-34300120 GAAAATATCCAGATGCCAAAAGG + Intergenic
952536460 3:34315243-34315265 GAAGACATACAAATGGAAACAGG - Intergenic
952974292 3:38681059-38681081 TACAATAAACTGATGGAAAAAGG + Intergenic
953250316 3:41240176-41240198 TAAAATAGACAAATAGAAAATGG + Exonic
953295991 3:41717452-41717474 GAAAATATACAAAAGAAAAGCGG - Intronic
953634093 3:44647746-44647768 AAAACTATAGAGATGAAAAATGG + Intronic
953762569 3:45701633-45701655 TAAACTACACACATGGAAAAGGG + Intronic
953830830 3:46296434-46296456 GAAAATAAATAGATGAGAAATGG - Intergenic
954784683 3:53084202-53084224 GAAAATATTCAGAGGGAAGCTGG - Intronic
955992897 3:64647185-64647207 AAAAAAATACACATGGAAATTGG - Intronic
956857581 3:73291071-73291093 GAAAATATACACATTAAAAGTGG - Intergenic
957087479 3:75695121-75695143 GAAAATAAAAGGATGGAAAAAGG + Intergenic
957546711 3:81647382-81647404 AAACATATTCAGATGGAGAAAGG - Intronic
957649340 3:82979808-82979830 GAAAATATATAGTTAGATAAAGG + Intergenic
957665944 3:83227169-83227191 GAAATTATACAAATTTAAAATGG + Intergenic
957684703 3:83486818-83486840 GAAAATTTTGAGATTGAAAATGG + Intergenic
958174830 3:89983869-89983891 GAAAACAAACGGATGGAAAAAGG - Intergenic
958501645 3:94918280-94918302 GAAGATATACCAATGGAAAAAGG - Intergenic
958630960 3:96683250-96683272 GAAAATAAAGGGATGAAAAAAGG - Intergenic
959005045 3:101010479-101010501 GAAAGTTTTCAGATGGAAATGGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959491016 3:106988884-106988906 GAAAGTATGCTGAAGGAAAATGG + Intergenic
959900635 3:111657671-111657693 GAACATATAAATATGGAATAAGG + Intronic
959956319 3:112242311-112242333 GAAAATATACATATACACAATGG + Intronic
960157888 3:114316626-114316648 TAAAATATACAGAGGGAGCAGGG - Intergenic
960187884 3:114666150-114666172 GGAAATAGACAAAGGGAAAAGGG - Intronic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
960803672 3:121562813-121562835 GAAAATATACTGAAACAAAAAGG - Intergenic
960979385 3:123208077-123208099 GAAGATAAAGAGAAGGAAAAAGG - Intronic
961073755 3:123962562-123962584 GAAAATATAGATAAGCAAAAAGG + Intergenic
961231511 3:125316208-125316230 GAAAATGTACATATGCACAATGG - Intronic
961404778 3:126670791-126670813 GAAAACATACAGTTGAAAATTGG - Intergenic
961470954 3:127112156-127112178 GAAAAGCTACACATAGAAAAAGG - Intergenic
962015599 3:131436994-131437016 GAAGACATACAAATGGCAAACGG + Intergenic
962587243 3:136854480-136854502 GAAAATATCCAGTTAAAAAACGG + Exonic
962779109 3:138694460-138694482 CAAAATTTAAAGAGGGAAAAAGG - Intronic
962779513 3:138698817-138698839 GAAAATATACCTATGAGAAAAGG + Intronic
963013117 3:140794074-140794096 CAAATTATAAAGATGGAGAACGG + Intergenic
963434265 3:145247827-145247849 TAAAATAAAATGATGGAAAAAGG - Intergenic
963487608 3:145955333-145955355 GAAAATCTACACATTGAAATAGG - Intergenic
963694288 3:148545320-148545342 GAAAATAAATTAATGGAAAAAGG - Intergenic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
963945285 3:151139243-151139265 GAAAATATACACAATGAACATGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
964804316 3:160590235-160590257 GAAAATAAATGGATGGAAAAAGG + Intergenic
965027498 3:163320904-163320926 AAAAATAGACATATAGAAAACGG - Intergenic
965188464 3:165498159-165498181 GAAAAGAAACACATGGAAAGTGG + Intergenic
965724360 3:171698505-171698527 GAAAAGATACAGAAAGAAAAGGG + Intronic
965726530 3:171722579-171722601 GAAAACATCCAGATACAAAAAGG - Intronic
965832791 3:172813442-172813464 GAAAAGTTCCTGATGGAAAAAGG - Intronic
965956948 3:174382112-174382134 GAAAATTTTTAGAGGGAAAAAGG - Intergenic
966132253 3:176654342-176654364 GAAAATATACATTTGGGAATAGG - Intergenic
966394149 3:179484570-179484592 GGCACTATACAGATGGCAAAGGG - Intergenic
966619356 3:181946979-181947001 AAAAATATGGATATGGAAAAGGG + Intergenic
967502263 3:190212364-190212386 GAAGATAAACAAATGGCAAATGG + Intergenic
967558556 3:190890503-190890525 GAAGATATACAGAATGGAAATGG - Intronic
968011996 3:195288510-195288532 GAAAATATTCAGGGGAAAAAAGG + Intronic
968906186 4:3452121-3452143 GAAAATAAACAAATTGAACAGGG + Intergenic
969044496 4:4326975-4326997 GAAAATACAAAGAAGTAAAAAGG + Intergenic
969579156 4:8053993-8054015 GCAATAATACAGATGGAACAAGG - Intronic
970173868 4:13317123-13317145 GAAGATATACAAATGGCCAATGG - Intergenic
970385981 4:15557023-15557045 ACAAATATACAGACTGAAAAAGG - Intronic
