ID: 950583915

View in Genome Browser
Species Human (GRCh38)
Location 3:13879855-13879877
Sequence CTGATCCCGCGGGCCGGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950583903_950583915 11 Left 950583903 3:13879821-13879843 CCGATTGGCCGCCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 86
Right 950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 132
950583908_950583915 3 Left 950583908 3:13879829-13879851 CCGCCGGGGCCGCGGGCCGGGCT 0: 1
1: 0
2: 5
3: 48
4: 381
Right 950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 132
950583902_950583915 12 Left 950583902 3:13879820-13879842 CCCGATTGGCCGCCGGGGCCGCG 0: 1
1: 0
2: 0
3: 6
4: 165
Right 950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 132
950583910_950583915 -6 Left 950583910 3:13879838-13879860 CCGCGGGCCGGGCTGTGCTGATC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 132
950583909_950583915 0 Left 950583909 3:13879832-13879854 CCGGGGCCGCGGGCCGGGCTGTG 0: 1
1: 0
2: 6
3: 57
4: 422
Right 950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 132
950583898_950583915 24 Left 950583898 3:13879808-13879830 CCGGTTCATAGTCCCGATTGGCC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950583915 Original CRISPR CTGATCCCGCGGGCCGGCCC CGG Exonic
900117037 1:1033326-1033348 CTGCGCCCGCGGCCCCGCCCTGG - Intronic
900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG + Intergenic
903190147 1:21651839-21651861 CGGCTCGCGCGGGCCGGGCCGGG - Intronic
906038272 1:42766680-42766702 CTGGTCCCCCAGCCCGGCCCAGG - Exonic
906062539 1:42958192-42958214 CCGAGCCCCCGGCCCGGCCCCGG - Intronic
916060999 1:161098553-161098575 CTGAGCCTGCGGCCCGACCCGGG - Exonic
917969692 1:180198748-180198770 CTGCTCCCTTGGGCTGGCCCTGG + Exonic
923161360 1:231317492-231317514 CGGCGCCCGCGGGCCGGCACGGG + Intergenic
923506438 1:234609738-234609760 CAGTTCCCCCCGGCCGGCCCGGG + Intergenic
1074823244 10:117197244-117197266 TTGATCCGCTGGGCCGGCCCTGG - Intergenic
1076605986 10:131690133-131690155 CAGTTCCCGTGGGCTGGCCCAGG - Intergenic
1076662223 10:132063174-132063196 CTGATCCCACAGCCCGTCCCTGG - Intergenic
1076784670 10:132743832-132743854 CTGAGCCCCGGGGCCGGCCTTGG - Intronic
1076792761 10:132785738-132785760 CCGCGCCCACGGGCCGGCCCAGG + Exonic
1077235659 11:1480932-1480954 CTGACCCCCCGGGCAGACCCTGG - Intronic
1078430037 11:11281488-11281510 CTCATCCTTGGGGCCGGCCCAGG + Intronic
1078580576 11:12536636-12536658 CTGAACCCACTGGCTGGCCCTGG + Intergenic
1083856779 11:65396879-65396901 CTGCTCGCCCGGCCCGGCCCTGG - Exonic
1084696083 11:70756367-70756389 CTGATCCTGGGGGCTGGCCACGG + Intronic
1087152056 11:94868098-94868120 CTGATCCAGCAGGCAGGGCCTGG - Intronic
1096284130 12:50283519-50283541 CTGCTCCTGCGGCCCCGCCCCGG + Intronic
