ID: 950581799

View in Genome Browser
Species Human (GRCh38)
Location 3:13867160-13867182
Sequence CCCACCTTGCTAGGTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950581799_950581808 13 Left 950581799 3:13867160-13867182 CCACTACCACCTAGCAAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 98
Right 950581808 3:13867196-13867218 CATTCTGCAGACTGTCAGAAAGG 0: 1
1: 0
2: 2
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950581799 Original CRISPR CCCACCTTGCTAGGTGGTAG TGG (reversed) Intronic
901493277 1:9607456-9607478 CCCACCTTGCACTGTGGGAGAGG + Intronic
904200213 1:28814649-28814671 CTCCCCTTGCTCAGTGGTAGTGG - Intronic
906147507 1:43568800-43568822 CCCAGCTTGCTAGGGGTTGGCGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069652813 10:70063051-70063073 CCCACCTTGCTGGCTGGCAGAGG + Intronic
1073313133 10:102558583-102558605 ACCACCTTGGTTGGTGGCAGTGG + Intronic
1073628272 10:105121592-105121614 CCCATCTTGGTAGATGTTAGTGG + Intronic
1075735601 10:124662848-124662870 CACACCTTGGTAGGTGCTAGAGG + Intronic
1081530541 11:43955824-43955846 CCCACCAGGCTAGGAGGAAGAGG - Intergenic
1084437709 11:69154053-69154075 CCCACCTAGCTAGGAGGCTGAGG - Intergenic
1089950732 11:122523784-122523806 CCCACCTTGATATGAGGCAGAGG - Intergenic
1092035270 12:5329167-5329189 CCCCCCTTGCTAAGTGATAATGG + Intergenic
1092924095 12:13258207-13258229 CCCACCTTTCTTGATGGTAGGGG + Intergenic
1096717871 12:53501818-53501840 CCCCCCTTGCTTTGGGGTAGTGG + Intronic
1096759383 12:53827400-53827422 CCCACCTTCCTAGGTGCTCCAGG - Intergenic
1098263365 12:68694060-68694082 ACCACCTGGCTAGGAAGTAGTGG + Intronic
1100100970 12:91105240-91105262 CCCACCTGGGTAAGTGGCAGAGG - Intronic
1103281788 12:119764120-119764142 CCCACCTTGGTGGGTGGTCGGGG - Intronic
1108698532 13:52924370-52924392 CTCTACCTGCTAGGTGGTAGGGG - Intergenic
1109202665 13:59448346-59448368 CCCACATTGCTTGCTGGTATGGG - Intergenic
1112801171 13:103111044-103111066 CCAACCTTCCTAGGTGAAAGGGG - Intergenic
1114266770 14:21076901-21076923 CCCAGCATGCTAGGTGGTAGAGG - Intronic
1122327523 14:100891443-100891465 CCCACCCTGCTGGGTGGTTTGGG - Intergenic
1124347342 15:28931433-28931455 CCCACTTTGCTAGGGGATGGGGG - Intronic
1126323083 15:47446188-47446210 CCCACCCTGCTAGGTGGAACAGG + Intronic
1132725398 16:1336227-1336249 CCTCCCTTGCTGGGTGGAAGAGG - Intronic
1136714252 16:32264241-32264263 CCCACATACCTAGGTGGTTGTGG + Intergenic
1136753643 16:32665176-32665198 CCCACATACCTAGGTGGTTGTGG - Intergenic
1136814470 16:33205189-33205211 CCCACATACCTAGGTGGTTGTGG + Intronic
1136820946 16:33315269-33315291 CCCACATACCTAGGTGGTTGTGG + Intergenic
1136827509 16:33371808-33371830 CCCACATACCTAGGTGGTTGTGG + Intergenic
1136832575 16:33470579-33470601 CCCACATACCTAGGTGGTTGTGG + Intergenic