970617811 4:17783891-17783913 GAAATTATGCAGATTTAAAAAGG + Intergenic
970639844 4:18051755-18051777 GGATATATACATATGGAAATTGG - Intergenic
970961757 4:21879607-21879629 GAAAGTATCAAGAAGGAAAATGG + Intronic
971004125 4:22355238-22355260 TAAAATAAAAAGATGGAAAAAGG + Intronic
971014010 4:22468778-22468800 AAAAAGATAGAGATGGAAGAAGG + Intronic
971624885 4:28906726-28906748 GAAAATTTACAGCTGGATCAAGG - Intergenic
971831053 4:31695193-31695215 CAAAATATACAGAATGAAAGTGG - Intergenic
971971120 4:33622464-33622486 AAAAATATAAAGATGGTGAAAGG - Intergenic
972059133 4:34846422-34846444 GAAAATATCCAGATGCAATGGGG + Intergenic
972130153 4:35822735-35822757 GACAAAAAACAGATGAAAAAGGG + Intergenic
972237177 4:37147732-37147754 GAAAGTATACAAATGTAAATAGG - Intergenic
972262764 4:37427150-37427172 GAAAGTATACAGATGGAGTTTGG - Intronic
972435262 4:39027730-39027752 GAAAAAAGACAGAAAGAAAAAGG - Intronic
972554765 4:40170713-40170735 AAAAAGATACAGCTGAAAAAAGG - Intergenic
972864088 4:43209099-43209121 GAAAATATCCAGAGGACAAATGG + Intergenic
972975552 4:44630433-44630455 GAAACTACACAGAGGGGAAAAGG + Intronic
973127095 4:46600220-46600242 GAAGATATACAAATGCAAACAGG + Intergenic
973233863 4:47874656-47874678 GAACATATGCTGTTGGAAAAAGG + Intronic
973574444 4:52272974-52272996 GAAGATATACAGTTGGCCAAAGG + Intergenic
973916249 4:55637031-55637053 GAAAGTATAGAGATGGAAAGAGG - Intergenic
974198440 4:58607597-58607619 TAAAACATACAGAAGGAAGAAGG - Intergenic
974229888 4:59097198-59097220 CAAAATATAAAGATGCTAAAAGG - Intergenic
974465138 4:62245953-62245975 GAAAATACACAGTTAAAAAAGGG + Intergenic
974552686 4:63398749-63398771 AAAAATATAAATAAGGAAAATGG + Intergenic
974599600 4:64060313-64060335 AAAAATATTCAGATTTAAAAAGG + Intergenic
974771284 4:66417299-66417321 GAAAATATAGAGGTAGAAAGTGG - Intergenic
975020324 4:69479005-69479027 GAAGATATACAAATGGTGAATGG + Intergenic
975248752 4:72152246-72152268 CAAAAAATACACAGGGAAAATGG - Intergenic
975338191 4:73205948-73205970 GAAAACATACACATGGCCAATGG + Intronic
975708015 4:77129922-77129944 GAAGACATACAAATGGCAAACGG - Intergenic
975962671 4:79932174-79932196 GAAAATAAACGGATGAATAAAGG + Intronic
976066322 4:81191716-81191738 GAAAATATACACATCGAAAAGGG + Intronic
976109313 4:81654194-81654216 TAAAATATACAGAGGCAATAAGG + Intronic
976120085 4:81770603-81770625 GAAAATATAGCATTGGAAAAAGG + Intronic
976192608 4:82502495-82502517 GAAATGATAAAGATGGTAAAGGG + Intronic
976292613 4:83435939-83435961 GAAAATAAAAGAATGGAAAAAGG + Intronic
976348917 4:84038221-84038243 GAAAACAAACAGAAGGAAATGGG - Intergenic
976842882 4:89452356-89452378 AAAACTATAGAGATGGTAAAAGG + Intergenic
976887775 4:90007381-90007403 GAAATGATACAGGGGGAAAATGG + Intergenic
976920409 4:90434375-90434397 GAATACATACAGGTAGAAAAGGG - Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977181722 4:93883223-93883245 AAGAATATACAGACTGAAAAAGG - Intergenic
977303821 4:95298631-95298653 GAAAAAATACAGCAGGAAAAGGG - Intronic
977433110 4:96957296-96957318 GAAAATATTCAGAGGGTAAAGGG + Intergenic
977649855 4:99456846-99456868 GAAAAGAAATACATGGAAAATGG + Intergenic
978307697 4:107349829-107349851 CAAGATGTATAGATGGAAAAAGG + Intergenic
978416753 4:108485027-108485049 GAAAATAGACAGATAGATGAAGG + Intergenic
979040794 4:115791051-115791073 GAAAATGCAAGGATGGAAAAAGG - Intergenic
979072703 4:116229853-116229875 GAACATAAAAAGATGAAAAAAGG + Intergenic
979141135 4:117176017-117176039 TAAAAAATTCAGATGGAAATAGG - Intergenic
979412701 4:120398050-120398072 GAAAAAATGATGATGGAAAATGG + Intergenic
979521129 4:121668204-121668226 AAATATATATAAATGGAAAATGG + Exonic
979677497 4:123426181-123426203 GAAGACATACAGATGGCAACAGG - Intergenic
980483364 4:133419717-133419739 TGAAATATAGAGATCGAAAATGG - Intergenic
980593026 4:134916429-134916451 GAAAATATACAGATTGCCTATGG + Intergenic
981230208 4:142344555-142344577 AAAAGTGTACAGCTGGAAAAAGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981342909 4:143642981-143643003 GAAGATATACAAATGGCCAACGG + Intronic
981450710 4:144894634-144894656 GAGACTATACAGATGGATAGTGG + Intergenic
981453165 4:144921999-144922021 TAAAATGTTCAGATGGATAAAGG + Intergenic
981454577 4:144938710-144938732 GAAAATATAAAGCAGGGAAAGGG + Intergenic
981521608 4:145668219-145668241 GAATATAAACAGAAGCAAAAAGG - Intergenic
