ID: 950584715

View in Genome Browser
Species Human (GRCh38)
Location 3:13883955-13883977
Sequence CAGGGTAGACAGGATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950584703_950584715 30 Left 950584703 3:13883902-13883924 CCTGGACAGATGGTGGGGAGAGA No data
Right 950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG No data
950584712_950584715 -10 Left 950584712 3:13883942-13883964 CCGAGTTTGAAGGCAGGGTAGAC No data
Right 950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950584715 Original CRISPR CAGGGTAGACAGGATAAGGA AGG Intergenic
No off target data available for this crispr