1096774802 12:53957293-53957315 CTGATCCCGCTGCCCGCACCGGG + Exonic
1109062320 13:57633752-57633774 CGGAACCCCCGGGCCCGCCCAGG - Exonic
1113806048 13:113110445-113110467 CTGATCCCGAGGGCGCGCTCGGG - Intronic
1115752435 14:36505915-36505937 CTGAGCCCCCGGGCAAGCCCAGG + Intronic
1117141020 14:52791394-52791416 CTGCTCTCGCGCCCCGGCCCCGG + Intronic
1117842100 14:59870578-59870600 CTGCTGCCGCTGGCCGGCCCCGG - Exonic
1122658638 14:103279519-103279541 CAGCACCCGCGGGACGGCCCCGG - Intergenic
1122971050 14:105152381-105152403 CTGAGGCCGCCCGCCGGCCCTGG - Intronic
1123500814 15:20878826-20878848 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123558065 15:21452521-21452543 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123594293 15:21889802-21889824 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1124118257 15:26867367-26867389 CTCACCCTGCGCGCCGGCCCCGG - Intronic
1124340244 15:28885796-28885818 CCGATCCCGGAGACCGGCCCGGG + Intronic
1131160677 15:90102686-90102708 CTGATCCCGCTCGCGGGTCCCGG - Intergenic
1202966415 15_KI270727v1_random:179693-179715 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1132480845 16:165442-165464 GAGACGCCGCGGGCCGGCCCGGG - Intronic
1132579029 16:676733-676755 CTCATCCAGCGGCCCGTCCCGGG - Exonic
1132691361 16:1183200-1183222 CAGATCCCGAGGGCAGCCCCAGG - Intronic
1132699135 16:1214870-1214892 GTGCCCCCGCTGGCCGGCCCTGG - Intronic
1132765141 16:1530736-1530758 GAGAGCCCGCAGGCCGGCCCTGG + Intronic
1134107554 16:11494729-11494751 CAGACCCCGAGGGCCAGCCCTGG - Exonic
1136478258 16:30526453-30526475 CCGATCCCGCGACCCGGCCTCGG + Exonic
1136884469 16:33923117-33923139 CTGCCCCCGCTGGCCAGCCCGGG - Intergenic
1139421878 16:66854019-66854041 CTGCTGCCACGGGCAGGCCCTGG + Exonic
1141842131 16:86579860-86579882 CTGAACCCACAGGCCGACCCAGG - Exonic
1142144993 16:88489199-88489221 CTGCTCCCAGGGGCCGGGCCAGG - Intronic
1142349502 16:89573567-89573589 CTCATCACGCGGGCCAGGCCCGG - Intergenic
1142880407 17:2878968-2878990 CTGAGCCCGGAGGCCGGCGCTGG + Intronic
1143030367 17:3964151-3964173 GTGAGCGCGCGGGCCGGGCCGGG - Intronic
1143269490 17:5665350-5665372 CTGCTCCCACGGGGCGGTCCTGG - Intergenic
1144695879 17:17303597-17303619 CGGTTCCCGCGGGGCGGCGCGGG + Exonic
1144782056 17:17813379-17813401 CTGAGGCGGCGGGCAGGCCCCGG - Exonic
1147145623 17:38482832-38482854 CTGCCCCCGCTGGCCAGCCCGGG + Intronic
1148664248 17:49362385-49362407 CGCAGCCCTCGGGCCGGCCCGGG + Intronic
1150076284 17:62194898-62194920 CTGATCCCACGGTACGGCTCAGG - Intergenic
1151826667 17:76527700-76527722 CGGATCCCCCGGGGCTGCCCTGG + Exonic
1152155374 17:78629437-78629459 CAGAGCCTGCGGGCCGTCCCAGG - Intergenic
1152586398 17:81191369-81191391 CTGGCCCCGCGGGCCGGCTCCGG - Intronic