981860094 4:149344350-149344372 GAAAATATATAGATAGTAACAGG - Intergenic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
981950936 4:150406487-150406509 GAAAATAAAATAATGGAAAAAGG + Intronic
982263008 4:153511656-153511678 ATACATATATAGATGGAAAAAGG - Intronic
982279686 4:153670123-153670145 GAAAATATATAAATGGCCAAGGG - Intergenic
982326254 4:154131766-154131788 TACAATATACAGAATGAAAAAGG + Intergenic
982687192 4:158505022-158505044 GAAAATATACATATGTAAAATGG + Intronic
982841445 4:160192845-160192867 GAAAATATAAAGATTAAAATTGG - Intergenic
982971170 4:161989112-161989134 TAAAATAGACATCTGGAAAAGGG + Intronic
982989285 4:162250322-162250344 GAAAAAACACAGAAGTAAAAGGG + Intergenic
982995063 4:162333424-162333446 GAAAATATTAAGTGGGAAAATGG - Intergenic
983249965 4:165332138-165332160 AAAAATGTACATATGGATAAAGG - Intronic
983387311 4:167081790-167081812 GAAAATATATAGATACAGAATGG + Intronic
983401039 4:167266167-167266189 GAAGATTTACAGACAGAAAAAGG - Intergenic
984120841 4:175741227-175741249 GGAAAGATACAGAGAGAAAAGGG - Intronic
984498726 4:180531917-180531939 GTAAAAATACAGATGGAATTTGG - Intergenic
984567906 4:181353079-181353101 GAAAATATTCAGGTGTATAATGG + Intergenic
984642163 4:182178868-182178890 GAAAATTTACAGATGTATACAGG - Intronic
984850132 4:184145348-184145370 GAAAAAATAAAGAAGAAAAAGGG - Intronic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
985325513 4:188764420-188764442 AAAAATAAACAGATTAAAAAAGG + Intergenic
986020026 5:3792794-3792816 GAAAATAAACAGATCTAAAGTGG + Intergenic
986033524 5:3915989-3916011 GAAAAAACACAGATGGTCAAAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986437654 5:7749967-7749989 GAAAGTAGAAAGATGGAACAAGG - Intronic
986570772 5:9162716-9162738 GAAAATATAATGATGAAAGAAGG - Intronic
986657144 5:10025337-10025359 TAAGACATACAAATGGAAAACGG - Intergenic
986859549 5:11910973-11910995 GAAAATGTACCTAGGGAAAAAGG - Intergenic
987326605 5:16817309-16817331 GCAAACAGGCAGATGGAAAAGGG + Intronic
987497109 5:18660275-18660297 AGAGATATACAGATAGAAAATGG - Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987616715 5:20283464-20283486 GAAGACACACAAATGGAAAACGG + Intronic
987798091 5:22655528-22655550 CAACATATACAAATGCAAAATGG - Intronic
987845918 5:23285643-23285665 GAAAAAAGAGAGATGGAAAAAGG - Intergenic
987947451 5:24630120-24630142 AAAAATATACAAAAGGAATAAGG + Intronic
988007125 5:25429960-25429982 TAAACTATACAGATTGAATATGG + Intergenic
988214976 5:28260287-28260309 AAAACAATACATATGGAAAAAGG - Intergenic
988277564 5:29101478-29101500 GAAAATATACAGATGACACTTGG + Intergenic
988320775 5:29693443-29693465 AAAACTATACAGACAGAAAAAGG - Intergenic
988376474 5:30441559-30441581 GAAAATAAAGGGATGGAAAAAGG + Intergenic
988978590 5:36540933-36540955 GAAGATATACAAATGGGCAACGG - Intergenic
989111589 5:37912028-37912050 GAAAATATACTTATGCACAATGG + Intergenic
989483362 5:41959168-41959190 GAAGATATACGGATGGCTAATGG - Intergenic
989786157 5:45333264-45333286 GAAGACATACAAATGGCAAACGG - Intronic
989836907 5:46005147-46005169 GCAAATGTACAGTTAGAAAAGGG - Intergenic
989979207 5:50622348-50622370 GAAGATATGGAGATGAAAAAAGG - Intergenic
990003388 5:50921001-50921023 GAACATATACATATGGAATGAGG - Intergenic
990144042 5:52738509-52738531 GAAAATATAAGGAAGGAAATGGG - Intergenic
990202601 5:53395117-53395139 GAAAACATACAAATGGCAACAGG - Intergenic
990465839 5:56070478-56070500 GAAAATAAATATATGGAAAGAGG + Intergenic
990497767 5:56365993-56366015 GAAAATATAAATATGGTATAGGG + Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990683671 5:58275717-58275739 GAAAATTTATAGACGAAAAAGGG - Intergenic
991207280 5:64064241-64064263 GACAATATACAAATGGCGAATGG - Intergenic
991672118 5:69058059-69058081 GAAGAAATACAAATGGCAAATGG - Intergenic
991672369 5:69061422-69061444 GAAAATAAAGGGATAGAAAAAGG - Intergenic
993205892 5:84877922-84877944 GAAGATATACAAATGGCAAACGG + Intergenic
993452546 5:88090433-88090455 GAAAATATACAGATTGCCAAGGG + Intergenic
994103285 5:95917479-95917501 GAAAAGATCCATAAGGAAAATGG + Intronic
994328659 5:98480074-98480096 AAAAATATAGGGATGGGAAATGG + Intergenic
994344345 5:98667087-98667109 GAAAATAAAGGAATGGAAAAAGG + Intergenic
994588617 5:101744663-101744685 GAGACGATACAAATGGAAAAAGG + Intergenic