1137636738 16:49993196-49993218 CCCCCTTTGTGAGGTGGTAGGGG + Intergenic
1138436459 16:57003407-57003429 CCCACCTGGCAAGATGGTTGTGG - Intronic
1142034435 16:87854810-87854832 CCCACCTGGCTGGCTGGCAGGGG + Intronic
1202993046 16_KI270728v1_random:28163-28185 CCCACATACCTAGGTGGTTGTGG + Intergenic
1203055801 16_KI270728v1_random:925528-925550 CCCACATACCTAGGTGGTTGTGG - Intergenic
1143461738 17:7108553-7108575 TGCACCTTGTCAGGTGGTAGTGG + Exonic
1143879553 17:10019604-10019626 CCCACTGTGCTGGGTGGTAGGGG - Intronic
1156497710 18:37536900-37536922 CCCACCTTGCCAGGGGGTGCTGG + Intronic
1161116426 19:2499397-2499419 CCCACATTGGGAGGTAGTAGTGG - Intergenic
1162419055 19:10555443-10555465 GCAACCCTGCTGGGTGGTAGCGG - Intronic
1163499256 19:17665954-17665976 CCCACCTTGCTATGTGGTCATGG - Intronic
1164598972 19:29548571-29548593 GCCTCCTTGCAAGGTGGCAGAGG + Intronic
1165930001 19:39351311-39351333 CCCACCTCTGGAGGTGGTAGGGG + Intronic
1166663058 19:44659802-44659824 ACCACTTTGCTGGGTGGTTGTGG - Intronic
1168585888 19:57591486-57591508 CCCACTGTGCAAGGTGGTAGAGG - Exonic
925995991 2:9293695-9293717 GGCACCGTGCTAGGTGTTAGAGG + Intronic
927836114 2:26400692-26400714 CACACCTGCCTAGGTGGTGGTGG - Intergenic
928160792 2:28922469-28922491 CAACCCTTTCTAGGTGGTAGGGG + Intronic
928403485 2:30996407-30996429 CCCACCTGGCTAGATGGCTGAGG - Intronic
945788808 2:214277934-214277956 CCCACCTTGCTGGGCTGTGGTGG + Intronic
947735427 2:232452055-232452077 CCCTCCTTGGTAGGTGGGATGGG + Intergenic
1169473285 20:5907384-5907406 CCCACCTACCTAGCTGGCAGAGG + Intergenic
1172097539 20:32467696-32467718 CCCACCTTGCCAGGCGGTTGAGG - Intronic
1173555557 20:43963111-43963133 GCCACCATTCTAGATGGTAGAGG + Intronic
1176179957 20:63745138-63745160 CCCACCTTGCTCGGTAAGAGTGG + Exonic
1181518996 22:23434645-23434667 CCCACCTTCCTTGGTGGTCCGGG + Intergenic
1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG + Intronic
950230567 3:11272275-11272297 CCCACTTAGCTCGGTGCTAGGGG + Intergenic
950459169 3:13111043-13111065 CGCACTTTGCTGGGTGGCAGGGG - Intergenic
950581799 3:13867160-13867182 CCCACCTTGCTAGGTGGTAGTGG - Intronic
950892124 3:16413441-16413463 GCCACCTTCCTATGGGGTAGTGG + Intronic
953754392 3:45634006-45634028 GCTACCTTGCTGGGTGCTAGGGG + Intronic
954486900 3:50861124-50861146 ACCACTTTGCTGGGTGGTGGAGG + Intronic
955335868 3:58085559-58085581 CCCACCTTGCTTAGTTCTAGTGG + Intronic
959034145 3:101340176-101340198 CCCCCCTTAGTAGGTGGTGGAGG + Exonic
962343118 3:134601786-134601808 GCCACCGTGCTGGGTGGCAGTGG + Intronic
963110399 3:141683444-141683466 CCCACCTTGGTAGGTGGCTCAGG + Intergenic
969044387 4:4326271-4326293 CTCTCCTGGCTAGGTGGTATTGG - Intergenic
969841799 4:9888394-9888416 CACACCTTGCAAGATGGCAGGGG - Intronic
970942876 4:21655898-21655920 GCCACCTTACTAGTGGGTAGAGG + Intronic