1158427624 18:57353415-57353437 CAGACTCCGCGGGCCGGGCCCGG + Intronic
1160321508 18:77900304-77900326 CGCCTCCCGCGGGCCGGGCCGGG - Intergenic
1161070049 19:2255517-2255539 CTGACCCCGCATGCCTGCCCTGG + Intronic
1161443314 19:4304706-4304728 CGGGGCCCGCGGGCCGGGCCGGG + Exonic
1162901046 19:13795675-13795697 CGGGTCCCGCGGGGCAGCCCCGG - Exonic
1162924482 19:13923369-13923391 CTGGTCCAGCGGCCTGGCCCGGG + Exonic
1165156919 19:33794863-33794885 CTGACCTCTCGGGCCGGGCCGGG + Intergenic
1165549622 19:36573235-36573257 CTCCTCCCGCAGCCCGGCCCGGG + Exonic
1167101611 19:47407316-47407338 GAGGGCCCGCGGGCCGGCCCGGG - Intronic
934763554 2:96868879-96868901 CCAATCCCGCTGGCCCGCCCAGG - Intronic
936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG + Exonic
946404059 2:219483525-219483547 CAGCTCCCGCGGCCCGGCCCGGG - Exonic
946607211 2:221418764-221418786 CTGAGCCCGTGGGCAAGCCCTGG - Exonic
947877981 2:233480417-233480439 CTGATGCCACGGGCAGGTCCTGG + Intronic
1168991930 20:2102799-2102821 CTCATCCCTCCGTCCGGCCCTGG - Exonic
1170569507 20:17624993-17625015 CTGATCCCTTGGGCCAGCTCTGG + Intronic
1171852199 20:30316696-30316718 GGGATCTCGCGGGCCGGGCCAGG - Intergenic
1172117967 20:32583297-32583319 CTCACCCCGCGGGCCCGGCCCGG + Intronic
1172274980 20:33674443-33674465 CTGAGCCCGCGCGTCGGCGCCGG - Intronic
1173243363 20:41317364-41317386 CTGAGACTGCGGGCCGGCCGCGG + Intronic
1174483348 20:50845937-50845959 CGGACCCCTCGGGCCAGCCCAGG - Intronic
1175756791 20:61535334-61535356 CTGAGCCTGAGGGCCGCCCCGGG - Intronic
1175935350 20:62511455-62511477 CTGGGCCCCCAGGCCGGCCCAGG + Intergenic
1180875219 22:19171948-19171970 CTCATCCTGCGGGCCGGCCCAGG - Intergenic
1181198182 22:21202733-21202755 CTGACCCTGCTGGCCGGCGCAGG - Intergenic
1185223504 22:49640602-49640624 CTGATGCCGCAGGCCAGGCCAGG + Intronic
1203228625 22_KI270731v1_random:92104-92126 CTGACCCTGCTGGCCGGCGCAGG + Intergenic
950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG + Exonic
952970873 3:38649534-38649556 CTGGTCCCCCGGCCGGGCCCCGG + Exonic
953226999 3:41030210-41030232 CTGATCCCTCGGGGAAGCCCTGG + Intergenic
954132514 3:48567734-48567756 CTGGTCCCCCAGGCCGCCCCGGG - Exonic
954337760 3:49929692-49929714 CTGTGCCCTCAGGCCGGCCCCGG - Exonic
960801597 3:121545741-121545763 CTGAGCCCGCCGCCCGGCCTTGG - Exonic
966874529 3:184314780-184314802 CTGGCCCCGCGGCCCGACCCAGG + Intronic
967028647 3:185586026-185586048 CTTGTCCCACGGGCCGGCTCCGG + Intronic
967780723 3:193436812-193436834 CTGATCCCCGGGGCCGGGCGCGG + Intronic
968063890 3:195747580-195747602 GTGAGCCCCCGCGCCGGCCCAGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968697921 4:2041847-2041869 CTGCTCCCGGGGGCAGCCCCCGG + Intronic
969447992 4:7256262-7256284 CTGGTCCCTCGTGGCGGCCCTGG - Intronic