994827865 5:104739094-104739116 TAAAATACAGAGAAGGAAAAAGG + Intergenic
994865722 5:105267175-105267197 GAAAATATATATAAGGAAGATGG - Intergenic
995003766 5:107166179-107166201 GAAAAAATATAGAGGGATAAGGG + Intergenic
995449951 5:112289594-112289616 GAAAACATCCAGAGGGCAAAGGG - Intronic
995757848 5:115528988-115529010 GAAAATATACAGAAAGAAGCAGG + Intronic
995904841 5:117111178-117111200 GAAAATATGAATATGCAAAAGGG + Intergenic
995916776 5:117256146-117256168 GAGAATTTACAGCTGGAAAGAGG + Intergenic
996235150 5:121118921-121118943 GAAAATAAAAGAATGGAAAAGGG + Intergenic
996704091 5:126479189-126479211 GAAAAAATAAAAAAGGAAAAAGG - Intronic
997331052 5:133062102-133062124 GATGAAATACAGCTGGAAAATGG + Intronic
997443288 5:133923897-133923919 GAGAATTTACAGACAGAAAAAGG - Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997761121 5:136448281-136448303 GAAAATACAGAGCTGCAAAATGG + Intergenic
998058436 5:139099137-139099159 GAAGACATACAAATGGCAAACGG + Intronic
998309199 5:141110205-141110227 GAAAATTTATTGAGGGAAAAAGG + Intronic
998314495 5:141169317-141169339 GAAAAGATATAGATTGAAAAAGG - Intergenic
998344811 5:141452570-141452592 AAAAATACAAAGATGGAAAGGGG - Intronic
998540707 5:142978802-142978824 GAAAATATAAAGAAGCATAATGG + Intronic
998695533 5:144634041-144634063 GAAAATAAAGGGATGGAACATGG + Intergenic
998937196 5:147241612-147241634 GAAATTATATAGCTGGAAAGGGG + Intronic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
999849351 5:155521959-155521981 GAAAATAGAGGGATTGAAAAAGG - Intergenic
1000366872 5:160500035-160500057 GAAAATCTACAAATGGAGAGGGG + Intergenic
1000625696 5:163535567-163535589 GAAAATGTCCAGGTTGAAAAGGG - Intergenic
1000760735 5:165221187-165221209 GAATATATGAAGATGAAAAATGG - Intergenic
1001737929 5:174022249-174022271 GAAAAAATAAAGATAAAAAAAGG - Intergenic
1002952302 6:1826018-1826040 AAAAATAAAAAGATAGAAAATGG + Intronic
1002988886 6:2219193-2219215 TAAAATATAAAGATGCAAATGGG - Intronic
1003798409 6:9632006-9632028 TTAAAATTACAGATGGAAAAGGG + Intronic
1004324230 6:14659386-14659408 GAGAAATTACAGATGGAAAGAGG - Intergenic
1004450840 6:15744785-15744807 TAAAATATACAATTGAAAAAAGG + Intergenic
1005034980 6:21547273-21547295 CAAGATAGCCAGATGGAAAAGGG + Intergenic
1005173689 6:23018828-23018850 GAAAATTTAAAGATAGTAAAAGG + Intergenic
1005367549 6:25094376-25094398 GAAAATATAAGGAGGGAAATAGG + Intergenic
1005426805 6:25711217-25711239 GACAAGATAAAGATGGATAATGG - Intergenic
1005503353 6:26449313-26449335 GAAATGATACAGATTGAGAAGGG + Intronic
1005640258 6:27789242-27789264 GAAGAAATAGAGAAGGAAAAGGG + Intergenic
1005926932 6:30452271-30452293 GAAAATATTCACATGAGAAAAGG + Intergenic
1006553849 6:34848668-34848690 AAAAATAAAGGGATGGAAAAAGG - Intronic
1007140884 6:39572773-39572795 GAAAAGAGACAGCTGGATAAAGG - Intronic
1007410734 6:41659847-41659869 AAAAAAAGGCAGATGGAAAAGGG + Intergenic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1007932158 6:45701304-45701326 GAAAATGTAAAGATGAACAAAGG - Intergenic
1008396369 6:51012409-51012431 GAAAATTTACAGATAAGAAAAGG - Intergenic
1008802524 6:55387274-55387296 GAAAATATAAGGGTGGAAAATGG - Intronic
1008816492 6:55573623-55573645 GAAAATATTCAGATTGAATACGG + Intronic
1008847718 6:55988014-55988036 GAAGACATACAAATGGTAAACGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008916557 6:56794251-56794273 AAAAATAAAGAGATGGTAAAAGG - Intronic
1009923662 6:70094399-70094421 CAAAATACACATATGGAAACAGG + Intronic
1010099888 6:72091787-72091809 TAAATTATCCACATGGAAAATGG - Intronic
1010139162 6:72593517-72593539 GAAAATAGAAAAATGGAAGATGG - Intergenic
1010183166 6:73112068-73112090 GAAAATATATGGATGGCAAAAGG - Intronic
1010346609 6:74817869-74817891 GAAAATGAAGAGTTGGAAAAAGG + Intergenic
1010425430 6:75723882-75723904 AAATATATACAGCTGAAAAATGG + Intergenic
1010939752 6:81902639-81902661 GAAAATATAGAGATGAAAGATGG + Intergenic
1011207491 6:84915378-84915400 GAAAAAAAAGAGGTGGAAAAGGG - Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011359564 6:86509406-86509428 GAAAGTAGAGAGATAGAAAATGG - Intergenic
1011372555 6:86652687-86652709 AAAATTTTAGAGATGGAAAACGG - Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012045982 6:94273675-94273697 GAAAATATACAGTTTCCAAATGG + Intergenic