973707576 4:53595279-53595301 CCCACCTTGCTAGGGTGAAGAGG + Intronic
982641709 4:157969827-157969849 CCCATCTTGCAAGATGGTTGTGG - Intergenic
992550298 5:77852928-77852950 CCCAATCTGCTAGGTGGAAGGGG + Intronic
997456963 5:134024883-134024905 CTCAGCTGGCTAGGGGGTAGGGG - Intergenic
1000187209 5:158870728-158870750 CAGACCTTGCTATGTGGTTGTGG - Intronic
1001572387 5:172738647-172738669 CCCACCAGGCTAGGAGGTACAGG + Intergenic
1003579401 6:7326015-7326037 CCCAGCTTACTGGGTGGCAGGGG - Intronic
1006451318 6:34107279-34107301 CCCCCCTTGCCAGGGGCTAGAGG - Intronic
1006582259 6:35083853-35083875 CCCACCCTGGAAGGTGGGAGGGG + Intronic
1007700477 6:43763350-43763372 CCCTTCTTGCTGGGAGGTAGGGG + Intergenic
1010321444 6:74514898-74514920 ACCACCCTGTTGGGTGGTAGGGG - Intergenic
1015905655 6:138114039-138114061 CCCACCCTGTTGGGTGATAGAGG + Intergenic
1018986788 6:168643713-168643735 CTGACCTTGCTGGGGGGTAGAGG - Intronic
1019592285 7:1841681-1841703 CCCACCTTCCTTGGTGGTCCGGG - Intronic
1026938965 7:74275654-74275676 CCTGCCTTGCTGGGTGGTGGGGG - Intergenic
1027646457 7:80806953-80806975 ACCAGCTTGCTAACTGGTAGGGG - Intronic
1028055958 7:86243910-86243932 TCCACCTTGCTAGGTTTTAAGGG + Intergenic
1034076004 7:148231765-148231787 CTCACCTTGTTGGGTGGAAGGGG + Intronic
1034460474 7:151195388-151195410 CCCACTTTGCATGGTGGTGGTGG - Intronic
1034941622 7:155234323-155234345 GCCACCTTGCTGGATGGTTGAGG - Intergenic
1036017871 8:4806285-4806307 GCCACCTTCCTAGGGTGTAGCGG - Intronic
1038084582 8:24180513-24180535 CCCACCTTCTTAGGTGGTCCAGG - Intergenic
1038106483 8:24440938-24440960 CACAACTTGCTAGGTGCTTGAGG - Intronic
1038192708 8:25338556-25338578 CCCTCCTTTCCAGGTGGAAGTGG + Intronic
1038448903 8:27626280-27626302 CCCACCTGGCTAGGTCTAAGCGG - Intergenic
1042178211 8:66058503-66058525 ACCTCCTTGCTAAGTGGTAGTGG - Intronic
1043532436 8:81165954-81165976 TCCAGCTTGCTGGGGGGTAGGGG + Intergenic
1048461022 8:134622219-134622241 CGCACAAAGCTAGGTGGTAGGGG - Intronic
1049222087 8:141432875-141432897 TCCACCTTGTTAGGGGGCAGGGG + Intergenic
1056102207 9:83310850-83310872 CCCACCTTGCTAAGTGGGCTGGG - Intronic
1056844199 9:90023472-90023494 CCCACCAAAATAGGTGGTAGAGG - Intergenic
1060427482 9:123518750-123518772 CCCACCTGTCTAGGTGGTCTAGG + Intronic
1061128472 9:128690733-128690755 TTTACCTTGATAGGTGGTAGTGG + Intronic
1062189483 9:135240517-135240539 CCCACGTTGCCAGGTGGGGGTGG - Intergenic
1188488262 X:30706820-30706842 CCCACCCTGCCAGAAGGTAGTGG + Intronic
1191996885 X:67105336-67105358 CCCAGCTTCCTAGGGGGAAGGGG - Intergenic
1192571140 X:72206356-72206378 ACCACCTTGCAAGATGGTAAAGG - Exonic
1196475527 X:116080219-116080241 CTCCCCCAGCTAGGTGGTAGCGG - Intergenic
1197246572 X:124172845-124172867 CCTACTGTGCAAGGTGGTAGAGG + Intronic