971279940 4:25234409-25234431 CTGAAACCGCGGGGCGGCTCCGG - Exonic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
978954816 4:114599668-114599690 CTAATCCCGGGGGCCCGCACAGG - Intronic
980930019 4:139176542-139176564 CTCATCCCGCGGGGAGGCCAGGG - Intronic
985512092 5:318721-318743 CTGACCCCTCGGGCCAGGCCAGG - Intronic
985641484 5:1065369-1065391 CTGATCCAGTCGGCCGGCCTGGG - Exonic
985666393 5:1183616-1183638 CTCTTCCCTGGGGCCGGCCCTGG - Intergenic
986721493 5:10564001-10564023 CCCATCCCGCGGGCCGGCGGAGG + Intergenic
990545525 5:56816623-56816645 CAGATACCGCGGGCTGGGCCCGG + Intronic
995106518 5:108381987-108382009 CTGAGCCGGCTGGCCGGGCCCGG - Exonic
998903341 5:146878393-146878415 CTGGTCCCGCCCGCCCGCCCCGG + Intronic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1006369198 6:33633785-33633807 CGGAGCTCGCGGGCCGGGCCAGG + Intronic
1007785264 6:44276189-44276211 GCCAGCCCGCGGGCCGGCCCGGG + Exonic
1015776775 6:136822648-136822670 CTCATCCCGCCCGCCGCCCCCGG - Exonic
1018628730 6:165804790-165804812 CTCCGCCCGCGGCCCGGCCCCGG - Intronic
1019279608 7:193179-193201 ATGGCCGCGCGGGCCGGCCCGGG - Exonic
1020215787 7:6189140-6189162 GTGATTCAGAGGGCCGGCCCTGG - Intronic
1023522275 7:41060455-41060477 CTCATCCTGAGGGCTGGCCCAGG - Intergenic
1026773105 7:73214395-73214417 CTGGTCCTGTGGGCTGGCCCAGG + Intergenic
1027013967 7:74767791-74767813 CTGGTCCTGTGGGCTGGCCCAGG + Intergenic
1027074070 7:75178241-75178263 CTGGTCCTGTGGGCTGGCCCAGG - Intergenic
1029432333 7:100539371-100539393 CTGACCCCGCCGCCCGGGCCCGG - Exonic
1034945693 7:155260335-155260357 CAGCTCCTGGGGGCCGGCCCGGG - Intergenic
1040559927 8:48514829-48514851 CTGGACCCGCGGGCCAGCCAAGG + Intergenic
1043391576 8:79797078-79797100 CTGAACCCGGGGGCATGCCCGGG - Intergenic
1045111055 8:98940096-98940118 CTGTGCCCGCGCGCCGCCCCGGG + Intronic
1048234396 8:132675511-132675533 CTGACCCCGCAAGCCGGACCCGG + Exonic
1053151943 9:35749129-35749151 CAGGTCCCGCCGGCCGGCTCCGG + Exonic
1057864457 9:98667957-98667979 CTCATCCCACGGGGCAGCCCAGG + Intronic
1061123242 9:128657063-128657085 CAGACCTCGCGGGCCGGCCACGG - Intergenic
1061293717 9:129666174-129666196 CGGACCCCGCGCCCCGGCCCCGG - Intronic
1061883403 9:133578999-133579021 AGGATCCCGGGGGCGGGCCCAGG + Exonic
1062364696 9:136203154-136203176 CTGCGCCCGCGGGCCGCCCTGGG + Exonic
1189928923 X:45987196-45987218 ATGATTCAGCAGGCCGGCCCTGG + Intergenic
1191846571 X:65551609-65551631 CTGCTCACCCGGCCCGGCCCTGG + Intergenic
1198005465 X:132489305-132489327 CACAGCCCGCCGGCCGGCCCCGG - Intronic
1200121111 X:153791015-153791037 GTGCTCCAGCGGGCCGGCCCTGG - Intronic
1200138437 X:153885942-153885964 CGGTTACCGCGGGCCGGACCGGG + Intronic
1200239538 X:154486506-154486528 CGGACCCGGCGGCCCGGCCCGGG + Intronic