1012225373 6:96697616-96697638 GAAGACACACAAATGGAAAATGG + Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012505347 6:99940285-99940307 GAAAATACACAGTCAGAAAAAGG - Intronic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1012703413 6:102492729-102492751 GAAAATAAACAGAATGAACAAGG - Intergenic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013895339 6:115081276-115081298 GAAACTAGGCGGATGGAAAAAGG + Intergenic
1013922581 6:115426224-115426246 GAAGACATACAGATGGCCAACGG + Intergenic
1013976726 6:116087632-116087654 GAGAAGATACAGAAGGAACAGGG + Intergenic
1014683299 6:124461854-124461876 GAAAAAAGAAAGATGGAAAAAGG - Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1015583560 6:134752730-134752752 AAAATTATACAGAAGGTAAAGGG + Intergenic
1015641868 6:135343076-135343098 TAGAATATACAGATTCAAAAAGG + Intronic
1015716039 6:136192877-136192899 GAAAACATACAGATGAACATGGG - Exonic
1015809296 6:137145788-137145810 GAAAATAATCAGTTGGTAAATGG + Intronic
1015885581 6:137914918-137914940 GAATATATACTAAGGGAAAAAGG - Intergenic
1016474217 6:144408846-144408868 GAATATCTAGAGGTGGAAAAGGG - Intronic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016646567 6:146416042-146416064 GAAAATCAAAGGATGGAAAATGG - Intronic
1016854860 6:148657216-148657238 GAATATTTATAGATGAAAAAGGG - Intergenic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017056554 6:150441867-150441889 GAAATATTACAGATGGAACAGGG + Intergenic
1017340274 6:153313192-153313214 CAAAATATACATGTGGAAGAAGG - Intergenic
1017631029 6:156396851-156396873 GAAAATGTAGAGGAGGAAAAAGG + Intergenic
1017651206 6:156584141-156584163 GAAGACATACAAATGGCAAACGG + Intergenic
1018132574 6:160746891-160746913 GGAAATATACAAATAAAAAATGG - Intronic
1018458567 6:163975434-163975456 GATGATAGACAGGTGGAAAATGG + Intergenic
1019097119 6:169591241-169591263 GAACACATACAGATGGCCAATGG - Intronic
1019106651 6:169673203-169673225 AACAAAATACAGAGGGAAAATGG + Intronic
1019577100 7:1742842-1742864 AAAAATATAATGATGTAAAATGG - Intronic
1020062690 7:5164465-5164487 GAAGATATACAGGTGGAGACCGG + Intergenic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020842028 7:13230097-13230119 GAAGAGAGACAGAGGGAAAAAGG - Intergenic
1020917730 7:14217399-14217421 GAAATTATACAGATTGCAACTGG - Intronic
1020934500 7:14445279-14445301 TAAAATATATAGTGGGAAAAGGG - Intronic
1021058076 7:16075475-16075497 GATAGTATACAGACGGCAAAGGG + Intergenic
1021093622 7:16510727-16510749 GATAATATACCGATATAAAAGGG + Intronic
1021206769 7:17789870-17789892 GAAAAGGGAAAGATGGAAAAAGG - Intergenic
1021456388 7:20833551-20833573 AAAATTATAGAGATGGAGAACGG + Intergenic
1022136959 7:27457904-27457926 GAAAAAGGACAGAAGGAAAATGG + Intergenic
1022323683 7:29310429-29310451 GAAAATATAAAGATTGAAACGGG + Intronic
1022707390 7:32816510-32816532 GAAAAGATTCAGATGGAAAGTGG + Intergenic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1022915523 7:34946437-34946459 GAAAAGATGTAGATGGAAAGCGG - Intronic
1022983400 7:35625862-35625884 GAAAGTAAAAGGATGGAAAAAGG - Intergenic
1023204780 7:37736259-37736281 GAATATATGCAAATGGAAAAAGG + Intronic
1023429258 7:40072578-40072600 GCAAATCAACACATGGAAAAAGG + Intronic
1023538746 7:41241732-41241754 GAAAATATATAGTTGGGAAGAGG + Intergenic
1023646459 7:42321857-42321879 GAAGATATACAGATATGAAAAGG - Intergenic
1024028171 7:45432139-45432161 GAAAATAGAAAGTTGGACAAAGG + Intergenic
1024654911 7:51443865-51443887 TAATATATACATATGTAAAAGGG - Intergenic
1024745164 7:52398102-52398124 TAAAATAAAGGGATGGAAAAAGG - Intergenic
1024789773 7:52951517-52951539 AAATATATACAGATTGGAAAGGG + Intergenic
1024793297 7:52992051-52992073 GAAAATATACTCAGGGAAAATGG - Intergenic
1025158078 7:56628233-56628255 GAAAATATAAAGACAGGAAAAGG - Intergenic
1025593488 7:62894425-62894447 GAAAATATACATTTGCAGAATGG + Intergenic
1026327136 7:69320504-69320526 GAAAACACACAAATGCAAAAAGG + Intergenic
1026926183 7:74195545-74195567 GAAAAAGGACAGAAGGAAAATGG - Exonic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1027544473 7:79509525-79509547 GAAAACAGAGAGATTGAAAATGG - Intergenic
1027568389 7:79829172-79829194 GAAAATTTACAGTTTGAAACAGG - Intergenic
1027856959 7:83523717-83523739 GAAAATACATAGATAGGAAAAGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028444472 7:90904563-90904585 AAAAATACAAAGATGAAAAATGG + Intronic
1028628692 7:92908163-92908185 GAAGATATACAGACAGCAAATGG + Intergenic
1029087380 7:98022021-98022043 GAAACCATCCAGAGGGAAAAGGG - Intergenic
1029106633 7:98182447-98182469 GGAAATATACAAATGGCAATAGG + Intronic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1029453892 7:100657459-100657481 GAAGAGAGACAGATGGAGAAAGG - Intergenic
1029952104 7:104597335-104597357 TAAAATATAAAGAGTGAAAATGG - Intronic
1030314954 7:108104976-108104998 GAAAATAGAGAGTTAGAAAAGGG + Intronic
1030452174 7:109725687-109725709 GAAGATACACAGATGAAAATTGG - Intergenic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1030706529 7:112698192-112698214 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1031159343 7:118147389-118147411 GATAATATATAGATGGTAAAAGG + Intergenic
1031354445 7:120773987-120774009 GAAAAGACACAGAGAGAAAAAGG - Intergenic
1031756761 7:125653935-125653957 GAAGATATACAAATGGCCAACGG - Intergenic
1031880419 7:127191925-127191947 GAAGATAGAAAAATGGAAAATGG - Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032337737 7:131042146-131042168 GTAAAAATACAGAGGGAAGAAGG + Intergenic
1032732109 7:134653911-134653933 GAACAGGTACATATGGAAAATGG - Intronic
1033530591 7:142258973-142258995 GAATATATACAGATGGTAAATGG + Intergenic
1033814245 7:145053084-145053106 GAGAATATGCACCTGGAAAAGGG - Intergenic
1033848741 7:145468186-145468208 GAAAATATTTAGAAGCAAAAAGG - Intergenic
1034001999 7:147424618-147424640 GTCAACATACAGATGGAATATGG - Intronic
1034356498 7:150454343-150454365 GACAATAGACAGCTGGAGAAGGG + Intronic
1035526955 8:321459-321481 GAAATTAAACAGAGGGAACAAGG - Intergenic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1036610054 8:10341920-10341942 GGAAATGCACTGATGGAAAATGG - Intronic
1037097510 8:15003193-15003215 TAAAATTTACTGAAGGAAAATGG + Intronic
1037097648 8:15004638-15004660 TAAAATTTACTGAAGGAAAATGG - Intronic
1037378166 8:18254963-18254985 GAAAATAAACAATTGTAAAATGG + Intergenic
1037462308 8:19123673-19123695 GAAGATTTACAGATGGCAAATGG - Intergenic
1037512441 8:19597681-19597703 GAGAAAATACAGATGTTAAAAGG + Intronic
1038094658 8:24294431-24294453 GAGAATATACAGAAATAAAAGGG + Intronic
1038161669 8:25045445-25045467 GAAAATCAACAAATGGAAATGGG + Intergenic
1038177276 8:25192486-25192508 AAAAGAATACAGATGGAAATGGG - Intronic
1038427768 8:27475602-27475624 AAAAATCTACAGATGGACAGTGG + Intronic
1038585157 8:28781730-28781752 AAAACTATACAGATAGTAAAAGG + Intronic
1038730867 8:30126550-30126572 GAAACTACATAGATAGAAAAAGG + Intronic
1038813694 8:30879054-30879076 GAGAATACACTGATGGCAAATGG - Intronic
1038860709 8:31386467-31386489 GAAGATATACAAATGGCAACAGG + Intergenic
1038933204 8:32218346-32218368 GAAAAGTGACATATGGAAAATGG - Intronic
1039078838 8:33716256-33716278 TAAAATTTACAGATAGGAAATGG - Intergenic
1040381052 8:46873413-46873435 TAAAAAATATAGATGGAAAATGG + Intergenic
1041061320 8:54037525-54037547 TAAATTACAGAGATGGAAAATGG - Intergenic
1041124276 8:54619374-54619396 GGTAATACAGAGATGGAAAAAGG - Intronic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042251972 8:66765334-66765356 GAAAATATACAAATGGCCACAGG - Intronic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1042588867 8:70374892-70374914 GAAAATATAGATAAGTAAAAAGG - Intronic
1042646608 8:70993862-70993884 GGAAATCTACAGATGCAAACAGG - Intergenic
1042843541 8:73148267-73148289 GAACTTAGACAGGTGGAAAAAGG + Intergenic
1042980629 8:74522943-74522965 GAAAATAAAGGGATGGAAGAAGG + Intergenic
1042987756 8:74603219-74603241 GAAACTACACAGATGGATCATGG + Intronic
1043405306 8:79926119-79926141 GAATACATACATATGGAAAGGGG + Intronic
1043547779 8:81334637-81334659 GAAAAGATACAGAGGTGAAATGG - Intergenic
1043548897 8:81346241-81346263 GAAGATATACAAATGGCTAATGG - Intergenic
1043937165 8:86155265-86155287 GAAAAGACACTGATGGGAAAGGG + Intergenic
1043948491 8:86281419-86281441 GAAAATATAGAAATAGAGAACGG + Intronic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044206909 8:89501402-89501424 GAAAAGAAATAGAAGGAAAAAGG + Intergenic
1044377287 8:91491126-91491148 GAAAGTATACAGACGGTAACTGG + Intergenic
1044479604 8:92670016-92670038 TAAAATATAAAGATAGTAAAAGG - Intergenic
1044507215 8:93036004-93036026 ACAAATAGATAGATGGAAAATGG + Intergenic
1044707405 8:95022076-95022098 GAAAATATAAGGATTGAATAAGG + Intronic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045138516 8:99251136-99251158 AAAGGTATACAGATGGGAAATGG - Intronic
1045598754 8:103689824-103689846 GAAAATAAAGAAATGGAAAAAGG - Intronic
1045669910 8:104539065-104539087 GAAAGTCCACAGATTGAAAAAGG + Intronic
1045733088 8:105264112-105264134 GAAAATATGCATATTGAAGAAGG - Intronic
1045745392 8:105413405-105413427 CAAAATATACATATAAAAAAGGG - Intronic
1046171887 8:110519827-110519849 GAAATTGAAGAGATGGAAAAAGG + Intergenic
1046419609 8:113962618-113962640 GAATATATATAAATTGAAAATGG - Intergenic
1047268623 8:123332837-123332859 GAATATATATATATGGAAATTGG - Intronic
1047598415 8:126402230-126402252 GAAATTATAAAGAAGGAAAAAGG + Intergenic
1047605072 8:126466564-126466586 GAAAAGATACACAGGGCAAAGGG - Intergenic
1048416638 8:134234488-134234510 GAAATTAAAAAAATGGAAAAAGG + Intergenic
1048644236 8:136400237-136400259 GAAGAAAAAGAGATGGAAAAGGG + Intergenic
1048769117 8:137876824-137876846 GAAATTAAAAATATGGAAAAAGG + Intergenic
1048805163 8:138233896-138233918 GAAGACATACAAATGGCAAATGG + Intronic
1048997965 8:139805795-139805817 GAAAATACACAGAACGAAGAAGG + Intronic
1049086419 8:140481772-140481794 GCAAATATTCAGAGTGAAAATGG + Intergenic
1050712113 9:8476633-8476655 GAAAATGTATAGATTAAAAATGG - Intronic
1050959591 9:11711435-11711457 GAAAATATGGAGAGGAAAAAAGG - Intergenic
1051208832 9:14719838-14719860 GAAAATCTTTAGATGGAGAAAGG + Exonic
1051423764 9:16914424-16914446 GAAAATTTACACTTCGAAAACGG - Intergenic
1051649748 9:19310151-19310173 GATAATATACAAATTAAAAAAGG - Intronic
1051738523 9:20228496-20228518 ACAAATATGAAGATGGAAAATGG + Intergenic
1052103389 9:24479799-24479821 GAAGAAATAAAAATGGAAAATGG + Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052484311 9:29076436-29076458 GAAAATATAAAAACTGAAAAAGG + Intergenic
1052515894 9:29479076-29479098 GAGTATAGATAGATGGAAAAAGG - Intergenic
1052801756 9:32974923-32974945 GAAAAAATAAACAAGGAAAATGG + Intronic
1052856770 9:33411989-33412011 GAAAAAATAATGATGGAGAAAGG - Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1055547647 9:77396924-77396946 GAAAATATATAGATAACAAATGG - Intronic
1055612230 9:78034516-78034538 GAAAAGATACGGCAGGAAAAGGG + Intergenic
1056344426 9:85676414-85676436 GAAAATATATAAATGGGCAATGG + Intronic
1056562680 9:87746134-87746156 GAAAATATACATATACACAATGG - Intergenic
1056685995 9:88759839-88759861 GAAAGTAAAAAGAGGGAAAAAGG + Intergenic
1057436709 9:95047211-95047233 AAAAATATACAGTTTGAAAGTGG + Intronic
1057506640 9:95639426-95639448 GAACATATACAAATGGCCAATGG + Intergenic
1057540168 9:95960303-95960325 GAAAATAAACACTTTGAAAAAGG + Intronic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1057970300 9:99549912-99549934 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1058251256 9:102698109-102698131 GAAAATATAGAGAAGAAGAAAGG - Intergenic
1058406426 9:104680587-104680609 GAAGACATACAAATGGCAAAGGG + Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1059180906 9:112211233-112211255 GAACATATACAGAAGGAAAATGG - Intergenic
1059354375 9:113687638-113687660 GAAATTCTGCAGATGGGAAATGG - Intergenic
1059988793 9:119844938-119844960 GAAAATGTTCATATGAAAAATGG + Intergenic
1060253890 9:122008441-122008463 GAAAACATACAAATGGCCAATGG + Intronic
1060273152 9:122161787-122161809 GAAAATACACAGAAGGCCAAAGG - Intronic
1060659523 9:125396119-125396141 GAAAAGATACACATAGAAAAAGG + Intergenic
1060680317 9:125556851-125556873 GAAAATACACACAGGGCAAACGG + Intronic
1061027812 9:128061885-128061907 GAAAGTGTAAAGATGGAACAGGG + Exonic
1061938849 9:133873363-133873385 CAAGACATACAGATGGCAAAGGG + Intronic
1062596538 9:137302295-137302317 GCAAATATAAAGAAGGTAAAAGG - Intergenic
1203467803 Un_GL000220v1:104128-104150 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1203475628 Un_GL000220v1:148104-148126 GAAAAGAGACAGATGGCGAAAGG - Intergenic
1186112185 X:6270191-6270213 GAAAATATTCAGAAAAAAAATGG + Intergenic
1186390042 X:9149712-9149734 GAAGATATATAGACAGAAAAAGG - Intronic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1186830358 X:13384016-13384038 TAACATTTACAGATAGAAAAAGG + Intergenic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187566699 X:20457445-20457467 GAAAATATAAATTTGGAAAGGGG - Intergenic
1187681939 X:21776711-21776733 TGAAATTTAGAGATGGAAAATGG - Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1187846731 X:23546327-23546349 GAAAATACACAAATGCAAACAGG + Intergenic
1187864650 X:23713226-23713248 GAAAATGTACATATGAGAAATGG + Intronic
1188210450 X:27418180-27418202 AAAAATATATAGATAGAAACTGG + Intergenic
1188304033 X:28540618-28540640 GAAGACATACAAATGGCAAACGG + Intergenic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1188787977 X:34372349-34372371 GAAAAAATAAAGATAGAACAGGG - Intergenic
1188929790 X:36093534-36093556 GAAAACATACAAATGGCAAATGG - Intronic
1189196139 X:39154775-39154797 GAAAAAATAAAGTTGGAAATAGG - Intergenic
1190614964 X:52220848-52220870 GAAAATAAAAGGATGGAAAAAGG + Intergenic
1191819662 X:65290634-65290656 GAAAATATACATATACACAATGG + Intergenic
1192475688 X:71440138-71440160 AAAACTATAGAGATGGAGAACGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192597751 X:72429293-72429315 CAAAATGTACAGATTGAAACTGG - Intronic
1192608511 X:72544465-72544487 GAAAATGTACAGGTGGTAGATGG + Intronic
1192749365 X:73972536-73972558 GAAAACATACAAATGGTCAATGG - Intergenic
1192763515 X:74120433-74120455 AATAATATACAGATTGAAAGGGG + Intergenic
1193153737 X:78151312-78151334 GACAATAGAGAGATGGAAAAAGG - Intergenic
1193170539 X:78330781-78330803 GAAGATTTATAGATAGAAAAAGG - Intergenic
1193172689 X:78355055-78355077 GAAGACATACAAATGGCAAACGG - Intergenic
1193509876 X:82385736-82385758 GAAAATATTCTGAAGGAAGAAGG + Intergenic
1193655582 X:84193150-84193172 ACAAATATGCAGATGGATAAAGG - Intergenic
1193730625 X:85098118-85098140 GAAAATGAAATGATGGAAAAAGG + Intronic
1194024677 X:88736812-88736834 GAAAATAAATTGATTGAAAATGG - Intergenic
1194223944 X:91231323-91231345 GAAGACATACAAATGGCAAATGG + Intergenic
1194249612 X:91558833-91558855 GAAGACATACATATGGCAAAAGG + Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1194613851 X:96076898-96076920 GAAAATAAACAGGTAGAAAAAGG + Intergenic
1194885920 X:99316101-99316123 AAAAATAGAAAAATGGAAAAAGG - Intergenic
1195436963 X:104855425-104855447 GCCAATATACAGTGGGAAAATGG + Intronic
1195502255 X:105615043-105615065 GAAGATATACAAATGGCACATGG + Intronic
1195521631 X:105837139-105837161 TAAAATATGCAGATAAAAAATGG + Intronic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1195857158 X:109343777-109343799 AAAAATATACAGCTAGAACAAGG + Intergenic
1195986225 X:110633528-110633550 GAAGACATACAAATGGCAAATGG + Intergenic
1196107749 X:111914505-111914527 GAAAACATACAGTAGGAGAAAGG + Intronic
1196118242 X:112020229-112020251 AAAAATATACATCTGAAAAATGG - Intronic
1196356272 X:114797073-114797095 GCAAATCTGCAGCTGGAAAAAGG + Intronic
1196387364 X:115173107-115173129 GAAAAAATAAAGAGGAAAAATGG - Intronic
1196626555 X:117883818-117883840 GAAGACATACAAATGGCAAACGG + Intergenic
1196824038 X:119726862-119726884 GAAAATATAGACAGGCAAAAAGG - Intergenic
1197105208 X:122705658-122705680 GAAAATTAAGGGATGGAAAAAGG + Intergenic
1197332031 X:125164982-125165004 GAAAACATCCAGAAGGACAAAGG + Intergenic
1197851584 X:130867269-130867291 GTAAATATATAGTTGGAAAATGG + Intronic
1198104659 X:133450755-133450777 GAAGATTTACAGATAGAAAGAGG - Intergenic
1198281591 X:135148209-135148231 GAAGAGACACAGATGGAAATAGG + Intergenic
1198289368 X:135224313-135224335 GAAGAGACACAGATGGAAATAGG - Intergenic
1198449127 X:136748791-136748813 GAAAATATGCAGCTTAAAAATGG - Intronic
1198514706 X:137394239-137394261 GAAAACATACAAAAGGCAAATGG - Intergenic
1198696977 X:139352356-139352378 GAAAATAAAGGGGTGGAAAAAGG - Intergenic
1198766731 X:140087943-140087965 GATAACAGACAGATGGTAAAGGG - Intergenic
1198925297 X:141784853-141784875 GAAGACATACACATGGCAAATGG - Intergenic
1199149466 X:144413507-144413529 AAAAATAAAGGGATGGAAAAAGG - Intergenic
1199341533 X:146683262-146683284 GAAGACATACACATGGCAAACGG - Intergenic
1199418981 X:147620951-147620973 GAAGACATACAAATGGTAAATGG + Intergenic
1199891931 X:152093260-152093282 GATAATATACATATAGAGAAGGG - Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200560409 Y:4694704-4694726 GAAGACATACAAATGGCAAATGG + Intergenic
1200568569 Y:4800083-4800105 GAAGACATACATATGGCAAAAGG + Intergenic
1201277309 Y:12311296-12311318 GAAGATCTACAGATGGAAACAGG - Intergenic
1201552680 Y:15235188-15235210 GAAAAACTTCAGATGAAAAATGG + Intergenic